CN110551195B - Alpha-synuclein aggregation-induced emission system and construction and application thereof - Google Patents

Abstract

An alpha-synuclein aggregation-induced emission system and its construction and application. The invention belongs to the field of biotechnology and chemical engineering, and particularly relates to an alpha SN aggregation-induced emission fusion body and a construction method and application thereof. The alpha SN aggregation-induced luminescent fusion is specifically EPB-alpha SN4F or EPB-alpha SN39Y, wherein phenylalanine at the 4 th position or tyrosine at the 39 th position in an alpha SN amino acid sequence is replaced by p-azidophenylalanine pAZF to obtain alpha SN4F or alpha SN39Y mutant protein, and then the AIE molecule EPB and the mutant protein alpha SN4F or alpha SN39Y are subjected to bio-orthogonal connection reaction to obtain EPB-alpha SN4F or EPB-alpha SN39Y, and the fusion-induced luminescent fusion can be applied to screening of aggregation inhibitors.

Description

Alpha-synuclein aggregation-induced emission system and construction and application thereof

The technical field is as follows:

the invention belongs to the field of biotechnology and chemical engineering, and particularly relates to construction of an alpha-synuclein aggregation-induced emission system, which is applied to screening of an alpha-synuclein aggregation inhibitor. In particular to the expression and purification of alpha-synuclein containing unnatural amino acid in escherichia coli, the traceless addition of an aggregation-induced emission probe and the screening of an aggregation inhibitor.

The background art comprises the following steps:

aggregation and misfolding of amyloid in cells and tissues to form toxic intermediates and amyloid fibrils may lead to various biological dysfunctions. These aggregation intermediates and fibers are presumed to be associated with certain neurodegenerative and other disorders, such as Alzheimer's Disease (AD), Parkinson's Disease (PD), diabetes type II, and the like. Numerous studies have demonstrated that the more toxic moiety is an oligomer or fibril intermediate, and mature fibers may also play an important role. The development of effective amyloid aggregation inhibitors is one of effective means in the field of drug development for treating the diseases, so that sensitive and convincing methods for detecting amyloid fibers or intermediates and detailed understanding of the fiber forming mechanism on the molecular level are helpful for rational design of treatment schemes and are used for preventing and relieving body injury caused by toxic amyloid fragments. In recent years, some researches on the structure, morphology, full length of amyloid protein and the like of amyloid fiber have been made in a breakthrough manner, but the molecular layer aggregation mechanism of amyloid protein misfolding is still unexplored.

The current method for screening the amyloid aggregation inhibitor mainly comprises the following three aspects: (1) and (4) in-vitro dye experiment screening. Amyloid dyes such as Thioflavin T (ThT) and Congo Red (CR) are sensitive in hydrophobic environments and fluoresce when bound to the β -sheet structure of amyloid fibrils, and are therefore widely used in research and high throughput screening of aggregative proteins and identification of aggregation inhibitors. However, there are many limitations to the use of these dyes, for example, the inability to detect the morphology of early aggregates using these dyes, and the inability to accurately explore the small molecule drug-induced changes in fiber morphology because small molecule drugs may bind competitively to amyloid fibers. In addition, the properties of the dye may be affected by other components in the buffer solution, and thus some false positives and the like are liable to occur. (2) And (4) fluorescent protein marker screening. To visualize the aggregation process, green fluorescent protein GFP was expressed as a fusion protein with β -amyloid 42(A β 42) and used to screen for inhibitors of A β 42 aggregation. However, the aggregation and folding process of GFP-A β 42 fusion protein may not be completely the aggregation process of A β 42, because the aggregation and folding of GFP with only 4.5kDｃA hardly leads to the misfolding of the whole fusion protein. In addition, background fluorescence of dyes and fluorescent proteins may have a large influence on the detection result. (3) Molecular design and virtual screening. With the rapid development of molecular simulation technology in recent years, molecular simulation technology, such as molecular dynamics simulation, molecular docking and pharmacophore model, has been widely used for analyzing amyloid aggregation and misfolding and inhibition mechanism thereof, calculating binding force type between inhibitor and amyloid, determining inhibitor action site, and screening and designing aggregation inhibitor. However, due to the conformational instability of the amyloid protein aggregate, especially the three-dimensional structure of some oligomers with the strongest toxicity has not been resolved so far, the application of the molecular simulation technology in the development of the amyloid protein aggregation inhibitor is severely restricted.

Aggregation-Induced Emission (AIE) probes have the characteristics of not fluorescing in a free state and capable of fluorescing strongly when aggregates are formed or conformation is restricted, and thus can be used as an optimal biosensor for analyzing environmental and conformational changes. The principle of aggregation-induced emission may be that the rotation of the probe molecule is limited by the environment, and a local excited state appears, thereby generating an abnormal photophysical effect. The conformation transformation dependent luminescence phenomenon is not interfered by background fluorescence, so that the conformation transformation dependent luminescence phenomenon can be applied to the biological dynamics research of amyloid protein. Several AIE molecules have been reported in recent years to detect and identify amyloid fibrils and to explore the relationship of proteins to proteins, including TPE, TPE-TPP, BSPOTPE, EPB, etc. Unfortunately, these AIE molecules suffer from poor sensitivity and specificity during application.

In order to solve the problems in the screening of the existing amyloid protein aggregation inhibitor, the invention combines the aggregation-induced emission technology, introduces Unnatural Amino Acid (UAA) into alpha-synuclein (alpha SN), then uses azide group on a side chain thereof to couple with AIE molecules through bioorthogonal reaction, and points on the alpha SN to mark the AIE molecules, thereby improving the specificity and sensitivity of the AIE applied to the detection of protein conformation conversion, obtaining the AIE-mut alpha SN biosensor and applying the AIE-mut alpha SN biosensor to the screening of the amyloid protein aggregation inhibitor.

The invention content is as follows:

in order to achieve the purpose, the invention combines the biological expression of unnatural amino acids and the biological orthogonal reaction technology to construct an alpha SN aggregation-induced luminescence system, and the alpha SN aggregation-induced luminescence system is applied to screening of an alpha SN aggregation inhibitor.

One of the technical schemes provided by the invention is an alpha SN aggregation-induced luminescent fusion, which is specifically EPB-alpha SN4F or EPB-alpha SN39Y, wherein the 4 th phenylalanine or 39 th tyrosine in an alpha SN amino acid sequence is replaced by p-Azido phenylalanine (pAZF) to obtain alpha SN4F or alpha SN39Y mutant protein, and then the biological orthogonal connection reaction is carried out on the AIE molecule EPB and the mutant protein alpha SN4F or alpha SN39Y to obtain EPB-alpha SN4F or EPB-alpha SN 39Y.

The alpha SN amino acid sequence is shown in a sequence table SEQ ID NO. 2.

The chemical formula of the AIE molecular EPB is as follows: c ₃₈ H ₄₄ N ₂ O ₂ Br ₂ The structural formula is shown in figure 1-a.

The invention also provides a construction method of EPB-alpha SN4F or EPB-alpha SN39Y, which comprises the following steps:

(1) obtaining a protein expression gene of pAZF replacing phenylalanine at position 4 or tyrosine at position 39 in alpha SN3 by a gene synthesis or PCR method, and obtaining alpha SN4F or alpha SN39Y mutant protein by an escherichia coli expression method;

(2) and carrying out bio-orthogonal ligation reaction on the EPB and UAA mutant protein alpha SN4F or alpha SN39Y by using copper-catalyzed azide terminal alkyne cycloaddition reaction (CuAAC) to obtain EPB-alpha SN4F or EPB-alpha SN 39Y.

The invention also provides an application of EPB-alpha SN4F or EPB-alpha SN39Y in screening of an alpha SN aggregation inhibitor, and the method comprises the following steps: potential inhibitors are added into EPB-alpha SN4F or EPB-alpha SN39Y solution (dissolved by PBS), the excitation wavelength is 350nm, the fluorescence intensity is detected in the range of 380nm-600nm of emission wavelength, and if the fluorescence intensity is weaker than that of EPB-alpha SN4F or EPB-alpha SN39Y systems without the potential inhibitors, the potential inhibitors are judged to be alpha SN aggregation inhibitors.

When the inhibitor exists in the EPB-alpha SN4F or EPB-alpha SN39Y solution, the aggregation of the alpha SN4F or the alpha SN39Y can be inhibited, so that the screening system does not emit light or emits light weakly; when the solution does not contain the inhibitor, the alpha SN4F or the alpha SN39Y is rapidly aggregated, so that the screening system can emit stronger fluorescence;

preferably, the concentration of EPB-alpha SN4F or EPB-alpha SN39Y is 20. mu.M, the excitation wavelength is 350nm, and the emission wavelength is 380nm-600nm, preferably 490nm, for detecting the fluorescence intensity.

Has the advantages that:

EPB cannot generate fluorescence along with aggregation of α SN, i.e. EPB alone cannot be used for research of aggregation properties of α SN; the pAzF mutated alpha SN can not lead EPB to generate fluorescence in the process of aggregation; the EPB-alpha SN4F or EPB-alpha SN39Y constructed by the invention can induce the system to emit stronger fluorescence when forming the aggregate, thereby providing a new method idea for screening the alpha SN aggregation inhibitor.

Description of the drawings:

FIG. 1EPB molecular Structure and verification of aggregation-induced emission characteristics thereof

Wherein, a.epb molecular structure; change in fluorescence of epb in different concentrations of glycerol;

FIG. 2 is a flow chart of the construction of an α SN aggregation-induced emission system;

FIG. 3 alpha SN and 6 UAA mutant protein expression purification and aggregation characteristic research

Wherein, a, the structure and the substitution principle of the unnatural amino acid pAzF; b. a pAzF substitution site in the α SN protein; schematic representation of pET22b-alpha SN/mut alpha SN expression vector; detecting alpha SN and 6 pAzF mutant proteins thereof by SDS-PAGE gel electrophoresis;

FIG. 4MALDI TOF mass spectrum identification of. alpha.SN and its 6 pAzF mutant proteins

Wherein a-g are respectively alpha SN, alpha SN4F, alpha SN39Y, alpha SN94F, alpha SN125Y, alpha SN133Y and alpha SN 136Y;

FIG. 5ThT fluorescent staining for detecting α SN and its 6 pAzF mutant protein aggregation properties;

FIG. 6EPB- α SN4F/39Y architecture construction and validation

Connecting EPB to alpha SN4F/39Y by using CuAAC to construct EPB-alpha SN 4F/39Y; b, c, UV-visible spectroscopy full-wavelength scanning verifies whether EPB-alpha SN4F and EPB-alpha SN39Y are successfully constructed, and the scanning wavelength range is 200-600 nm;

FIG. 7 application of EPB- α SN4F/39Y aggregation-induced emission system in which (a) EPB- α SN 4F; (b) EPB- α SN39Y system;

FIG. 8 aggregation behavior of different light-emitting systems

Wherein a is an alpha SN4F related system; b is a related system of alpha SN 39Y.

The specific implementation mode is as follows:

in order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present patent and are not intended to limit the present invention.

The invention uses restriction enzyme and DNA polymerase from Dalibao bioengineering limited company, small amount plasmid extraction kit, DNA gel recovery kit, DNA purification recovery kit from Omega bio-tech, Ni ⁺ Resins were purchased from sigma, unnatural amino acids pAzF from MCE, and other reagents not specifically identified as sources were purchased from shanghai leaf biotechnology limited. Gene and primer synthesis was from Jinzhi Biotechnology, Inc., Suzhou. The aggregation-induced emission molecule EPB is synthesized by using a chemical synthesis formula. The experimental procedures, which are not described in detail, were performed according to the laboratory manual, e.g., molecular cloning.

Tetraphenyl ethylene and derivatives thereof are the most deeply studied AIE molecules at present due to the characteristics of simple synthesis, easy modification and the like. The EPB molecule is a tetraphenylethylene derivative.

The AIE molecule selected by the invention is EPB, which is named as 2,20- (((2- (4-ethylphenyl) -2-phenylethylene-1, 1-diyl) bis (4,1-phenylene)) bis (oxy)) bis- (N, N, N-trimethylenetanaminium) bromide, is a derivative of tetraphenylethylene, has good aggregation-induced emission characteristics, and is disclosed in Hu, R.; yap, h.k.; fung, y.h.; wang, y.; cheong, w.l.; so, l.y.; tsang, c.s.; lee, l.y.; lo, w.k.; yuan, j.; sun, n.; leung, y.c.; yang, G.; wong, K.Y., 'Light up' protein-protein interaction through bioorganic interaction of a turn-on fluorescent interaction. mol.biosystem.2016, 12, (12), 3544-. The EPB can be synthesized by the skilled person according to the above documents or the related information of structural formula, chemical formula and the like.

The unnatural amino acid selected by the invention is a phenylalanine structural analogue containing Azido, namely p-Azido phenylalanine (pAZF). To minimize the effect of UAA substitutions on the aggregation properties of the protein itself, phenylalanine (positions 4 and 94) and tyrosine (positions 39, 125, 133 and 136) in α SN were selected as substitution sites for pAzF according to the principle of structural similarity. Expressing and purifying the alpha SN isomer protein by Escherichia coli to obtain 6 pAzF mutant alpha SN isomer proteins. The aggregation properties of the mutants were analyzed by ThT fluorescent staining, and the results showed that the aggregation properties of α SN4F and α SN39Y were less affected by pAzF introduction, and therefore α SN4F or α SN39Y mutant proteins were selected for subsequent experiments.

The invention will be further illustrated by the following specific examples. The construction flow of the alpha SN aggregation-induced emission screening system is shown in FIG. 2.

Example 1: selection of aggregation-induced emission molecules and characterization of emission characteristics

The aggregation-induced emission molecule EPB is a tetraphenylethylene derivative, and the structural formula is shown in figure 1-a. To verify the aggregation-inducing property of the AIE molecules, the change of the fluorescence values of the AIE molecules in different concentrations of glycerol is detected by taking the same concentration of EPB (2 mu M), wherein the concentrations of the glycerol are respectively 0%, 20%, 40%, 60% and 70%, the buffer solution is PBS, and the pH value is 7.4. After being fully and uniformly mixed, the fluorescence is detected under the conditions of the excitation wavelength of 350nm and the emission wavelength of 460 nm.

The experimental result is shown in figure 1-b, the EPB solution fluorescence intensity is gradually increased along with the increase of the glycerol concentration, and the EPB solution is proved to have the characteristic of aggregation-induced luminescence.

Example 2: expression and purification of alpha SN isomer containing unnatural amino acid pAzF

(1) Selecting phenylalanine (4 and 94 positions) and tyrosine (39, 125, 133 and 136 positions) in alpha SN as the substitution sites of pAzF, and obtaining coding genes of alpha SN4F, alpha SN39Y, alpha SN94F, alpha SN125Y, alpha SN133Y and alpha SN136Y of pAzF by gene synthesis or PCR (the substitution principle and the substitution sites are shown in figures 3-a and 3-b);

the gene of the coded alpha SN protein is synthesized by Jinzhi company after codon optimization, the gene sequence is shown as SEQ ID No.1, the gene of the alpha SN125Y amber mutant is synthesized by the gene company, the other 5 amber mutant genes are obtained by taking a wild type gene as a template and a PCR or overlap PCR method, and the used primers are shown as SEQ ID No.3-No. 11.

Wherein, the primer for cloning the alpha SN4F gene is NdeI-4 alpha SN-F/XhoI-alpha SN-R.

When the alpha SN39Y gene is cloned, firstly, a left arm fragment is cloned by using a primer NdeI-alpha SN-F/39TAG-R, a right arm fragment is cloned by using a primer 39 TAG-F/XhoI-alpha SN-R, and then, the alpha SN39Y gene is cloned by using a primer NdeI-alpha SN-F/XhoI-alpha SN-R and taking a left arm fragment mixture and a right arm fragment mixture as templates.

When the alpha SN94F gene is cloned, firstly, a left arm fragment is cloned by using a primer NdeI-alpha SN-F/94TAG-R, a right arm fragment is cloned by using a primer 94 TAG-F/XhoI-alpha SN-R, and then, the alpha SN94Y gene is cloned by using a mixture of the left and right arm fragments as a template and the primer NdeI-alpha SN-F/XhoI-alpha SN-R.

The primer of the cloned alpha SN133Y gene is NdeI-alpha SN-F/133 TAG-R.

The primer of the clone alpha SN136Y gene is NdeI-alpha SN-F/136 TAG-R.

NdeI-αSN-F:GGAATTCCATATG GATGTGTTTATGAAAGGCCT(SEQ ID No.3)；

XhoI-αSN-R:CCGCTCGAG GGCTTCCGGTTCATAATCCT(SEQ ID No.4)；

NdeI-4αSN-F:GGAATTCCATATGGATGTGTAGATGAAAGGCCT(SEQ ID No.5)；

39TAG-R:TTGCTACCCACCTACAGCACGCCCT(SEQ ID No.6)；

39TAG-F:AGGGCGTGCTGTAGGTGGGTAGCAA(SEQ ID No.7)；

94TAG-R:CTTTCTTCACCTAACCGGTGGCG(SEQ ID No.8)；

94TAG-F:CGCCACCGGTTAGGTGAAGAAAG(SEQ ID No.9)；

133TAG-R:CCGCTCGAGGGCTTCCGGTTCATAATCCTGCTAGCCAA(SEQ ID No.10)；

136TAG-R:CCGCTCGAGGGCTTCCGGTTCCTAATCCTGGTAGCC(SEQ ID No.11)。

(2) In order to facilitate the screening and purification of the UAA mutant protein in the later period, pET22b plasmid is selected as an expression vector.

(3) An expression vector for expressing wild type alpha SN and 6 mutant proteins in escherichia coli is constructed by using a conventional escherichia coli chemical conversion method, and a schematic diagram of the expression vector is shown in fig. 3-c.

For wild type alpha SN protein, pET22 b-alpha SN expression vector is transformed into Escherichia coli BL21 expression host, and corresponding recombinant strain BL 21-alpha SN is constructed. Selecting a single colony of the constructed BL 21-alpha SN engineering bacteria to 5mL LB culture medium for overnight culture at 37 ℃, transferring the single colony into a fresh LB culture medium according to 1% inoculation amount, culturing at 37 ℃ until OD600 is 0.6-0.8, adding 0.5mM IPTG (isopropyl thiogalactoside) with final concentration for induction, wherein the induction temperature is 16 ℃, and the induction time is 16-18 h. Finally, the cells were collected by centrifugation at 6000rpm for 10 min. The resulting cells were resuspended in a buffer lyssbuffer (20mM Tris-HCl, pH 7.4, 200mM NaCl, 1mM EDTA, 1mM DTT), lysozyme and 1% PMSF were added to a final concentration of 30. mu.g/mL, and the cells were sonicated after 30min in an ice bath, centrifuged at 12000rpm for 40min, and the supernatant was collected. The supernatant was applied to an amylose resin affinity chromatography column, which was then washed with 10 column volumes of wash buffer (20mM Tris-HCl, pH 7.4, 200mM NaCl, 1mM EDTA, 1mM DTT, 2mM maltose), and finally eluted with 10 column volumes of elusion buffer (20mM Tris-HCl, pH 7.4, 200mM NaCl, 1mM EDTA, 1mM DTT, 10mM maltose). Protein concentration is measured by Nanodrop 2000, and 35.5mg of wild type alpha SN protein can be obtained by calculating purification of bacterial liquid per liter.

For the expression of pAzF mutant protein, the helper plasmid pEVOL-pAzF and the expression vector plasmid pET22b-mut alpha SN (mut alpha SN is respectively 6 mutant protein coding genes, pET22b-mut alpha SN represents the expression vector of the alpha SN-loaded mutant protein coding gene pET22 b) are co-transformed into the same escherichia coli BL21 competent cell, and the corresponding recombinant strain BL21-mut alpha SN is constructed. A single colony of the engineering bacteria is picked up and put into 5mL LB culture medium to be cultured overnight at 37 ℃, transferred into fresh LB culture medium according to the inoculation amount of 1 percent, cultured at 37 ℃ until OD600 is 0.3, and added with pAzF with the final concentration of 1 mM. Continuously culturing in a 37 deg.C shaking table, adding L-arabinose with final concentration of 0.2% (w/v) when OD600 is 0.5, culturing in a 30 deg.C shaking table until OD600 is 1, adding IPTG with final concentration of 0.5mM for induction at 30 deg.C for 16-18 h. Finally, the cells were collected by centrifugation at 6000rpm for 10 min. Consistent with the above protein purification method, 6 pAzF mutant proteins were obtained by Ni column affinity chromatography, and SDS-PAGE electrophoresis is shown in FIG. 3-d, wherein it can be seen that the protein purity is above 95%, and the yields of these 6 mutant proteins, α SN4F, α SN39Y, α SN94F, α SN125Y, α SN133Y, and α SN136Y, were calculated to be about 7.5mg/L, 13.7mg/L, 8.3mg/L, 8.8mg/L, 9.1mg/L, and 7.8mg/L, respectively, by detecting the protein concentration with Nanodrop 2000. The protein is dialyzed, desalted, freeze-dried and placed at-20 ℃ for later use.

The protein obtained was further verified to be the target protein by MALDI TOF mass spectrometry, and the mass spectrum is shown in fig. 4.

Example 3: detection of mutant protein aggregation characteristics by ThT fluorescent staining

Detecting by adopting an ex-situ culture method, taking the six mutant proteins and the alpha SN to respectively prepare protein solutions with equal concentrations, wherein the concentration is 100 mu M, and placing the protein solutions at 37 ℃ and shaking culture at 180 rpm. Sampling at fixed point time, wherein the sampling volume is 10 mu L, adding 90 mu L of 250 mu M ThT solution, fully mixing uniformly, and detecting the fluorescence intensity under the conditions of excitation wavelength of 440nm and emission wavelength of 480 nm. The detection result is shown in FIG. 5, which shows that the fluorescence intensity of wild type alpha SN is gradually enhanced along with the increase of the culture time, and the wild type alpha SN basically enters a stable period after 12 hours; in 6 mutant proteins, the fluorescence intensities of alpha SN4F and alpha SN39Y are also enhanced along with the increase of time, and basically enter a stable period after 24 hours; the other 4 mutant proteins had lower fluorescence intensities. The above results demonstrate that: pAzF introduced at positions 4 and 39 has a small effect on the aggregation of the protein itself, and when the amino acids at the other 4 positions are substituted, the protein basically loses the aggregation, so that two mutant proteins of alpha SN4F and alpha SN39Y are selected for subsequent experiments.

TBS buffer solution was used as the protein and ThT buffer solution, and pH was 5.0.

Example 4: construction of EPB-alpha SN 4F/alpha SN39Y System

The invention adopts copper-catalyzed azide terminal alkyne cycloaddition reaction (CuAAC) to connect EPB with alpha SN4F or alpha SN39Y to construct an EPB-alpha SN4F or EPB-alpha SN39Y system, as shown in figure 6-a. 1mL of reaction system, the reaction conditions and the added amounts of the reagents used were as follows:

then 1mL was made up with PBS. Mix and shake gently, react at 4 ℃ for 8h (both buffer and reagent are prepared in PBS). After the reaction is finished, desalting the reaction system by using a dialysis bag or a desalting column, removing redundant ions and the like, and keeping the dialysis or desalting process at low temperature as much as possible.

In order to verify whether the system is successfully constructed, the method of scanning in the wavelength range of 200-600nm by using a UV-visible spectrophotometer is used for comparing and detecting the change of the absorbance of the target protein before and after the EPB is marked, and the result is shown in FIGS. 6-b and 6-c. As is evident from the figure, the absorbance of EPB-alpha SN4F or EPB-alpha SN39Y complex after EPB labeling in the wavelength range of 250-350 nm is obviously greater than that of alpha SN4F or alpha SN39Y before the EPB labeling, which is the phenomenon that the absorbance is enhanced due to the pi-pi bond on the EPB, and the successful connection of EPB to alpha SN4F or alpha SN39Y is proved.

Example 5: use of EPB-alpha SN4F or EPB-alpha SN39Y systems

In order to identify whether the system can be really applied to screening of aggregation inhibitors, a small-molecule inhibitor EGCG with alpha SN aggregation inhibition effect is selected for verification.

EGCG powder was formulated in 100. mu.M stock solution with PBS buffer. EGCG and EPB-alpha SN4F or EPB-alpha SN39Y solutions with the same final concentration (20 mu M) were placed in 96-well cell culture plates to prepare a 200 mu L system. After fully mixing, scanning and detecting by using a fluorescence spectrophotometer under the following detection conditions: the excitation wavelength is 350nm, and the emission wavelength is 380nm-600 nm. And the same final concentration of EPB-alpha SN4F or EPB-alpha SN39Y without EGCG was used as a control.

As shown in FIG. 7, the fluorescence value of the EGCG solution as a blank control in the scanning range, especially in the range of 450-550nm, is very low, while the fluorescence value of the EPB-alpha SN4F or EPB-alpha SN39Y solution without EGCG is obviously higher than that of the sample with EGCG. The result proves that the EGCG inhibits the aggregation of the target protein, so that the aggregation-induced emission system is in a free state, the fluorescence value is low, and when the EGCG is not added, the target protein forms an aggregate, and finally the induction system emits strong fluorescence. In addition, analysis results show that the fluorescence value is highest when the emission wavelength is 490nm in the scanning range, and the fluorescence value can be used as a detection condition for rapidly screening small-molecule drugs in the later period.

Example 6 investigation of aggregation Properties

(1) Constructing a luminescent system, namely, fully mixing alpha SN with an EPB solution with equal concentration, wherein the final concentration is 20 mu M; alpha SN4F or alpha SN39Y is fully mixed with EPB with equal concentration, and the final concentration is 20 mu M; ③ 20. mu.M EPB-alpha SN4F or EPB-alpha SN 39Y;

(2) respectively carrying out scanning detection on the system by using a fluorescence spectrophotometer under the following detection conditions: the excitation wavelength is 350nm, and the emission wavelength is 380nm-600 nm.

As a result, as shown in fig. 8, it is understood from fig. 8 that EPB cannot generate fluorescence with aggregation of α SN, that is, EPB alone cannot be used for the study of α SN aggregation characteristics. The pAzF mutated alpha SN can not cause EPB polymerization to generate fluorescence in the aggregation process, and the EPB-alpha SN4F or EPB-alpha SN39Y constructed by the invention can induce a system to emit stronger fluorescence when forming the aggregate.

In conclusion, the aggregation-induced emission system constructed by the invention can be applied to screening of an alpha SN aggregation inhibitor, and when the inhibitor exists in a solution, the aggregation of the alpha SN can be inhibited, so that the sensor does not emit light; and when the solution does not contain the inhibitor, the alpha SN is rapidly gathered, so that the sensor can emit stronger fluorescence, the detection can be carried out by utilizing a fluorescence spectrophotometer, and the inhibition effect of the small molecular inhibitor is judged according to the fluorescence intensity.

Sequence listing

<110> Tianjin science and technology university

<120> alpha-synuclein aggregation-induced emission system and construction and application thereof

<130> 1

<141> 2019-08-01

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 429

<212> DNA

<213> person ()

<400> 1

catatggatg tgtttatgaa aggcctgagc aaagccaagg aaggcgtggt ggccgccgcc 60

gagaaaacca aacagggtgt ggccgaagcc gccggtaaaa ccaaagaggg cgtgctgtac 120

gtgggtagca agaccaaaga aggtgtggtg cacggcgttg ccaccgtggc cgaaaagacc 180

aaggaacagg tgaccaacgt gggtggtgca gtggtgaccg gtgttaccgc cgtggcccag 240

aaaaccgtgg aaggtgccgg tagtattgcc gccgccaccg gttttgtgaa gaaagaccag 300

ctgggcaaga acgaagaagg tgccccgcag gaaggtattc tggaagatat gccggttgat 360

cctgataacg aagcctatga gatgccgagc gaagaaggct accaggatta tgaaccggaa 420

gccctcgag 429

<210> 2

<211> 140

<212> PRT

<213> person ()

<400> 2

Met Asp Val Phe Met Lys Gly Leu Ser Lys Ala Lys Glu Gly Val Val

1 5 10 15

Ala Ala Ala Glu Lys Thr Lys Gln Gly Val Ala Glu Ala Ala Gly Lys

20 25 30

Thr Lys Glu Gly Val Leu Tyr Val Gly Ser Lys Thr Lys Glu Gly Val

35 40 45

Val His Gly Val Ala Thr Val Ala Glu Lys Thr Lys Glu Gln Val Thr

50 55 60

Asn Val Gly Gly Ala Val Val Thr Gly Val Thr Ala Val Ala Gln Lys

65 70 75 80

Thr Val Glu Gly Ala Gly Ser Ile Ala Ala Ala Thr Gly Phe Val Lys

85 90 95

Lys Asp Gln Leu Gly Lys Asn Glu Glu Gly Ala Pro Gln Glu Gly Ile

100 105 110

Leu Glu Asp Met Pro Val Asp Pro Asp Asn Glu Ala Tyr Glu Met Pro

115 120 125

Ser Glu Glu Gly Tyr Gln Asp Tyr Glu Pro Glu Ala

130 135 140

<210> 3

<211> 33

<212> DNA

<213> Artificial Synthesis ()

<400> 3

ggaattccat atggatgtgt ttatgaaagg cct 33

<210> 4

<211> 29

<212> DNA

<213> Artificial Synthesis ()

<400> 4

ccgctcgagg gcttccggtt cataatcct 29

<210> 5

<211> 33

<212> DNA

<213> Artificial Synthesis ()

<400> 5

ggaattccat atggatgtgt agatgaaagg cct 33

<210> 6

<211> 25

<212> DNA

<213> Artificial Synthesis ()

<400> 6

ttgctaccca cctacagcac gccct 25

<210> 7

<211> 25

<212> DNA

<213> Artificial Synthesis ()

<400> 7

agggcgtgct gtaggtgggt agcaa 25

<210> 8

<211> 23

<212> DNA

<213> Artificial Synthesis ()

<400> 8

ctttcttcac ctaaccggtg gcg 23

<210> 9

<211> 23

<212> DNA

<213> Artificial Synthesis ()

<400> 9

cgccaccggt taggtgaaga aag 23

<210> 10

<211> 38

<212> DNA

<213> Artificial Synthesis ()

<400> 10

ccgctcgagg gcttccggtt cataatcctg ctagccaa 38

<210> 11

<211> 36

<212> DNA

<213> Artificial Synthesis ()

<400> 11

ccgctcgagg gcttccggtt cctaatcctg gtagcc 36

Claims (6)

1. An alpha SN aggregation-induced luminescent fusion is characterized in that the alpha SN aggregation-induced luminescent fusion is specifically EPB-alpha SN39Y, wherein the 39 th tyrosine in an alpha SN amino acid sequence is replaced by p-azidophenylalanine pAZF to obtain alpha SN39Y mutant protein, and then the biological orthogonal connection reaction is carried out on AIE molecule EPB and the mutant protein alpha SN39Y to obtain EPB-alpha SN 39Y;

the alpha SN amino acid sequence is shown in a sequence table SEQ ID No. 2;

the EPB has the chemical formula: c ₃₈ H ₄₄ N ₂ O ₂ Br ₂ 。

2. The method for constructing an α SN aggregation-induced emission fusion according to claim 1, which comprises the following steps:

(1) obtaining a protein expression gene of substituting pAZF for the 39 th tyrosine in the alpha SN by a gene synthesis or PCR method, and obtaining an alpha SN39Y mutant protein by an escherichia coli expression method;

(2) and carrying out bio-orthogonal ligation reaction on the EPB and the mutant protein alpha SN39Y by using copper-catalyzed azide terminal alkyne cycloaddition reaction to obtain EPB-alpha SN 39Y.

3. The method for constructing the alpha SN aggregation-induced emission fusion body as claimed in claim 2, wherein the method for constructing the EPB-alpha SN39Y screening system by connecting EPB and alpha SN39Y through copper-catalyzed azide-terminated alkyne cycloaddition reaction is as follows: 1mL of reaction system, the reaction conditions and the added amounts of the reagents used were as follows:

then make up 1mL with PBS; reacting for 8 hours at 4 ℃, and desalting the reaction system by using a dialysis bag or a desalting column after the reaction is finished.

4. Use of an α SN aggregation-inducing luminescent fusion of claim 1 in the screening of α SN aggregation inhibitors.

5. The use according to claim 4, in particular for screening inhibitors of α SN aggregation, as follows: adding a potential inhibitor into the EPB-alpha SN39Y solution, detecting fluorescence intensity within the range of excitation wavelength of 350nm and emission wavelength of 380nm-600nm, and judging the potential inhibitor to be an alpha SN aggregation inhibitor if the fluorescence intensity is weaker than that of an EPB-alpha SN39Y system without the potential inhibitor.

6. Use according to claim 5, wherein detection is carried out at a concentration of EPB- α SN39Y of 20 μ M, an excitation wavelength of 350nm and an emission wavelength of 490 nm.

Images