CN110551756A - reporter gene cell strain and construction method and application thereof - Google Patents
reporter gene cell strain and construction method and application thereof Download PDFInfo
- Publication number
- CN110551756A CN110551756A CN201910864683.8A CN201910864683A CN110551756A CN 110551756 A CN110551756 A CN 110551756A CN 201910864683 A CN201910864683 A CN 201910864683A CN 110551756 A CN110551756 A CN 110551756A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- reporter gene
- reporter
- vector
- gamma chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0681—Cells of the genital tract; Non-germinal cells from gonads
- C12N5/0682—Cells of the female genital tract, e.g. endometrium; Non-germinal cells from ovaries, e.g. ovarian follicle cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2503/00—Use of cells in diagnostics
- C12N2503/02—Drug screening
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Abstract
The invention provides a reporter gene cell strain and a construction method and application thereof, wherein the reporter gene cell strain comprises a reporter gene plasmid, and the reporter gene plasmid comprises an STAT6 signal response element; the STAT6 signaling response element comprises at least one copy of a STAT6 binding motif; the nucleotide sequence of the STAT6 binding motif is shown as SEQ ID NO. 1. The reporter gene cell strain is suitable for evaluating the specific binding of IL-4 and a receptor IL-4R thereof, is simultaneously suitable for blocking the binding of IL-4 and IL-4R alpha by an IL-4/IL4R alpha antibody, monitors and evaluates the activity of the IL-4/IL4R alpha antibody, has obvious specificity, short detection time and high sensitivity, and has important significance for monitoring and evaluating the activity of a monoclonal antibody.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a reporter gene cell strain, and a construction method and application thereof.
background
In recent years, antibody drugs have been widely used for clinical treatment of various diseases such as tumor, transplant rejection, bacterial infection, and autoimmunity, due to their advantages such as safety, effectiveness, and specificity. When developing antibody drugs, it is an urgent need to solve the problem of establishing a high-efficiency and rapid antibody drug screening and evaluation system. At present, the in vitro level evaluation of antibody drug activity mainly adopts antigen binding activity experiments and cell proliferation inhibition experiments. Although the antigen binding activity experiment can directly reflect the binding capacity of the antigen and the antibody, the antigen binding activity experiment cannot reflect the inhibition effect of the antibody drug on cell proliferation; although the cell proliferation inhibition experiment intuitively reflects the inhibition effect of the antibody drug on cell proliferation, the experiment period is long, and the wide application of the antibody drug is limited. Th2 cells play a key role in the type II inflammatory pathway by secreting the type II cytokines IL-4, IL-5 and IL-13. IL-4 can promote Th cells to be differentiated into Th2 cells and proliferate, and Th2 cells secrete IL-4, IL-5 and IL-13; IL-5 promotes eosinophil differentiation in bone marrow, and IL-4, IL-5 and IL-13 promote eosinophil metastasis to specific tissues; IL-4 and IL-13 can cause IgE production by B cells, and IL-13 plays an important role in mucus secretion, goblet cell proliferation, smooth muscle contraction and collagen production.
IL-4 and IL-13, although only 25% amino acid homology, their receptor complexes (type I and type II receptors) contain a common component IL-4R α, type I IL-4R refers to IL4R α & common γ chain, and type II IL-4R refers to IL4R α & IL13R α. IL-4 acts by binding to both type I and type II receptors, activating the downstream JAK-STAT6 pathway, whereas IL-13 acts only through type II receptors. IL-4 and IL4R a antibody drugs inhibit the binding of IL-4 to cell surface IL-4R α by competitively binding to IL4/IL-4R α.
At present, the activity of an IL-4/IL4R alpha antibody drug is judged mainly by detecting the proliferation inhibition activity of the IL-4/IL4R alpha antibody drug on TF-1 cells, although the method can directly reflect the effect of the antibody drug on the cells, the method takes 7 days and easily causes the distortion of experimental results. The reporter gene system can specifically reflect the action mechanism of the antibody drug, has short evaluation time, is a good method for evaluating the activity of the antibody drug, but the current market lacks a reporter gene cell strain for specifically evaluating the IL-4/IL4R alpha antibody drug.
CN107760760A discloses a method for rapidly determining IL-6/IL-6 receptor antibody drug biological activity, which comprises constructing effector cells stably expressing SIE reporter gene, stimulating and activating the reporter gene expression by IL-6, blocking IL-6 signal channel by IL-6/IL-6R antibody drug, and fitting a four-parameter curve according to the measured reporter gene signal value to determine the antibody biological activity. The invention establishes a faster and more accurate quantitative detection method aiming at the determination of the pharmaceutical biological activity of the IL-6/IL-6R antibody, has short experimental period and simple and convenient operation, and avoids the problem of objective factors such as the possibility of cell pollution caused by long-time incubation. However, the method cannot be used to evaluate the activity of IL-4/IL4R alpha antibody drugs.
Therefore, the reporter gene cell strain for specifically evaluating the IL-4/IL4R alpha antibody medicaments is provided, is used for evaluating the biological activity of the IL-4/IL4R alpha antibody medicaments, and has wide application prospect and great market value.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a reporter gene cell strain, a construction method and application thereof, wherein the reporter gene cell strain has short detection time and high sensitivity and has important significance for monitoring and evaluating the activity of a monoclonal antibody.
In order to achieve the purpose, the invention adopts the following technical scheme:
In a first aspect, the present invention provides a reporter plasmid comprising a STAT6 signaling response element;
the STAT6 signaling response element comprises at least one copy of a STAT6 binding motif;
The nucleotide sequence of the STAT6 binding motif is shown as SEQ ID NO. 1;
The nucleotide sequence shown in SEQ ID NO. 1 is:
GCTGTTGCTCAATCGACTTCCCAAGAACAG.
STAT6 is a member of a signal transduction and transcriptional activation factor family, participates in a JAK-STAT signal pathway, is regulated and controlled by IL-4/IL-13, transmits signals from a cell membrane to a cell nucleus and activates transcriptional expression of a series of downstream genes, and plays a key role in the differentiation process of Th2 cells. In the invention, the IL-4/IL4R alpha signal on the corresponding cell membrane of the STAT6 structural element is expressed as the strength of luciferase expression through the signal conversion of the STAT6 result element, and finally the signal is captured by a microplate reader to form antibody pharmaco-pharmacodynamic data.
preferably, the STAT6 signaling response element comprises five copies of a STAT6 binding motif.
The strength of signal conversion of STAT6 is related to the number of times of repeated sequences, the strength and linearity of signal response are considered, and 5 repeated elements can fully meet the detection requirement of the method.
Preferably, the nucleotide sequence of the STAT6 signal response element is shown as SEQ ID NO. 2;
the nucleotide sequence shown in SEQ ID NO. 2 is:
GGCCTAACTGGCCGGTACCTGAGCTCGCTGTTGCTCAATCGACTTCCCAAGAACAGGCTGTTGCTCAATCGACTTCCCAAGAACAGGCTGTTGCTCAATCGACTTCCCAAGAACAGGCTGTTGCTCAATCGACTTCCCAAGAACAGGCTGTTGCTCAATCGACTTCCCAAGAACAGCTCGAGGATATCAAGATCTGGCCTCGGCGGCCAAGCTTAGACACT.
in a second aspect, the present invention provides a reporter cell line comprising a reporter plasmid according to the first aspect.
Preferably, the reporter cell line further comprises a type I IL-4R expression plasmid.
preferably, the type I IL-4R expression plasmid includes IL-4R α and common γ chain expressed in tandem by an IRES structure, i.e., a type I IL-4R gene.
In the invention, the reporter gene cell strain transfected with the reporter gene plasmid and the I-type IL-4R expression plasmid expresses the I-type human IL-4R on a cell membrane, luciferase responding to JAK-STAT6 signals is expressed intracellularly, IL-4 can specifically activate the expression of the luciferase of the reporter gene cell strain in a dose-dependent manner, and meanwhile, an antibody drug targeting IL-4R alpha can block the combination of IL-4 and the IL-4R on the surface of the reporter gene cell strain, so that the invention has important application in antibody drug activity detection.
In the invention, the antibody drug targeting IL-4R alpha comprises Dupimumab (dupilumab) and a homotarget antibody thereof.
Preferably, the reporter cell line is Chinese hamster ovary cell K1 (CHO-K1).
in a third aspect, the present invention provides a method for constructing the reporter cell strain according to the second aspect, the method comprising:
constructing a reporter gene plasmid and a type I IL-4R expression plasmid, transfecting host cells, and obtaining the reporter gene cell strain after resistance screening.
preferably, the construction method of the reporter gene plasmid comprises the following steps:
The nucleotide sequence shown as SEQ ID NO. 2 is inserted into a luciferase reporter gene vector, transformed into an escherichia coli clone strain, and subjected to resistance screening and sequencing to obtain a recombinant plasmid, so that a reporter gene plasmid is obtained.
preferably, the luciferase reporter gene vector is pGL4.23[ luc2/minP ].
preferably, the nucleotide sequence shown in SEQ ID NO. 2 is inserted between Acc651 and Hind III sites of the luciferase reporter gene vector.
preferably, the construction method of the type I IL-4R expression plasmid comprises the following steps:
(1) Inserting the IL-4R alpha gene fragment into a pcDNA3.3-TOPO vector, transforming into an escherichia coli cloning strain, and obtaining a recombinant plasmid after resistance screening and sequencing to obtain pcDNA3.3-IL4R alpha;
(2) Inserting the common gamma chain gene fragment into a pOptiVEC-TOPO vector, transforming the pOptiVEC-TOPO vector into an escherichia coli clone strain, and obtaining a recombinant plasmid after resistance screening and sequencing to obtain pOptiVEC-TOPO-common gamma chain;
(3) And (2) carrying out PCR amplification by using pOptiVEC-TOPO-common gamma chain as a template to obtain an IRES-common gamma chain sequence, and inserting the IRES-common gamma chain sequence into the pcDNA3.3-IL4R alpha vector obtained in the step (1) through a Nhe I restriction endonuclease site to obtain the type I IL-4R expression plasmid.
preferably, the IL-4R α gene fragment of step (1) is inserted between Xba I and Pme I cleavage sites of pcDNA3.3-TOPO vector.
preferably, the common gamma chain gene fragment of step (2) is inserted between BglII and Pme I cleavage sites of pOptiVEC-TOPO vector.
preferably, the resistance selection is performed using a mixture of hygromycin B and G418.
As a preferred embodiment, the present invention provides a method for constructing a reporter cell line according to the second aspect, comprising the steps of:
(1) Constructing a reporter gene plasmid: inserting a nucleotide sequence shown as SEQ ID NO. 2 between Acc651 and Hind III enzyme cutting sites of a luciferase reporter gene vector pGL4.23[ luc2/minP ], converting the nucleotide sequence into an escherichia coli clone strain, and extracting plasmids after resistance screening to obtain a reporter gene plasmid;
(2) Construction of type I IL-4R expression plasmids:
(a) Inserting the IL-4R alpha gene fragment between Xba I and Pme I enzyme cutting sites of pcDNA3.3-TOPO vector, transforming into Escherichia coli cloning strain, obtaining recombinant plasmid after resistance screening and sequencing to obtain pcDNA3.3-IL4R alpha;
(b) Inserting the common gamma chain gene fragment between BglII and Pme I enzyme cutting sites of a pOptiveVEC-TOPO vector, transforming into an escherichia coli clone strain, obtaining a recombinant plasmid after resistance screening and sequencing, and obtaining pOptiveVEC-TOPO-common gamma chain;
(c) taking pOptiveC-TOPO-common gamma chain as a template, carrying out PCR amplification to obtain an IRES-common gamma chain sequence, and inserting the IRES-common gamma chain sequence into a pcDNA3.3-IL4R alpha vector through a Nhe I restriction endonuclease site to obtain the type I IL-4R expression plasmid;
(3) Transfection of host cells: mixing the constructed reporter gene plasmid and the I type IL-4R expression plasmid with Lipofectamine 2000, and transfecting Chinese hamster ovary cells K1;
(4) and (3) resistance screening: and adding a mixed solution of hygromycin B and G418 into the cell culture medium, and culturing to obtain the reporter gene cell strain.
In a fourth aspect, the present invention provides an antibody detection reagent comprising the reporter plasmid according to the first aspect or the reporter cell strain according to the second aspect.
Preferably, the detection reagent further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.
in a fifth aspect, the present invention provides a reporter plasmid according to the first aspect, a reporter cell strain according to the second aspect, a method for constructing a reporter cell strain according to the third aspect, or an antibody detection reagent according to the fourth aspect, for use in detecting the pharmaceutical activity of an IL4& IL-4 ra antibody.
Compared with the prior art, the invention has the following beneficial effects:
(1) the reporter gene cell strain 10B5 expresses I-type human IL-4R on a cell membrane, and expresses luciferase responding to JAK-STAT6 signals in cells;
(2) IL-4 can specifically activate the luciferase expression of the reporter gene cell line 10B5 in a dose-dependent manner, the window value is 6.9 times, meanwhile, antibody drugs dupilumab and K10-4 targeting IL-4R alpha can block the combination of IL-4 and 10B5 surface I-type IL-4R, and IC 50 is 359.9ng/mL and 796.3ng/mL respectively;
(3) The reporter gene cell strain 10B5 is suitable for evaluating the specific binding of IL-4 and a receptor IL-4R alpha thereof, simultaneously suitable for blocking the binding of IL-4 and IL-4R alpha by an IL-4/IL-4R alpha antibody, monitoring and evaluating the activity of the IL-4/IL-4R alpha antibody and having remarkable specificity.
drawings
FIG. 1(A) is a schematic diagram of a reporter gene vector, and FIG. 1(B) is a schematic diagram of a type I IL-4R expression vector;
FIG. 2 is a flow chart of IL-4R α expression from 10B 5;
FIG. 3 shows the results of PCR amplification of comman gamma chain mRNA from CHO-K1, 10B5, 1C8 and TF-1;
FIG. 4 is a graph showing the results of IL-4 stimulation of luciferase expression from 10B 5;
FIG. 5 is a graph showing the results of Dupilumab and K10-4 blocking the binding of IL-4 to 10B 5;
FIG. 6 is a graph of the activity of five monoclonal antibodies determined by 10B 5.
Detailed Description
to further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.
the examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.
Example 1 construction of reporter Gene cell lines
In this example, a reporter gene cell line is constructed through the steps of plasmid construction, cell transfection, stable cell line screening, monoclonality, and the like, and the specific method is as follows:
(1) plasmid construction
(a) construction of reporter plasmid
2, inserting the STAT6 cis-acting element sequence into a luciferase reporter gene vector pGL4.23[ luc2/minP ] through restriction enzyme sites Acc65 and Hind III, converting escherichia coli and selecting bacteria, and sequencing to obtain a reporter gene system vector pGL4.23[ STAT6/luc2/minP ] shown in a picture 1(A), wherein STAT6sequence is STAT6 cis-acting element sequence SEQ ID NO:2, and other elements are inherent elements on pGL4.23[ luc2/minP ];
(b) Construction of type I IL-4R expression plasmid
The NCBI of the IL4R α molecule is referred to as NM-000418.3 and the NCBI of the common γ chain molecule is referred to as NM-000206.1, and the cDNA clones for these genes are available from Chinesia Fordii (Sino Biological Inc.);
designing a primer to amplify an IL4R alpha gene segment, inserting restriction enzyme sites Xba I and Pme I into a pcDNA3.3-TOPO vector, transforming escherichia coli, selecting bacteria, and sequencing to obtain an IL4R alpha expression plasmid pcDNA3.3-IL4R alpha;
designing a primer to amplify a common gamma chain gene sequence, inserting the common gamma chain gene sequence into pOptiVEC-TOPO through restriction enzyme sites BglII and Pme I, transforming escherichia coli, selecting bacteria, and sequencing to obtain pOptiVEC-TOPO-common gamma chain plasmid;
the primers were designed to amplify the IRES-common γ chain sequence in pOptiVEC-TOPO-common γ chain plasmid, inserted into pcDNA3.3-IL4R α plasmid via Nhe I restriction endonuclease site, transformed into E.coli, selected, sequenced to obtain pcDNA3.3-IL4R α -IERS-common γ chain plasmid shown in FIG. 1(B), i.e., type I IL4R expression vector.
(2) cell transfection
Recovering CHO-K1 cells two weeks in advance to ensure that the cells are in logarithmic growth phase when in use; cells were harvested the day before transfection and plated in 6-well plates, 3E5 cells/well in 10% FBS + F12 medium;
On the day of transfection, the culture medium of the 6-well plate is changed into Opti-MEM (2 mL/well), a mixed solution of reporter gene plasmid pGL4.23[ STAT6/luc2/minP ], IL-4R expression plasmid pcDNA3.3-IL4R alpha-IERS-common gamma chain and Lipofectamine 2000 is prepared, the mixed solution is dropwise added into the 6-well plate, the 6-well plate is placed in an incubator at 37 ℃ for incubation for 5h, and the cell culture medium is changed into 10% FBS + F12;
(3) stable cell line selection
the next day of transfection, the cell culture medium is replaced by 10% FBS + 500. mu.g/mL hygromycin B + 700. mu.g/mL G418+ F12, after 14 days of pressurized culture, the cells are inoculated in a white 96-well plate, after IL-4 is added for stimulation for 6 hours, a luciferase expression window value is obtained, and the stably expressed cell strain with the largest window value is screened out;
(4) Monoclonality of cells
Cloning the selected stable expression cell strain with the largest window value by adopting a limiting dilution method, namely inoculating the cells into a 96-well plate at the density of 0.4 cell/well, and photographing on the 0 th day and the 1 st day by using Cloneselect Image Data View to obtain a monoclonal cell strain; inoculating the monoclonal cell strain into a white 96-well plate, adding IL-4 to stimulate for 6h to obtain a luciferase expression window value, and screening the monoclonal cell 10B5 with the largest window value.
The expression of IL-4 Ra and common gamma chain in 10B5 cell membrane was detected by flow cytometry, and the expression level of IL-4 Ra was 94.4% as shown in FIG. 2.
as shown in FIG. 3, from left to right, the PCR amplification results of CHO-K1, 10B5, 1C8 and TF-1, respectively, wherein IC8 is a clone picked up in the same batch as 10B5, TF-1 is a human erythroleukemia cell, naturally expresses type I IL4R and is used as a positive control, and the sequencing result shows that the 10B5 cell strain has the expression of the comman gamma chain protein. Monoclonal cells 10B5 were expanded and frozen.
Example 2 IL-4 stimulation of luciferase expression by monoclonal cells 10B5
(1) preparing a culture medium: pre-experiment pre-warmed assay medium (2% FBS + F12) and complete medium (10% FBS + F12);
(2) Collecting cells: taking out the cell culture dish, and observing the cell density under an inverted microscope to ensure that the cells are free from pollution; discarding the old medium, rinsing the cells with sterile PBS, digesting with pancreatin for 2min, and terminating the digestion with complete medium; centrifuging at 1000rpm for 5min, adding F12 culture medium containing 2% FBS, resuspending cells, and counting cells;
(3) Cell plating: resuspending the cells to 4E 5/mL, plating 50. mu.L/well in a 96-well plate, adding PBS (100. mu.L/well) to the surrounding wells, and placing in an incubator at 37 ℃;
(4) adding IL-4: taking a 96-well plate, diluting IL-4 to 50ng/mL, and diluting by 3 times, namely sucking 60 mu L of mixed liquor of a previous well, adding the mixed liquor into 120 mu L of analysis culture medium of a next well, and obtaining 10 concentration gradients; IL-4 was added at 50. mu.L/well to a white 96-well plate;
(5) Putting the white 96-well plate in an incubator for incubation for 6h, balancing the cell plate to room temperature, adding 30 mu L of Blo-glo into each well, and reading the plate by an enzyme-labeling instrument after 10 min;
(6) As a result: data processing was performed with Graphpad software using a 4-parameter equation.
As can be seen from FIG. 4, IL-4 stimulated the expression of luciferase by monoclonal cell 10B5 dose-dependently, with a window value of 6.9-fold.
EXAMPLE 3 evaluation of Dupumab (Dupilumab) and K10-4 biological Activity experiments
(1) Preparing a culture medium: pre-experiment pre-warmed assay medium (2% FBS + F12) and complete medium (10% FBS + F12);
(2) collecting cells: taking out the cell culture dish, and observing the cell density under an inverted microscope to ensure that the cells are free from pollution; discarding the old medium, rinsing the cells with sterile PBS, digesting with pancreatin for 2min, and terminating the digestion with complete medium; centrifuging at 1000rpm for 5min, adding F12 culture medium containing 2% FBS, resuspending cells, and counting cells;
(3) cell plating: resuspending the cells to 4E 5/mL, plating 50. mu.L/well in a 96-well plate, adding PBS (100. mu.L/well) around one well, and placing in an incubator at 37 ℃;
(4) IL-4 and Dupilumab and K10-4 were added: taking a 96-well plate, diluting dupilumab and K10-4 to 600 mu g/mL, and diluting by 3.5 times, namely, sucking 40 mu L of mixed liquor of a previous well, adding the mixed liquor into 100 mu L of analysis culture medium of a next well, and obtaining 10 concentration gradients; using assay medium, IL-4 was diluted to 0.8ng/mL and added to 96-well plates at 100 μ L/well; the antibody and IL-4 were mixed well and added to a white 96-well plate at 50. mu.L/well;
(5) Putting the white 96-well plate in an incubator for incubation for 6h, balancing the cell plate to room temperature, adding 30 mu L of Blo-glo into each well, and reading the plate by an enzyme-labeling instrument after 10 min;
(6) As a result: data processing was performed with Graphpad software using a 4-parameter equation.
As can be seen from FIG. 5, the monoclonal antibodies of dupilumab and K10-4 (developed by Bao boat biomedical science and technology (Shanghai) Co., Ltd., target IL-4 Ra) with increased gradient are put into IL-4 with fixed concentration, and can inhibit the combination of IL-4 and 10B5 in a concentration-dependent manner, and IC 50 is 359.9ng/mL and 796.3ng/mL respectively, which indicates that the constructed reporter gene cell strain can be used for evaluating the combination of IL-4 and IL4R alpha antibody blocking IL-4 and 10B 5.
example 4 specificity test
In this embodiment, the constructed reporter gene cell strain 10B5 is used to detect the activities of monoclonal antibody drugs of different targets: dupilumab (Dup, target IL-4 ra), K10-4 (baochar biomedical science and technology (shanghai) ltd., target IL-4 ra), Tecentriq (target PD-L1), cetuximab (Erbitux, target EGFR) and bevacizumab (Avastin, target VEGF), the specific steps refer to example 3.
the results are shown in fig. 6, no dose-response curve was observed for 10B5 for antibody drugs against EGFR, VEGF and PD-L1 targets, indicating that 10B5 is not applicable to drugs other than IL-4/IL-4 ra targets, demonstrating that 10B5 has significant IL-4/IL-4 ra specificity.
in conclusion, the reporter gene cell strain 10B5 expresses I-type human IL-4R on a cell membrane, expresses luciferase responding to JAK-STAT6 signals intracellularly, IL-4 can specifically activate the expression of the luciferase of 10B5 in a dose-dependent manner, the window value is 6.9 times, antibody drugs dupilumab and K10-4 targeting IL-4 Ra can block the combination of IL-4 and 10B5, IC 50 is 359.9ng/mL and 796.3ng/mL respectively, the 10B5 is suitable for evaluating the specific combination of IL-4 and a receptor IL-4 Ra, and is also suitable for blocking the combination of IL-4 and IL-4 Ra by an IL-4/IL4R alpha antibody, and monitoring and evaluating the activity of the IL-4/IL4R alpha antibody, the specificity is remarkable, and the reporter gene cell strain has wide application prospect and great market value.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
SEQUENCE LISTING
<110> Bao boat biomedical science and technology (Shanghai) Co., Ltd
<120> reporter gene cell strain and construction method and application thereof
<130> 20190531
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 30
<212> DNA
<213> Artificial Synthesis
<400> 1
gctgttgctc aatcgacttc ccaagaacag 30
<210> 2
<211> 221
<212> DNA
<213> Artificial Synthesis
<400> 2
ggcctaactg gccggtacct gagctcgctg ttgctcaatc gacttcccaa gaacaggctg 60
ttgctcaatc gacttcccaa gaacaggctg ttgctcaatc gacttcccaa gaacaggctg 120
ttgctcaatc gacttcccaa gaacaggctg ttgctcaatc gacttcccaa gaacagctcg 180
aggatatcaa gatctggcct cggcggccaa gcttagacac t 221
Claims (10)
1. a reporter plasmid comprising a STAT6 signal responsive element;
the STAT6 signaling response element comprises at least one copy of a STAT6 binding motif;
The nucleotide sequence of the STAT6 binding motif is shown as SEQ ID NO. 1.
2. the reporter plasmid of claim 1, wherein the STAT6 signaling response element comprises five copies of a STAT6 binding motif;
Preferably, the nucleotide sequence of the STAT6 signal response element is as shown in SEQ ID NO 2.
3. a reporter cell line comprising the reporter plasmid of claim 1 or 2;
preferably, the reporter cell line further comprises a type I IL-4R expression plasmid;
preferably, the type I IL-4R expression plasmid comprises IL-4R α and common γ chain expressed in tandem by IRES elements;
preferably, the reporter gene cell strain is Chinese hamster ovary cell K1.
4. A method for constructing the reporter cell line of claim 3, comprising:
Constructing a reporter gene plasmid and a type I IL-4R expression plasmid, transfecting host cells, and obtaining the reporter gene cell strain after resistance screening.
5. The method of claim 4, wherein the reporter plasmid is constructed by the steps of:
inserting a nucleotide sequence shown as SEQ ID NO. 2 into a luciferase reporter gene vector, converting the luciferase reporter gene vector into an escherichia coli clone strain, and obtaining recombinant plasmids after resistance, sequencing and screening to obtain reporter gene plasmids;
preferably, the luciferase reporter gene vector is pGL4.23[ luc2/minP ];
preferably, the nucleotide sequence shown in SEQ ID NO. 2 is inserted between Acc651 and Hind III sites of the luciferase reporter gene vector.
6. The method of claim 4 or 5, wherein said type I IL-4R expression plasmid is constructed by the steps of:
(1) Inserting the IL-4R alpha gene fragment into a pcDNA3.3-TOPO vector, transforming into an escherichia coli cloning strain, and obtaining a recombinant plasmid after resistance screening and sequencing to obtain pcDNA3.3-IL4R alpha;
(2) inserting the common gamma chain gene fragment into a pOptiVEC-TOPO vector, transforming the pOptiVEC-TOPO vector into an escherichia coli clone strain, and obtaining a recombinant plasmid after resistance screening and sequencing to obtain pOptiVEC-TOPO-common gamma chain;
(3) taking pOptiVEC-TOPO-common gamma chain as a template, carrying out PCR amplification to obtain an IRES-common gamma chain sequence, and inserting the IRES-common gamma chain sequence into the pcDNA3.3-IL4R alpha vector obtained in the step (1) through a Nhe I restriction endonuclease site to obtain the type I IL-4R expression plasmid;
Preferably, the IL-4R alpha gene fragment of step (1) is inserted between Xba I and Pme I cleavage sites of pcDNA3.3-TOPO vector;
Preferably, the common gamma chain gene fragment of step (2) is inserted between BglII and Pme I cleavage sites of pOptiVEC-TOPO vector.
7. the method according to any one of claims 4 to 6, wherein the resistance selection is carried out using a mixture of hygromycin B and G418.
8. Construction method according to any one of claims 4 to 7, characterized in that it comprises the following steps:
(1) constructing a reporter gene plasmid: inserting a nucleotide sequence shown as SEQ ID NO. 2 between Acc651 and Hind III enzyme cutting sites of a luciferase reporter gene vector pGL4.23[ luc2/minP ], converting the nucleotide sequence into an escherichia coli clone strain, and extracting plasmids after resistance screening to obtain a reporter gene plasmid;
(2) Construction of type I IL-4R expression plasmids:
(a) Inserting the IL-4R alpha gene fragment between XbaI and Pme I enzyme cutting sites of pcDNA3.3-TOPO vector, transforming into Escherichia coli cloning strain, obtaining recombinant plasmid after resistance screening and sequencing to obtain pcDNA3.3-IL4R alpha;
(b) inserting the common gamma chain gene fragment between BglII and Pme I enzyme cutting sites of a pOptiveVEC-TOPO vector, transforming into an escherichia coli clone strain, obtaining a plasmid after resistance screening and sequencing, and obtaining pOptiveVEC-TOPO-common gamma chain;
(c) taking pOptiveC-TOPO-common gamma chain as a template, carrying out PCR amplification to obtain an IRES-common gamma chain sequence, and inserting the IRES-common gamma chain sequence into a pcDNA3.3-IL4R alpha vector through a Nhe I restriction endonuclease site to obtain the type I IL-4R expression plasmid;
(3) Transfection of host cells: mixing the constructed reporter gene plasmid and the I type IL-4R expression plasmid with Lipofectamine 2000, and transfecting Chinese hamster ovary cells K1;
(4) and (3) resistance screening: and adding a mixed solution of hygromycin B and G418 into the cell culture medium, and culturing to obtain the reporter gene cell strain.
9. an antibody detection reagent, wherein the detection reagent comprises the reporter plasmid of claim 1 or 2 or the reporter cell line of claim 3;
Preferably, the detection reagent further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.
10. use of the reporter plasmid of claim 1 or 2, the reporter cell line of claim 3, the method of constructing the reporter cell line of any one of claims 4-8, or the antibody detection reagent of claim 9 for detecting the pharmaceutical activity of an antibody against IL4& IL-4 ra.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910864683.8A CN110551756A (en) | 2019-09-12 | 2019-09-12 | reporter gene cell strain and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910864683.8A CN110551756A (en) | 2019-09-12 | 2019-09-12 | reporter gene cell strain and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110551756A true CN110551756A (en) | 2019-12-10 |
Family
ID=68740180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910864683.8A Pending CN110551756A (en) | 2019-09-12 | 2019-09-12 | reporter gene cell strain and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110551756A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030092616A1 (en) * | 2001-05-25 | 2003-05-15 | Akio Matsuda | STAT6 activation gene |
| WO2003104277A2 (en) * | 2002-01-22 | 2003-12-18 | Asahi Kasei Kabushiki Kaisha | Stat6 activation gene |
| EP1572944A2 (en) * | 2002-08-30 | 2005-09-14 | President And Fellows Of Harvard College | Methods and compositions for modulating xbp-1 activity |
| CN107586826A (en) * | 2017-09-28 | 2018-01-16 | 中国食品药品检定研究院 | Transgenic cell measuring method for activity determines IL 5 or IL 5R Alpha antibodies activity |
| CN107760760A (en) * | 2017-09-28 | 2018-03-06 | 中国食品药品检定研究院 | A kind of method of the receptor antibody pharmaceutical biology activity of quick measure IL 6/IL 6 |
| CN110004168A (en) * | 2019-04-12 | 2019-07-12 | 南京科佰生物科技有限公司 | For screening the reporter gene of LAG-3 inhibitor |
-
2019
- 2019-09-12 CN CN201910864683.8A patent/CN110551756A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030092616A1 (en) * | 2001-05-25 | 2003-05-15 | Akio Matsuda | STAT6 activation gene |
| WO2003104277A2 (en) * | 2002-01-22 | 2003-12-18 | Asahi Kasei Kabushiki Kaisha | Stat6 activation gene |
| EP1572944A2 (en) * | 2002-08-30 | 2005-09-14 | President And Fellows Of Harvard College | Methods and compositions for modulating xbp-1 activity |
| CN107586826A (en) * | 2017-09-28 | 2018-01-16 | 中国食品药品检定研究院 | Transgenic cell measuring method for activity determines IL 5 or IL 5R Alpha antibodies activity |
| CN107760760A (en) * | 2017-09-28 | 2018-03-06 | 中国食品药品检定研究院 | A kind of method of the receptor antibody pharmaceutical biology activity of quick measure IL 6/IL 6 |
| CN110004168A (en) * | 2019-04-12 | 2019-07-12 | 南京科佰生物科技有限公司 | For screening the reporter gene of LAG-3 inhibitor |
Non-Patent Citations (2)
| Title |
|---|
| JURIS EZERNIEKS等: "The human IgE germline promoter is regulated by interleukin-4, interleukin-13, interferon-a and interferon-γvia an interferon-γ-activated site and its flanking regions", 《EUR. J. BIOCHEM》 * |
| 笪宇蓉等: "高通量筛选 JAK-STAT6信号传导通路抑制剂方法的初步建立", 《中国药理学通报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110691844B (en) | Methods and kits for generating simulated innate immune cells from pluripotent stem cells | |
| CN102803508B (en) | For composition and the method for stem cell imaging | |
| CN110499295A (en) | A kind of CSF-1R reporter gene cell strain and its preparation method and application | |
| AU2013366092A1 (en) | Novel method | |
| Ramos et al. | IFN-α is not sufficient to drive Th1 development due to lack of stable T-bet expression | |
| KR102135745B1 (en) | Expression cassette | |
| CN113234723B (en) | Japanese eel cytokine IL-6 gene promoter and application thereof | |
| CN110551756A (en) | reporter gene cell strain and construction method and application thereof | |
| CN103865931A (en) | DNA element having the activity of enhancing foreign gene expression | |
| CN107384869A (en) | A kind of monoclonal cell strain and its application in IL 6R inhibitor relative biological activities are determined | |
| CN111500668B (en) | Method for determining biological activity of human IL-36/IL36R/IL1RAcP pathway inhibitor | |
| CN114729320B (en) | Compositions, methods and uses for reprogramming cells to dendritic cell type 2 capable of presenting antigen | |
| CN114457040A (en) | RSPO1 activity detection stable cell strain and construction method and application thereof | |
| CN108239642A (en) | A kind of relevant long non-coding RNA of Adipocyte Differentiation and its application | |
| CN114921496A (en) | Construction method and application of humanized immune system animal model with NK (Natural killer) cell and ADCC (advanced Charge coupled device) capabilities | |
| CN110257340A (en) | CHO cell line of Dnmt3b gene defection type and preparation method thereof, application, recombinant protein expression system | |
| US8394931B2 (en) | Anti-HMGA1 monoclonal antibodies, process for their preparation and their use for the quantitative determination of HMGA1 | |
| WO2017073740A1 (en) | Method for producing pancreatic endocrine cells, and transdifferentiation agent | |
| CN114729361B (en) | Promoter with high activity in activated T cells | |
| US20220372481A1 (en) | Promoter having high activity in activated t-cell | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs | |
| CN112725409B (en) | Method for rapidly determining biological activity of IL-2 protein drug and anti-CD 25 antibody drug | |
| CN114591987B (en) | Genetic code fluorescence biosensor for detecting mTORC1 activity in living cells and construction method thereof | |
| WO2024048820A1 (en) | System for evaluating porcine stem cell pluripotency and method for evaluating pluripotency using same | |
| CN103305540B (en) | Plasmid for determination of biological activity and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191210 |