CN110548135B

CN110548135B - Phosphorylated polypeptide antigen vaccine, preparation method and application thereof

Info

Publication number: CN110548135B
Application number: CN201810551372.1A
Authority: CN
Inventors: 孔维; 吴慧; 孙瑶; 郭永青
Original assignee: CHANGCHUN BCHT BIOTECHNOLOGY Co; Jilin University
Current assignee: CHANGCHUN BCHT BIOTECHNOLOGY Co; Jilin University
Priority date: 2018-05-31
Filing date: 2018-05-31
Publication date: 2023-06-06
Anticipated expiration: 2038-05-31
Also published as: CN110548135A; EP3804748A1; WO2019228032A1; EP3804748A4

Abstract

The invention discloses a phosphorylated polypeptide antigen vaccine, which comprises at least two polypeptide fragments or conservatively modified variants thereof from human full-length Tau protein, wherein the polypeptide fragments or conservatively modified variants thereof contain a phosphorylation site. The invention also discloses a complex vaccine formed by coupling the phosphorylated polypeptide antigen vaccine and a carrier, and the polypeptide antigen vaccine and the complex vaccine can be used for preventing and/or treating Tau protein diseases (tauopathy) including Alzheimer's Disease (AD).

Description

Phosphorylated polypeptide antigen vaccine, preparation method and application thereof

Technical Field

The present invention relates to the field of molecular biology. In particular, the invention relates to splicing truncated Tau proteins to form a phosphorylated polypeptide antigen vaccine, preferably linked to an appropriate carrier to prepare a complex vaccine, which can be used for the prevention and/or treatment of Tau protein diseases (AD) including Alzheimer's disease.

Background

Alzheimer's Disease (AD) is a progressive neurodegenerative disease that results in defective cognitive function, decline in learning, memory, language, and motor functions in patients. Concomitant behavioral, emotional, interpersonal, and social deterioration of patients as the disease progresses; advanced patients are unable to speak, have impaired linguistic understanding, and are unable to self-care. Several drugs currently being approved can achieve control and relief of symptoms and side effects from AD, as well as improved quality of life, but there is still an unmet need for therapies that directly target the course of the disease and have improved therapeutic effects.

Histopathological features of AD include deposition of extra-neuronal plaques in the brain, neurofibrillary tangles both intracellular and extracellular and loss of neurons. Numerous studies have shown that Tau protein plays an important role in AD lesions, and is also the most downstream change in the course of AD pathology. Studies have shown that aβ neurotoxicity in cultured neurons appears to be dependent on Tau protein; reducing the Tau protein content in a tauopathic model restores its memory function. In addition, lowering endogenous Tau protein inhibited behavioral defects in transgenic mice expressing human amyloid precursors without altering aβ levels. Thus, therapies targeting Tau protein may be an effective strategy for treating tauopathies, including AD.

Tau protein is a microtubule-binding protein that mediates the assembly of tubulin monomers into Microtubules (MT) that form the network of neuronal microtubules; tau protein carries nutrients, transmitters and the like on microtubules through the effects of phosphorylation and dephosphorylation, and has important significance for the correct formation and execution of functions of a neuron circuit. Experiments in vitro and in non-neuronal cells also showed that Tau binding to MT was controlled by dynamic phosphorylation and dephosphorylation. When Tau proteins are hyperphosphorylated, tau proteins aggregate with each other and detach from MT, which destabilizes itself, forming neurofibrillary tangles (NFT) and neuronal loss.

Despite the widespread pathogenesis of AD in the population, its pathogenesis is so far not completely clear and current research and therapeutic approaches remain unmet. Experiments by Asuni et al in a mouse model of Tau protein disease showed that reduced neurofibrillary tangles and improved function occurred after mice were vaccinated with the Tau protein-derived phosphopeptide. Small molecules of short peptides, although generally capable of interacting with immune response products, often fail to elicit a response alone, these peptide immunogens, also known as "haptens", are not capable of producing immunogenicity on their own or eliciting antibodies in vivo, and can only be prepared into immunogenic compositions by coupling them to a suitable carrier. On the other hand, the full length recombinant Tau protein expressed in the prokaryotic system appears to be unsuitable as a vaccine.

In view of the foregoing, there is a need in the art to develop a method for effectively preventing and/or treating tauopathies.

Disclosure of Invention

The invention aims at the defects, and designs a phosphorylated polypeptide antigen vaccine and a complex vaccine formed by coupling the phosphorylated polypeptide antigen vaccine with a carrier which is suitable for the phosphorylated polypeptide antigen vaccine based on the human full-length Tau protein, so as to be used for preventing and/or treating the Tau protein diseases including AD. The vaccine of the invention has good safety, high immunogenicity and high titer of the induced antibody.

In particular, a first aspect of the invention provides a phosphorylated polypeptide antigen vaccine comprising at least two polypeptide fragments from a human full-length Tau protein or conservatively modified variants thereof, wherein said polypeptide fragments or conservatively modified variants thereof contain a phosphorylation site. In some embodiments, the phosphorylated polypeptide antigen vaccine has an additional cysteine residue at its C' terminus.

In the context of the present invention, the term "phosphorylated polypeptide antigen vaccine" means a phosphorylated polypeptide, and may be used interchangeably with the term "phosphorylated polypeptide".

In some embodiments, the polypeptide fragment is from a region of the human full-length Tau protein that is enriched in phosphorylation modification sites. In some preferred embodiments, the polypeptide fragment is from the following region of a human full-length Tau protein: amino acids 14-22 of human full-length Tau protein, amino acids 194-266 of human full-length Tau protein and/or amino acids 392-408 of human full-length Tau protein.

In some embodiments, the polypeptide fragments are linked directly by peptide bonds or are linked by amino acid linkers. In a preferred embodiment, the polypeptide fragments are directly linked by peptide bonds.

In some specific embodiments, the phosphorylation site comprises an amino acid site that is phosphorylated at

positions

18, 202, 205, 212, 214, 231, 235, 238, 262, 396, and 404 of an amino acid sequence corresponding to a human full-length Tau protein, i.e., 18 (P-Tyr ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ ) And 404 (P-Ser) ₄₀₄ ) Preferably all of the sites. In some preferred embodiments, 1 to 4, preferably 1 to 3, more preferably 1 to 2, most preferably 1 Ser sites of the phosphorylation sites are replaced by aspartic acid and/or 1 to 4, preferably 1 to 3, more preferably 1 to 2, most preferably 1 Thr sites of the phosphorylation sites are replaced by glutamic acid, whereby the overall net charge of the obtained polypeptide fragment or conservatively modified variant thereof and the charge distribution on its molecule remain substantially the same as before the replacement. Such mimicking of phosphorylation by substitution of the phosphorylation site by aspartic acid and/or glutamic acid is well known in the art.

In some embodiments, conservatively modified variants of a polypeptide fragment comprised by a phosphorylated polypeptide antigen vaccine of the present invention are variants of one or more amino acids, preferably 1 to 10 amino acids, more preferably 1 to 6 amino acids, more preferably 1 to 4 amino acids, more preferably 1 to 3 amino acids, most preferably 1 amino acid of the polypeptide fragment is conservatively substituted with a functionally similar amino acid. Such conservative substitutions are well known in the art and include the following 6 groups of amino acids:

1) Alanine (a), serine (S), threonine (T);

2) Aspartic acid (D), glutamic acid (E);

3) Asparagine (N), glutamine (Q);

4) Arginine (R), lysine (K);

5) Isoleucine (I), leucine (L), methionine (M), valine (V);

6) Phenylalanine (F), tyrosine (Y), tryptophan (W).

The overall net charge of the polypeptide fragment variants thus obtained and the charge distribution on its molecules remain substantially the same as before the substitution.

In some preferred embodiments, the phosphorylated polypeptide antigen vaccine has an amino acid sequence set forth in any one of SEQ ID NO.1 through SEQ ID NO.1331, and the amino acid sequence comprises a polypeptide selected from 18 (P-Tyr ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ ) And 404 (P-Ser) ₄₀₄ ) A phosphorylation site of two or more of (a) a polypeptide. In some embodiments, the phosphorylated polypeptide antigen vaccine has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, preferably at least 98%, more preferably at least 99% sequence identity to any one of SEQ ID No.1 to SEQ ID No.1331, which has substantially the same immunogenic activity as the pre-phosphorylated polypeptide antigen vaccine, and the amino acid sequence comprises a polypeptide selected from the group consisting of 18 (P-Tyr ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ ) And 404 (P-Ser) ₄₀₄ ) A phosphorylation site of two or more of (a) a polypeptide.

In a more preferred embodiment, the phosphorylated polypeptide antigen vaccine has an amino acid sequence as set forth in any one of SEQ ID No.201, SEQ ID No.225, SEQ ID No.306, SEQ ID No.387, SEQ ID No.468, SEQ ID No.558, SEQ ID No.567, SEQ ID No.769, SEQ ID No.784, SEQ ID No.875, SEQ ID No.1020, SEQ ID No.1101, SEQ ID No.1182, SEQ ID No.1272, SEQ ID No.1313, and SEQ ID No.1330, and the amino acid sequence comprises a polypeptide selected from the group consisting of 18 (P-Tyr ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ ) And 404 (P-Ser) ₄₀₄ ) A phosphorylation site of two or more of (a) a polypeptide. In some embodiments, the phosphorylated polypeptide antigen vaccine has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, preferably at least 98%, more preferably at least 99% sequence identity to any of the above sequences, which has a sequence identity to any of the above sequencesThe orthophosphorylated polypeptide antigen vaccine has substantially the same immunogenic activity and the amino acid sequence comprises a polypeptide selected from the group consisting of 18 (P-Tyr ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ ) And 404 (P-Ser) ₄₀₄ ) A phosphorylation site of two or more of (a) a polypeptide.

In a particular specific embodiment, the phosphorylated polypeptide antigen vaccine has an amino acid sequence as set forth in any one of SEQ ID No.201, SEQ ID No.225, SEQ ID No.306, SEQ ID No.387, SEQ ID No.468, SEQ ID No.558, SEQ ID No.567, SEQ ID No.769, SEQ ID No.784, SEQ ID No.875, SEQ ID No.1020, SEQ ID No.1101, SEQ ID No.1182, SEQ ID No.1272, SEQ ID No.1313, and SEQ ID No.1330, and the amino acid sequences each have a phosphorylation site as set forth below: 18 (P-Tyr) ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )；18(P-Tyr ₁₈ )、202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )；18(P-Tyr ₁₈ )、212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )；18(P-Tyr ₁₈ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )；18(P-Tyr ₁₈ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )；18(P-Tyr ₁₈ )、396(P-Ser ₃₉₆ )、404(P-Ser ₄₀₄ )；202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )；202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )；202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )；202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、396(P-Ser ₃₉₆ )、404(P-Ser ₄₀₄ )；202(P-Ser ₂₀₂ )、205(P-Thr ₂₀₅ )、396(P-Ser ₃₉₆ )、404(P-Ser ₄₀₄ )；212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、231(P-Thr ₂₃₁ )、235(P-Ser ₂₃₅ )；212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )；212(P-Thr ₂₁₂ )、214(P-Ser ₂₁₄ )、396(P-Ser ₃₉₆ )、404(P-Ser ₄₀₄ )；238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ )、404(P-Ser ₄₀₄ )；238(P-Ser ₂₃₈ )、262(P-Ser ₂₆₂ )、396(P-Ser ₃₉₆ )、404(P-Ser ₄₀₄ )。

In a second aspect, the invention provides a complex vaccine formed by coupling a phosphorylated polypeptide antigen vaccine of the first aspect of the invention to a carrier.

In some embodiments, the carrier is selected from the group consisting of human serum albumin, keyhole limpet hemocyanin, bacterial-like particle (BLP), immunoglobulin molecules, thyroglobulin, ovalbumin, bovine serum albumin component V, influenza hemagglutinin, PAN-DR binding peptide (PADRE polypeptide), malaria Circumsporon (CS) protein, hepatitis b surface antigen (HBSAg 19-28), heat Shock Protein (HSP) 65, BCG, cholera toxin, attenuated cholera toxin variants, diphtheria toxin, norovirus capsid P protein, recombinant streptococcal C5a peptidase, streptococcus pyogenes ORF1224, streptococcus pyogenes ORF2452, pneumolysin, attenuated streptococcus pneumoniae variant, chlamydia ORFT367, chlamydia pneumoniae ORFT858, tetanus toxoid, HIV gp120T1, components that recognize microbial surface adhesion matrix molecules (MSCRAMMS), growth factors/hormones, chemotactic factors, and the like, and complexes formed by coupling or mixing with the carrier can stimulate specific immune responses to the phosphorylated polypeptides of the organism.

In some preferred embodiments, the vector is a norovirus capsid P protein.

The term "norovirus P protein", also referred to herein simply as P protein (P protein), refers to P protein in the capsid protein of the norovirus, which is capable of self-assembly into P particles in vitro. As used herein, P protein is used at the gene level, meaning a fragment of a gene, nucleotide sequence, plasmid, etc., encoding a P protein; p protein is used at the protein level, meaning a P protein monomer or multimer.

The term P Particle (PP) refers to a protein particle in the norovirus that is self-assembled from P protein in vitro, most commonly in the form of a 24-mer. As used herein, P Particle (PP) is used only at the protein level, meaning forms of multimers (e.g., 24-mers, etc.), including various proteins for use in property detection and proteins for immunization.

In some specific embodiments, one amino acid in each of the three loops in the loop domain of the norovirus capsid P protein is mutated to a cysteine to facilitate chemical ligation to the phosphorylated polypeptide vaccine, and the mutated modified norovirus capsid P protein is designated PP-3C (sequence shown in SEQ ID No. 1357), wherein the mutation does not cause a frame shift mutation of the norovirus P protein.

In other specific embodiments, three loops in the loop domain of the norovirus P protein are each inserted with a lysine to facilitate chemical coupling to the spliced phosphorylated polypeptide, and the mutant modified norovirus capsid P protein is designated PP-3K (sequence shown in SEQ ID No. 1359), wherein the mutation does not cause a frameshift mutation of the norovirus P protein.

In other preferred embodiments, the carrier is a bacterial-like particle (BLP).

In some specific embodiments, the BLP is coupled to a phosphorylated polypeptide antigen vaccine by means of a protein connector Protein (PA); specifically, the BLP is linked to PA (i.e., C-PA) to which GGGGSCGGGGS sequence is added at its N-terminus by covalent binding to thereby obtain C-PA-BLP, which is then coupled to a phosphorylated polypeptide antigen vaccine having cysteine at its C-terminus.

The term "bacteria-like particles (BLP)" is a novel mucosal adjuvant, which is obtained by heat acid treatment of lactococcus lactis, is a spherical particle with no living activity, and mainly comprises lactococcus lactis peptidoglycan shells. The BLP particles act as carriers for the antigen component of the vaccine, and can effectively bind to the antigen and display the antigen on the surface thereof. The peptidoglycan shell of BLP itself activates the innate immune system to function as an adjuvant by acting with Toll-like receptors. BLP may be obtained by methods known in the art.

The term "Protein Adapter (PA)" is a PA protein that is the whole or truncated sequence of the lactococcus lactis cell wall hydrolase ACMA cell wall binding region. The PA protein used in the invention is a product (namely C-PA protein) obtained by adding GGGGSCGGGGS sequences to the N-terminal of 219-437 amino acid sequences of lactococcus lactis cell wall hydrolase ACMA (GenBank: U17696.1), and the sequence is shown as SEQ ID NO: 1364.

A third aspect of the invention provides a method of preparing a complex vaccine of the second aspect of the invention, the method comprising the steps of:

1) Artificially synthesizing the phosphorylated polypeptide antigen vaccine of the first aspect of the invention;

2) Preparing a carrier to be coupled with the phosphorylated polypeptide antigen vaccine;

3) Mixing the phosphorylated polypeptide antigen vaccine with the carrier to perform a coupling reaction;

4) Isolating and purifying the conjugate body obtained in 3), thereby obtaining the complex vaccine.

In some embodiments, the vector in step 2) of the method is a norovirus capsid P protein, preferably PP-3C or PP-3K, specifically comprising the steps of:

i) Obtaining an expression vector comprising a nucleic acid encoding a PP-3C or PP-3K protein;

ii) transferring the expression vector into a recipient cell;

iii) Expressing the PP-3C or PP-3K protein and self-assembling the protein into recombinant P particles in a receptor cell,

preferably, the method further comprises separation and purification steps. In some specific embodiments, purification may be performed using ion exchange chromatography and/or hydrophobic chromatography.

In some embodiments, step 3) of the method uses PP-3C as a vaccine carrier for coupling, the preferred buffer system being an ammonium bicarbonate buffer system, the preferred pH range being 7.5-8.8; preferably, the phosphorylated polypeptide antigen vaccine is mixed with the carrier in a ratio of 10:1-100:1, and the preferable reaction temperature is 2-10 ℃.

In some embodiments, step 3) of the method uses PP-3K as a vaccine carrier for coupling, a preferred buffer system is a phosphate buffer system, preferably having a pH in the range of 7.0 to 8.5; preferably, the phosphorylated polypeptide antigen vaccine is mixed with the carrier in a ratio of 10:1-100:1, and the preferred reaction temperature is in the range of 2-25 ℃.

In other embodiments, the carrier in step 2) of the method is a bacterial-like particle BLP. In some embodiments, step 3) of the method specifically comprises i) obtaining a purified protein adaptor C-PA protein (sequence shown as SEQ ID NO: 1364); ii) ligating the carrier bacterial-like particle BLP obtained in step 2) with a C-PA protein to obtain C-PA-BLP; iii) Coupling C-PA-BLP with the phosphorylated polypeptide antigen vaccine; wherein the buffer system is a Tris buffer system, and the preferable pH range is 7.2-8.8; the preferred concentration of the C-PA protein is 0.1 mg/mL-1.5 mg/mL, and the preferred reaction temperature range is 2-30 ℃. In some embodiments, the buffer system employed in step 3) of the method is an ammonium bicarbonate buffer system, preferably having a pH in the range of 7.5 to 8.8; preferably, the phosphorylated polypeptide antigen vaccine is mixed with the C-PA-BLP in a ratio of 10:1-100:1, and the preferable reaction temperature is 2-10 ℃.

In some embodiments, step 4) of the method comprises removing the unsuccessfully linked vector and polypeptide antigen by centrifugation, dialysis, ultrafiltration, and the like.

In a fourth aspect the invention provides a vaccine composition comprising a phosphorylated polypeptide antigen vaccine of the first aspect of the invention or a complex vaccine of the second aspect of the invention. Preferably, the vaccine composition further comprises a pharmaceutically acceptable adjuvant.

In some embodiments, the pharmaceutically acceptable adjuvant is selected from one or more of CpG, MF59, AS02, AS03, freund's complete adjuvant, and freund's incomplete adjuvant.

In a fifth aspect the invention provides the use of a phosphorylated polypeptide antigen vaccine of the first aspect of the invention or a complex vaccine of the second aspect of the invention or a vaccine composition of the fourth aspect of the invention for the manufacture of a medicament for the prevention and/or treatment of neurodegenerative disorders.

In the present invention, the "neurodegenerative disorders" include, but are not limited to, AD, creutzfeldt-Jakob disease, dementia pugilistica, down's syndrome, grassler-Sachs disease, inclusion body myositis, prion protein cerebral amyloid angiopathy and traumatic brain injury, amyotrophic lateral sclerosis/Parkinson's syndrome-dementia complex, silver-philic particulate dementia, basal ganglia (cobticbasal) degeneration, diffuse neurofibrillary tangles with calcification, chromosome 17 linked frontotemporal dementia with Parkinson's syndrome, ha-Schlemen-Spatz disease, multisystemic atrophy, nypi-skin disease, pick disease, progressive subcutaneous gliosis, progressive supranuclear encephalitis, preferably AD.

In some embodiments, the vaccine or vaccine composition is preferably immunized by subcutaneous or intraperitoneal or intramuscular route, more preferably by intramuscular route.

In a sixth aspect the invention provides the use of a phosphorylated polypeptide antigen vaccine of the first aspect of the invention or a complex vaccine of the second aspect of the invention or a vaccine composition of the fourth aspect of the invention for the manufacture of a medicament for maintaining or improving, preferably restoring, more preferably completely restoring, cognitive memory in a mammal, in particular a human.

In a seventh aspect the invention provides a method of treating or preventing a neurodegenerative disorder comprising administering to a subject a phosphorylated polypeptide antigen vaccine of the first aspect of the invention or a complex vaccine of the second aspect of the invention or a vaccine composition of the fourth aspect of the invention.

In some embodiments, the subject is a mammal, preferably a human.

In some embodiments, the vaccine or vaccine composition is preferably administered by subcutaneous or intraperitoneal or intramuscular route, more preferably by intramuscular route.

In an eighth aspect the present invention provides a method of maintaining or improving, preferably restoring, more preferably fully restoring, cognitive memory in a subject comprising administering to said subject a phosphorylated polypeptide antigen vaccine of the first aspect of the invention or a complex vaccine of the second aspect of the invention or a vaccine composition of the fourth aspect of the invention.

In a ninth aspect, the present invention provides a norovirus capsid protein for coupling with a phosphorylated polypeptide antigen vaccine of the first aspect of the present invention, wherein one amino acid of each of the three loops in the loop domain is mutated to a cysteine, whereby the resulting protein is referred to as PP-3C (sequence shown in SEQ ID No. 1357), or one lysine is inserted, whereby the resulting protein is referred to as PP-3K (sequence shown in SEQ ID No. 1359).

In a tenth aspect, the invention provides a method for preparing the norovirus capsid P protein of the ninth aspect of the invention, comprising the steps of:

ii) transferring the expression vector into a recipient cell;

In an eleventh aspect the invention provides a connector protein having a GGGGSCGGGGS sequence inserted at the N-terminus-the connector protein thus obtained is C-PA (sequence shown as SEQ ID NO. 1364).

In a twelfth aspect, the invention provides a method of preparing a connector protein according to the eleventh aspect of the invention, comprising the steps of:

i) Obtaining an expression vector comprising a nucleic acid encoding a C-PA protein;

ii) transferring the expression vector into a host cell;

iii) Expressing the C-PA protein and separating and purifying the C-PA protein.

Drawings

Figures 1A to 1E show the maps of the respective recombinant plasmid constructs. FIG. 1A is a schematic diagram of a constructed pET26b-PP plasmid; FIG. 1B is a schematic diagram of a constructed pET26B-PP-3C plasmid; FIG. 1C is a schematic representation of a constructed pET28a-PP plasmid; FIG. 1D is a schematic diagram of a constructed pET28a-PP-3K plasmid; FIG. 1E is a schematic representation of a constructed pColdIV-PP-3C plasmid.

FIGS. 2A to 2C show graphs of recombinant pET26b plasmid constructs and purified expression results. FIG. 2A is a schematic illustration of PP-3C particles; FIG. 2B is a schematic diagram of double restriction enzyme identification of the constructed pET26B-PP-3C plasmid, wherein the target band is 1000bp; FIG. 2C is a diagram of a non-denaturing electrophoresis gel of samples of PP-3C protein and PP-3K protein, wherein bands of the two proteins are above 250kDa, and the two proteins are analyzed to be in 12-mer and 24-mer forms.

FIGS. 3A to 3C show graphs of recombinant pET28a plasmid constructs and purified expression results. FIG. 3A is a schematic illustration of PP-3K particles; FIG. 3B is a schematic diagram of double restriction enzyme identification of the constructed pET28a-PP-3K plasmid, wherein the target band is 1000bp; FIG. 3C is an SDS-PAGE plot of peak protein samples of the protein of interest, as shown by enrichment at 35 kDa.

FIG. 4 shows an electron micrograph of recombinant pET28a-PP-3K protein particles.

FIG. 5 shows an electron micrograph of recombinant pET26b-PP-3C protein particles.

Figures 6A to 6H show IgG antibody levels against different antigens generated after immunization of mice with phosphorylated polypeptide antigen vaccine in combination with freund's adjuvant. FIG. 6A shows the anti-Tau 14-22 (pY 18) IgG antibody levels generated after immunization of WT mice with A1-A16 vaccine, with 6 mice per group, each group receiving four immunizations, the first immunization with complete Freund's adjuvant, the second, third, and fourth immunizations with incomplete Freund's adjuvant, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6B shows anti-Tau 198-209 (pS 202/pT 205) IgG antibodies generated after immunization of WT mice with A1-A16 vaccine, 6 mice per group, four immunizations with complete Freund's adjuvant for the first, incomplete Freund's adjuvant for the second, third and fourth immunization, and two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6C shows anti-Tau 208-218 (pT 212/pS 214) IgG antibodies generated after immunization of WT mice with A1-A16 vaccine, 6 mice per group, four immunizations each, the first immunization with complete Freund's adjuvant, the second, third and fourth immunizations with incomplete Freund's adjuvant, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6D shows anti-Tau 227-239 (pS 231/pS 235) IgG antibodies generated after immunization of WT mice with A1-A16 vaccine, 6 mice per group, four immunizations of each group, the first immunization with complete Freund's adjuvant, the second, third, and fourth immunizations with incomplete Freund's adjuvant, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6E shows anti-Tau 234-242 (pS 238) IgG antibodies generated after immunization of WT mice with A1-A16 vaccine, 6 mice per group, each group received four immunizations, the first immunization with complete Freund's adjuvant, the second, third, and fourth immunizations with incomplete Freund's adjuvant, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6F shows immunization of anti-Tau 258-266 (pS 262) IgG antibodies in WT mice with A1-A16 vaccine, 6 mice per group, four immunizations with complete Freund's adjuvant for the first, incomplete Freund's adjuvant for the second, third, and fourth immunizations, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6G shows immunization of anti-Tau 392-400 (pS 396) IgG antibodies in WT mice with A1-A16 vaccine, 6 mice per group, four immunizations with complete Freund's adjuvant for the first, incomplete Freund's adjuvant for the second, third, and fourth immunizations, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice; FIG. 6H shows immunization of anti-Tau 401-408 (pS 404) IgG antibodies in WT mice with A1-A16 vaccine, 6 mice per group, four immunizations with complete Freund's adjuvant for the first, incomplete Freund's adjuvant for the second, third, and fourth immunization, two weeks apart. Two weeks after the fourth immunization, blood was collected and mouse serum was obtained for ELISA experiments. Results are expressed as average o.d. + SD values obtained for each group of mice.

Figures 7A to 7S show the results of immunization of mice via different immunization routes with phosphorylated polypeptide antigens conjugated to norovirus P protein. Six mice in each group were immunized 4 times, each time two weeks apart, and serum was obtained by blood sampling at the fourth, sixth and eighth weeks after the first immunization for ELISA experiments. FIG. 7A shows the results of muscle immunization of WT mice immunized with A1 conjugated to norovirus P protein, and ELISA method for detection of anti-Tau 14-22 (pY 18) IgG antibodies and anti-Tau 198-209 (pS 202/pT 205) IgG antibody content in mouse serum. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7B shows the results of muscle immunization of WT mice immunized with norovirus P protein-conjugated A5, and ELISA method for detection of anti-Tau 14-22 (pY 18) IgG antibody, anti-Tau 234-242 (pS 238) IgG antibody, and anti-Tau 258-266 (pS 262) IgG antibody content in serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7C shows the results of muscle immunization of WT mice immunized with A9 conjugated to norovirus P protein, and ELISA method for detection of anti-Tau 198-209 (pS 202/pT 205) IgG antibody, anti-Tau 234-242 (pS 238) IgG antibody and anti-Tau 258-266 (pS 262) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7D shows the results of muscle immunization of WT mice immunized with norovirus P protein-conjugated A10, and ELISA method for detection of anti-Tau 198-209 (pS 202/pT 205) IgG antibodies, anti-Tau 392-400 (pS 396) IgG antibodies, and anti-Tau 401-408 (pS 404) IgG antibody levels in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7E shows the results of muscle immunization of WT mice immunized with A11 conjugated to norovirus P protein, and ELISA method was used to detect anti-Tau 198-209 (pS 202/pT 205) IgG antibodies, anti-Tau 392-400 (pS 396) IgG antibodies, and anti-Tau 401-408 (pS 404) IgG antibody levels in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7F shows the results of muscle immunization of WT mice immunized with A12 conjugated with norovirus P protein, and ELISA method was used to detect anti-Tau 208-218 (pT 212/pS 214) IgG antibodies and anti-Tau 227-239 (pS 231/pS 235) IgG antibody content in the serum of the mice. Results are expressed as average o.d. + SD to obtained at 1/200 dilution of mouse serum; FIG. 7G shows the results of muscle immunization of WT mice immunized with A15 conjugated to norovirus P protein, and ELISA method for detection of anti-Tau 234-242 (pS 238), anti-Tau 258-266 (pS 262), anti-Tau 392-400 (pS 396) and anti-Tau 401-408 (pS 404) IgG antibodies in serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7H shows the results of intraperitoneal immunization of WT mice immunized with A2 conjugated with norovirus P protein. The levels of anti-Tau 14-22 (pY 18) IgG antibodies and anti-Tau 198-209 (pS 202/pT 205) IgG antibodies in the serum of mice were measured by ELISA. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7J shows the results of intraperitoneal immunization of WT mice immunized with A3 conjugated with norovirus P protein, and ELISA method for detection of anti-Tau 14-22 (pY 18) IgG antibody and anti-Tau 208-218 (pT 212/pS 214) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7K shows the results of intraperitoneal immunization of WT mice immunized with norovirus P protein-coupled A7, and the levels of anti-Tau 198-209 (pS 202/pT 205) IgG antibodies and anti-Tau 227-239 (pS 231/pS 235) IgG antibodies in the serum of the mice were detected by ELISA. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7L shows the results of intraperitoneal immunization of WT mice immunized with A11 conjugated with norovirus P protein, and ELISA method for detection of anti-Tau 198-209 (pS 202/pT 205) IgG antibodies, anti-Tau 392-400 (pS 396) IgG antibodies, and anti-Tau 401-408 (pS 404) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7M shows the results of intraperitoneal immunization of WT mice immunized with A14 conjugated with norovirus P protein, and ELISA method for detection of anti-Tau 208-218 (pT 212/pS 214) IgG antibody, anti-Tau 392-400 (pS 396) IgG antibody and anti-Tau 401-408 (pS 404) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7N shows the results of subcutaneous immunization of WT mice immunized with A4 conjugated to norovirus P protein. The levels of anti-Tau 14-22 (pY 18) IgG antibodies and anti-Tau 227-239 (pS 231/pS 235) IgG antibodies in the serum of mice were measured by ELISA. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7O shows the results of subcutaneous immunization of WT mice immunized with A6 conjugated to norovirus P protein. ELISA was used to measure the levels of anti-Tau 14-22 (pY 18) IgG antibodies and anti-Tau 392-400 (pS 396) IgG antibodies and anti-Tau 401-408 (pS 404) IgG antibodies in mouse serum. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7P shows the results of subcutaneous immunization of WT mice immunized with A8 conjugated with norovirus P protein, and ELISA method was used to detect anti-Tau 198-209 (pS 202/pT 205) IgG antibodies and anti-Tau 227-239 (pS 231/pS 235) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7Q shows the results of subcutaneous immunization of WT mice immunized with A11 conjugated with norovirus P protein, and ELISA method for detection of anti-Tau 198-209 (pS 202/pT 205) IgG antibodies, anti-Tau 392-400 (pS 396) IgG antibodies, and anti-Tau 401-408 (pS 404) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7R shows the results of subcutaneous immunization of WT mice immunized with A13 conjugated to norovirus P protein, and ELISA method was used to detect anti-Tau 208-218 (pT 212/pS 214) IgG antibody, anti-Tau 392-400 (pS 396) IgG antibody, and anti-Tau 401-408 (pS 404) IgG antibody levels in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum; FIG. 7S shows the results of subcutaneous immunization of WT mice immunized with A16 conjugated to norovirus P protein, and ELISA method for detection of anti-Tau 234-242 (pS 238) IgG antibody, anti-Tau 258-266 (pS 262) IgG antibody, anti-Tau 392-400 (pS 396) IgG antibody, and anti-Tau 401-408 (pS 404) IgG antibody content in the serum of the mice. Results are expressed as the average o.d. + SD values obtained at 1/200 dilution of mouse serum.

FIG. 8 shows that wild mice were respectively subjected to muscle immunization at

weeks

0, 2, 4, 6, 12 with phosphorylated polypeptide antigen coupled to PP-3C in combination with CpG, AS02, AS03, MF59, AS02+ CpG adjuvant and phosphorylated polypeptide antigen coupled to PP-3K in combination with AS02+ CpG adjuvant, blood was taken 2 weeks after each immunization to obtain serum, and ELISA experiments were performed using phosphorylated polypeptide of SEQ ID NO 1354 phosphorylated with respect to amino acids at positions 202, 205, 396, 404 of the full-length Tau protein AS coating antigen. The results are expressed as the concentration of antibodies against phosphorylated polypeptides obtained from each group of mice, which were labeled with AT8 antibodies.

Figures 9A to 9F show immunogenicity assays in mice of the binding of the phosphorylated polypeptide antigen A5 coupled to PP-3K to the AS02+ CpG adjuvant. FIG. 9A shows the results of immunization of WT mice with the phosphorylated polypeptide antigen A5 conjugated to PP-3K in combination with an AS02+ CpG adjuvant, and detection of the antibody content in the mouse serum against the phosphorylated polypeptide of SEQ ID NO 1355. Results are expressed as the average o.d. + SD values obtained at different dilutions of mouse serum; FIG. 9B shows the results of immunization of P301S mice with the phosphorylated polypeptide antigen A5 conjugated to PP-3K in combination with an AS02+ CpG adjuvant, and detection of the antibody content in the mouse serum against the phosphorylated polypeptide of SEQ ID NO 1355. Results are expressed as the average o.d. + SD values obtained at different dilutions of mouse serum; FIG. 9C shows the results of immunization of P301S mice with the phosphorylated polypeptide antigen A11 conjugated to PP-3C in combination with an AS02+ CpG adjuvant, and detection of the antibody content in the mouse serum against the phosphorylated polypeptide of SEQ ID NO 1354. Results are expressed as the average o.d. + SD values obtained at different dilutions of mouse serum; FIG. 9D shows the results of immunization of P301S mice with the phosphorylated polypeptide antigen A11 conjugated to PP-3K in combination with an AS02+ CpG adjuvant, and detection of the antibody content in the mouse serum against the phosphorylated polypeptide of SEQ ID NO 1354. Results are expressed as the average o.d. + SD values obtained at different dilutions of mouse serum; FIG. 9E shows the results of immunization of WT mice with the phosphorylated polypeptide antigen A12 conjugated to PP-3K in combination with an AS02+ CpG adjuvant, and detection of the antibody content in the mouse serum against the phosphorylated polypeptide of SEQ ID NO 1356. Results are expressed as the average o.d. + SD values obtained at different dilutions of mouse serum; FIG. 9F shows the results of immunization of P301S mice with the phosphorylated polypeptide antigen A12 conjugated to PP-3K in combination with an AS02+ CpG adjuvant, and detection of the antibody content in the mouse serum against the phosphorylated polypeptide of SEQ ID NO 1356. Results are expressed as the average o.d. + SD values obtained at different dilutions of mouse serum.

Fig. 10A to 10H show the cellular immunity of the vaccine in P301S transgenic mice. FIG. 10A shows ELISPOT results of PP-3K-A5 complex vaccine in P301S transgenic mice expressed as full length Tau protein stimulator stimulation of prokaryotic expression per 10 splenocytes from different immunized groups of animals ⁶ Number of IFN-gamma points caused by individual cell stimulation; FIG. 10B shows ELISPOT results of PP-3K-A5 complex vaccine in P301S transgenic mice expressed as spleen cells per 10 of different immunized groups of animals stimulated by non-phosphorylated A5 polypeptide stimulus ⁶ Number of IFN-gamma points caused by individual cell stimulation; FIG. 10C shows ELISPOT results of PP-3K-A11 complex vaccine in P301S transgenic mice expressed as full length Tau protein stimulator stimulation of prokaryotic expression per 10 splenocytes from different immunized groups ⁶ Number of IFN-gamma points caused by individual cell stimulation; FIG. 10D shows ELISPOT results of PP-3K-A11 complex vaccine in P301S transgenic mice expressed as spleen cells per 10 of different immunized groups of animals stimulated by non-phosphorylated A11 polypeptide stimulus ⁶ Number of IFN-gamma points caused by individual cell stimulation; FIG. 10E shows ELISPOT results of PP-3C-A11 complex vaccine in P301S transgenic mice expressed as full length Tau protein stimulator stimulation of prokaryotic expression per 10 splenocytes from different immunized groups ⁶ Number of IFN-gamma points caused by individual cell stimulation; FIG. 10F shows ELISPOT results of PP-3C-A11 complex vaccine in P301S transgenic mice expressed as spleen cells per 10 of different immunized groups of animals stimulated by non-phosphorylated A11 polypeptide stimulus ⁶ Number of IFN-gamma points caused by individual cell stimulation; FIG. 10G shows ELISPOT results of PP-3K-A12 complex vaccine in P301S transgenic mice expressed as full length Tau protein stimulator stimulation of prokaryotic expression per 10 splenocytes from different immunized groups of animals ⁶ Caused by individual cell stimulationPoints of IFN-gamma; FIG. 10H shows ELISPOT results of PP-3K-A12 complex vaccine in P301S transgenic mice expressed as spleen cells per 10 of different immunized groups of animals stimulated by non-phosphorylated A12 polypeptide stimulus ⁶ Number of IFN-gamma points induced by individual cell stimulation.

Fig. 11A to 11D show the transgene rod behavior of the vaccine in P301S transgenic mice. FIG. 11A shows the results of a stick test of the PP-3K-A5 complex vaccine in P301S transgenic mice, expressed as the average time of mice falling from the stick over 300S for different immunized groups versus the time point of detection; FIG. 11B shows the results of a stick test of the PP-3C-A11 complex vaccine in P301S transgenic mice, expressed as the average time of mice falling from the stick over 300S for different immunized groups versus the time point of detection; FIG. 11C shows the results of a stick test of the PP-3K-A11 complex vaccine in P301S transgenic mice, expressed as the average time of mice falling from the stick over 300S for different immunized groups versus the time point of detection; FIG. 11D shows the results of a stick test of the PP-3K-A12 complex vaccine in P301S transgenic mice, expressed as the average time of mice falling from the stick over 300S for different immunized groups of animals versus the time point of detection.

Figures 12A to 12D show nesting behavior of the vaccine in P301S transgenic mice. Figure 12A shows the results of nesting experiments with PP-3K-A5 complex vaccine in P301S transgenic mice, expressed as the average of three scores of each mouse during the nesting experiment. The results showed that immunized mice had statistically significant differences relative to PBS group; figure 12B shows nesting experimental results of PP-3C-a11 complex vaccine in P301S transgenic mice, expressed as the average of three scores of each mouse in the nesting experiment. The results showed that immunized mice had statistically significant differences relative to PBS group; figure 12C shows nesting experimental results of PP-3K-a11 complex vaccine in P301S transgenic mice, expressed as the average of three scores of each mouse in the nesting experiment. The results show that immunized mice have differences relative to PBS group; figure 12D shows nesting experimental results of PP-3K-a12 complex vaccine in P301S transgenic mice, expressed as the average of three scores of each mouse in the nesting experiment. The results indicated that immunized mice had differences relative to PBS group.

FIGS. 13A to 13D show a schematic representation of HPLC quantification of phosphorylated polypeptides coupled to PP-3C/C-PA-BLP. FIG. 13A shows a liquid phase diagram at a standard concentration of 0.03125mg/mL, with the peaks noted as the standard peak positions; FIG. 13B schematically shows a liquid phase pattern of the phosphorylated polypeptide dissociated from a sample of the PP-3C conjugated phosphorylated polypeptide prepared in example 4-2, wherein the peaks are labeled as the positions of the peaks; FIG. 13C schematically shows a liquid phase pattern of phosphorylated polypeptides dissociated from a sample of phosphorylated polypeptides coupled to C-PA-BLP prepared in example 33, wherein peaks are labeled as sample exit peak positions; fig. 13D shows a standard graph of standard concentration versus peak area.

FIG. 14 shows a schematic representation of the already constructed pET28a-C-PA plasmid.

FIGS. 15A to 15B show graphs of the recombinant pET28a-C-PA plasmid construct and the purified expression results. FIG. 15A is a schematic diagram showing double restriction enzyme identification of the constructed pET28a-C-PA plasmid, wherein the target band is 700bp; FIG. 15B is a SDS-PAGE gel of a sample of C-PA protein, as shown by the protein bands around 24 kDa.

Detailed Description

The following describes the invention by way of specific examples. It should be understood that the particular embodiments described are for purposes of illustration only and are not intended to limit the scope of the invention to the particular embodiments.

Example 1: preparation of phosphorylated polypeptide antigen vaccine

In this example, the inventors designed 15 phosphorylated polypeptide antigen vaccines comprising two polypeptide fragments selected from the human full-length Tau protein (SEQ ID No. 1332), based on the human full-length Tau protein, with specific sequence information see table 1 below:

table 1: sequence information of 15 phosphorylated polypeptide antigen vaccines

The 15 phosphorylated polypeptide antigen vaccines described above were synthetically prepared by gill biochemistry (Shanghai) limited (GL biochem (Shanghai) Ltd.) and were presented in lyophilized form.

Example 2: preparation of cysteine-modified norovirus P protein (PP-3C)

The preparation of norovirus P protein plasmids using pET26b (+) as a vector has been described in chinese patent application 2015104155561. In this example, three point mutations were performed using this plasmid as a template, and one amino acid in each of the three loop structures of the norovirus P particles was mutated to cysteine, and the protein was expressed and purified.

2.1 construction of PP-3C plasmid

The constructed plasmid pET26b-P protein in the Chinese patent application 2015104155561 is utilized by a site-directed mutagenesis method, and 5 'ATCGCTGGAACAA3' in loop1 is mutated into 5'ATCGCTTGCACACAA3' through three rounds of site-directed mutagenesis. The specific embodiment is as follows:

1334 (forward) SEQ ID NO:

CTGTGAACATCGCTACTTTCCGCGGCGACGTCACACACATCGCTTGCACACAAAACTACSEQ ID NO:1335 (reverse):

GTAGTTTTGTGTGCAAGCGATGTGTGTGACGTCGCCGCGGAAAGTAGCGATGTTCACAG the whole plasmid was subjected to a PCR reaction using a KOD-Plus DNA polymerase system (available from TOYOBO Co.) in a total volume of 50. Mu.L (5. Mu.L of buffer, 0.2mM of dNTP, 1mM of magnesium sulfate, 0.3. Mu.M each of the upstream and downstream primers, 50ng of template DNA, 1. Mu.L of KOD enzyme, and a final volume of 50. Mu.L by adding water). PCR was performed according to the reaction system instructions to obtain 20. Mu.L of a PCR product, 1. Mu.L of DpnI enzyme (purchased from NEB Co.) was added to the product, digested at 37℃for 1 hour, 10. Mu.L of the digested product was added to Tran1-Blue competent cells (purchased from Beijing Quantum gold Co.), left on ice for 30 minutes, heat-shocked at 42℃for 45 seconds, left on ice for 2 minutes, and then added to 600. Mu.L of a non-resistant liquid LB medium, and resuscitated at 37℃for 1 hour at 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. Obtaining the clone of mutant plasmid, sequencing and verifying the correct sequence.

And performing second site-directed mutagenesis on the obtained first round of site-directed mutagenesis plasmid. The 5 'ACCTCAAAACGAT 3' mutation in loop2 is 5'ACCTGCAACGA3', and the specific embodiments are as follows:

SEQ ID NO. 1336 (Forward): GCAATTCAGCACAGACACCTGCAACGATTTCGAGACTGGCC

SEQ ID NO. 1337 (reverse): GGCCAGTCTCGAAATCGTTGCAGGTGTCTGTGCTGAATTGC

The whole plasmid was subjected to PCR reaction in which the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of the upstream and downstream primers was 0.3. Mu.M, template DNA 50ng, KOD enzyme 1. Mu.L, and water was added to make up the final volume of 50. Mu.L) using the KOD-Plus DNA polymerase system (available from TOYOBO Co.). PCR was performed according to the reaction system instructions to obtain 20. Mu.L of a PCR product, 1. Mu.L of DpnI enzyme (purchased from NEB Co.) was added to the product, digested at 37℃for 1 hour, 10. Mu.L of the digested product was added to Tran1-Blue competent cells (purchased from Beijing Quantum gold Co.), left on ice for 30 minutes, heat-shocked at 42℃for 45 seconds, left on ice for 2 minutes, and then added to 600. Mu.L of a non-resistant liquid LB medium, and resuscitated at 37℃for 1 hour at 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. Obtaining the clone of mutant plasmid, sequencing and verifying the correct sequence.

And performing third site-directed mutagenesis on the obtained second round of site-directed mutagenesis plasmid. The 5'GACGGCAGCACC3' in loop3 was mutated to 5'GACTGCAGCACC3' as follows:

1338 (forward) SEQ ID NO: CCGTGGGTGTCGTTCAAGACTGCAGCACCACTCACCAGAACG

1339 (reverse): CGTTCTGGTGAGTGGTGCTGCAGTCTTGAACGACACCCACGG

The whole plasmid was subjected to PCR reaction in which the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of the upstream and downstream primers was 0.3. Mu.M, template DNA 50ng, KOD enzyme 1. Mu.L, and water was added to make up the final volume of 50. Mu.L) using the KOD-Plus DNA polymerase system (available from TOYOBO Co.). PCR was performed according to the reaction system instructions to obtain 20. Mu.L of a PCR product, 1. Mu.L of DpnI enzyme (purchased from NEB Co.) was added to the product, digested at 37℃for 1 hour, 10. Mu.L of the digested product was added to Tran1-Blue competent cells (purchased from Beijing Quantum gold Co.), left on ice for 30 minutes, heat-shocked at 42℃for 45 seconds, left on ice for 2 minutes, and then added to 600. Mu.L of a non-resistant liquid LB medium, and resuscitated at 37℃for 1 hour at 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. Obtaining the clone of mutant plasmid, sequencing and verifying the correct sequence. The resulting plasmid pET26B-PP-3C is shown in FIG. 1B.

2.2 construction of a successfully mutated P protein, namely the PP-3C Gene, onto a pCold IV vector

An EcoR I restriction site is introduced into the 5 'end of the PP-3C gene (the sequence of which is shown as SEQ ID NO. 1358) by a PCR method, and a Hind III restriction site is introduced into the 3' end, wherein the specific implementation scheme is as follows:

SEQ ID NO 1340 (forward): GGGAATTCCATATGAAGCCCTTCTCGGTCCCTATCCTGACAG

SEQ ID NO 1341 (reverse): CCCAAGCTTTTACAAGGCTCTGCGACGACCGGCTC

The pET26b-PP-3C plasmid obtained above was subjected to PCR reaction in which the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of the upstream and downstream primers was 0.3. Mu.M, template DNA 50ng, KOD enzyme 1. Mu.L, and water was added to make up the final volume of 50. Mu.L) using the KOD-Plus DNA polymerase system (available from TOYOBO Co.). PCR was performed according to the reaction system instructions to obtain 50. Mu.L of a PCR product. The product was subjected to agarose gel electrophoresis, and the target fragment was recovered using a gel recovery kit (purchased from Tiangen Biochemical technologies Co., ltd.) to obtain a PP-3C gene fragment having EcoR I cleavage site at the 5 'end and Hind III cleavage site at the 3' end.

Mu.g of the above recovered fragment was taken, 1. Mu.L of HindIII enzyme and EcoRI enzyme (from Takara Co.) each was added, 5. Mu.L of cleavage buffer (from Takara Co.) was added, and finally sterile water was added to the system to give a final volume of 50. Mu.L, 37℃and cleavage was performed for 2 hours, and the product was purified with a usual DNA product purification kit (from Tiangen Biochemical Co., ltd.) to give the objective fragment having a cohesive end.

Mu.g of pCold IV vector plasmid (available from Novagen) was taken, 1. Mu.L of each of Hind III enzyme and EcoR I enzyme (available from Takara) was added, 5. Mu.L of cleavage buffer (available from Takara) was added, and finally sterile water was added to the system to give a final volume of 50. Mu.L, 37℃for 2 hours, and the product was subjected to agarose gel electrophoresis, and the vector fragment was recovered using a gel recovery kit (available from Tian Gen Biochemical Co., ltd.) to give a plasmid vector having double cleavage sticky ends.

The vector fragment and the target fragment (molar ratio: 1:3, total volume: 15. Mu.L) obtained after the double digestion were mixed, 0.75. Mu.L of T4 ligase (available from Takara Co.) and 1.5. Mu.L of ligase buffer (available from Takara Co.) were added, and the mixture was ligated overnight at 16℃to obtain 10. Mu.L of ligation product, which was then added to Tran1-Blue competent cells (available from Beijing Quan gold Co.), left on ice for 30min, then thermally shocked at 42℃for 45s, left on ice for 2min, and then added to 600. Mu.L of liquid LB medium without resistance, and resuscitated at 37℃for 1h at 200 rpm. The bacterial solution was plated on LB solid plates containing ampicillin (15. Mu.g/mL), and cultured upside down at 37℃overnight. And obtaining recombinant clone, and verifying correct sequence by sequencing. A pColdIV-PP-3C plasmid having a capability of expressing PP-3C protein was obtained as shown in FIG. 1E.

2.3 expression of cysteine modified norovirus P proteins

1. Mu.L of the recombinant plasmid prepared in the above example was added to 100. Mu.L of competent cells of E.coli BL21 (purchased from TransGen Co.) and ice-bathed for 30min, followed by heat-shock in a water bath at 42℃for 90s and ice-bathing for 2min. To the mixture, 600. Mu.L of LB medium was added, 180rpm/min and incubated at 37℃for 1 hour. The mixture was uniformly spread on LB solid medium containing kanamycin (15. Mu.g/mL) resistance, and cultured at 37℃for 24 hours, thereby obtaining a strain capable of stably expressing recombinant proteins. Grown colonies were picked up and inoculated in 20mL LB medium, incubated at 37℃and 220rpm, and induced with isopropyl thiogalactoside (IPTG, final concentration 0.5 mmol/L), at 16℃and 220rpm overnight when the OD of the incubation mixture reached 1.0. After the completion of the induction, the bacterial liquid was centrifuged at 4000rpm for 20 minutes, the supernatant was discarded, the bacterial pellet was resuspended in PBS, and the supernatant was discarded again by centrifugation at 4000rpm for 20 minutes to obtain a bacterial pellet containing the target protein.

2.4 purification of cysteine modified norovirus P proteins

To the cell pellet obtained in 2.3, 20mL of a protein buffer (ph=8.0, containing 50mM Tris,300mM KCl) was added to resuspend, cells were broken by sonication on ice for 30min, and the mixture was centrifuged at 12000rpm at 4 ℃ for 30min to obtain a supernatant. The supernatant was filtered through a 0.45 μm filter to obtain a crude protein extract.

The structure of the recombinant PP-3C granulin is shown in FIG. 2A.

The crude protein extract was purified using an anion exchange column (available from GE). The specific scheme is as follows: firstly, rinsing the exchange column with ultrapure water, balancing the exchange column with PB solution with the pH of 5.0 at the flow rate of 2mL/min, adding 20mL of crude protein extract into the exchange column at the flow rate of 1mL/min, flushing the exchange column with PB solution with the pH of 7.0 after the sample is completely hung on the column to remove foreign proteins, eluting with PB solution containing sodium chloride with the concentration of 0.5mol/L, and collecting peak proteins to obtain target proteins.

The protein was further purified by a hydrophobic chromatography column (available from GE company) as follows: the column was rinsed first with ultrapure water and then with PB solution at pH 7.0 at a flow rate of 2mL/min. After the column is well balanced, injecting a protein sample, and after the sample completely enters the column, performing gradient elution by using PB (PB) with pH of 7.0 and 1mol/L sodium chloride solution, wherein the elution time is 2 hours, the concentration of sodium chloride is reduced from 1mol/L to 0.1mol/L, and the peak protein is obtained. The size of the resulting P-particle protein monomer was identified by reducing SDS-PAGE.

The 24-mer form of the P protein particles was then further isolated and purified using Superdex 200 molecular sieves (available from GE company) as follows: the column was rinsed with ultrapure water at a flow rate of 1mL/min, a column volume was rinsed, then the column was rinsed again with a volume of about 120mL of PB buffer at ph=5, then 2mL of protein extract was added to the column, washed with PB buffer at a flow rate of 1mL/min, and the peak protein was harvested to give P-particle 24-mer-type protein. And detecting the multimeric structure of the three proteins by non-denaturing polyacrylamide gel electrophoresis, wherein the protein bands are above 250kDa, as shown in FIG. 2C, so that the recombinant P protein can be self-assembled into P protein particles in the form of 12-mer and 24-mer in vitro, and the recombinant P protein can be kept in balance; after purification of the protein, the multimeric form is maintained. Electron microscopy analysis of the purified PP-3C protein particles showed that PP-3C was polymorphic into large aggregates of particles (as shown in figure 4).

Example 3: preparation of lysine-modified norovirus P protein (PP-3K)

In this example, a norovirus P protein plasmid (which is obtained by constructing a PP gene into pET28a by homologous recombination method from pET26b-PP plasmid provided in chinese patent application 2015104155561) using pET28a as a vector was subjected to three-time point mutation, and one lysine was inserted into each of the three loop structures of the norovirus P particles, and the protein was expressed and purified.

Construction of the 1pET28a-PP plasmid

The PP gene in the pET26 b-PP plasmid is enriched by a PCR method, and the specific implementation scheme is as follows:

SEQ ID NO 1361 (forward): AACTTTAAGAAGGAGATATACCATGGGCAAGCCCTTCTCGGTCCCTA

SEQ ID NO 1362 (reverse): CGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTTACAAGGCTCTGCGACGACCGGC

The pET26b-P protein plasmid was subjected to PCR reaction in which the PCR reaction system was KOD-Plus DNA polymerase system (available from TOYOBO Co.) and the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of the upstream and downstream primers was 0.3. Mu.M, template DNA 50ng, KOD enzyme 1. Mu.L, and water was added to make up to a final volume of 50. Mu.L). PCR was performed according to the reaction system instructions to obtain 50. Mu.L of a PCR product. The products were subjected to agarose gel electrophoresis and the target fragments were recovered using a gel recovery kit (purchased from Tiangen Biochemical technologies Co., ltd.).

Mu.g of pET28a vector plasmid (available from Novagen) was taken, 1. Mu.L of BamHI enzyme and XhoI enzyme (available from Takara) were added to each, 5. Mu.L of digestion buffer (available from Takara) was added, and finally sterile water was added to the system to a final volume of 50. Mu.L at 37℃for 2 hours, and the product was subjected to agarose gel electrophoresis, and the vector fragment was recovered using a gel recovery kit (available from Tiangen Biotechnology Co., ltd.) to obtain a linear plasmid vector.

Mixing the carrier fragment and the target fragment (molar ratio is 1:3, total volume is 5 mu L) after double enzyme digestion, adding 5 mu L of homologous recombination mix (purchased from Zhongmeitai and Co.), connecting for 15min at 25 ℃, adding 10 mu L of connecting product into DH10B competent cells (purchased from Zhongmeitai and Co.), standing on ice for 30min, then heat-beating for 30s at 42 ℃, standing on ice for 2min, then adding the mixture into 600 mu L of non-resistant liquid LB medium, and resuscitating for 1h at 37 ℃ and 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. And obtaining recombinant clone, and verifying correct sequence by sequencing. The result was a pET28a-PP plasmid with the ability to express PP protein, as shown in FIG. 1C.

3.2 construction of PP-3K plasmid

The constructed plasmid pET28a-PP is utilized by a site-directed mutagenesis method, and 5 'CGCTGGAACAAA3' in loop1 is mutated into 5 'CGCTGGAAGACACAAA3' through three rounds of site-directed mutagenesis. The specific embodiment is as follows:

SEQ ID NO 1340 (forward): GACGTCACACACATCGCTGGAAAGACACAAAACTACACCATGAAC

SEQ ID NO. 1341 (reverse): GTTCATGGTGTAGTTTTGTGTCTTTCCAGCGATGTGTGTGACGTC

The obtained first round PCR product was subjected to a second site-directed mutagenesis. The specific embodiment of mutating 5 'acccaaaacgat 3' in loop2 to 5 'accctaaagaaacgat 3' is as follows:

SEQ ID NO 1342 (Forward): CAATTCAGCACAGACACCTCAAAGAACGATTTCGAGACTGGCCAG

SEQ ID NO. 1343 (reverse): CTGGCCAGTCTCGAAATCGTTCTTTGAGGTGTCTGTGCTGAATTG

The whole plasmid was subjected to PCR reaction in which the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of which was 0.3. Mu.M, template DNA 50ng, KOD 1. Mu.L, and water was added to a final volume of 50. Mu.L) by the KOD-Plus DNA polymerase system (available from TOYOBO Co.), and the PCR reaction was performed according to the reaction system instructions to obtain 20. Mu.L of a PCR product, 1. Mu.L of DpnI enzyme (available from NEB Co.) was added to the product, digested at 37℃for 1 hour, 10. Mu.L of the digested product was added to Tran1-Blue competent cells (available from Beijing Co., ltd.), left on ice for 30 minutes and then left on ice for 45s at 42℃for 2 minutes, and then added to 600. Mu.L of a non-resistant liquid LB medium, and resuscitated at 37℃for 1 hour at 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. Obtaining the clone of mutant plasmid, sequencing and verifying the correct sequence.

The obtained second round PCR product was subjected to a third site-directed mutagenesis. The 5 'gacggcagcagcacc 3' mutation in loop3 to 5 'gacggcagcagcacc 3' embodiment is as follows:

SEQ ID NO:1344 (forward):

GTGGGTGTCGTTCAAGACGGCAAGAGCACCACTCACCAGAACGAA

SEQ ID NO:1345 (reverse):

TTCGTTCTGGTGAGTGGTGCTCTTGCCGTCTTGAACGACACCCAC

the whole plasmid was subjected to PCR reaction in which the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of the upstream and downstream primers was 0.3. Mu.M, template DNA 50ng, KOD enzyme 1. Mu.L, and water was added to make up the final volume of 50. Mu.L) using the KOD-Plus DNA polymerase system (available from TOYOBO Co.). PCR was performed according to the reaction system instructions to obtain 20. Mu.L of a PCR product, 1. Mu.L of DpnI enzyme (purchased from NEB Co.) was added to the product, digested at 37℃for 1 hour, 10. Mu.L of the digested product was added to Tran1-Blue competent cells (purchased from Beijing Quantum gold Co.), left on ice for 30 minutes, heat-shocked at 42℃for 45 seconds, left on ice for 2 minutes, and then added to 600. Mu.L of a non-resistant liquid LB medium, and resuscitated at 37℃for 1 hour at 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. The mutant plasmid clone was obtained, and the sequence was verified to be correct by sequencing (the sequence of the PP-3K gene is shown as SEQ ID NO. 1360). The pET28a-P protein-3K plasmid is shown in FIG. 1D.

3.3 expression of tyrosine modified norovirus P protein

3.4 purification of lysine-modified norovirus P protein

To the cell pellet obtained in 3.3 was added 20mL of a protein buffer (pH=8.0, containing 50mM Tris,300mM KCl) to resuspend, the cells were crushed by sonication on ice for 30min, and the mixture was centrifuged at 12000rpm at 4℃for 30min to obtain a supernatant. The supernatant was filtered through a 0.45 μm filter to obtain a crude protein extract.

The structure of the recombinant PP-3K particles is shown in FIG. 3A.

The protein was further purified by a hydrophobic chromatography column (available from GE company) as follows: the column was rinsed first with ultrapure water and then with PB solution at pH 7.0 at a flow rate of 2mL/min. After the column is well balanced, injecting a protein sample, and after the sample completely enters the column, performing gradient elution by using PB (PB) with pH of 7.0 and 1mol/L sodium chloride solution, wherein the elution time is 2 hours, the concentration of sodium chloride is reduced from 1mol/L to 0.1mol/L, and the peak protein is obtained. The size of the resulting P-particle protein monomer was identified by reducing SDS-PAGE. The 24-mer form of the P protein particles was then further isolated and purified using Superdex 200 molecular sieves (available from GE company) as follows: the column was rinsed with ultrapure water at a flow rate of 1mL/min, a column volume was rinsed, then the column was rinsed again with a volume of about 120mL of PB buffer at pH5, then 2mL of protein extract was added to the column, washed with PB buffer at a flow rate of 1mL/min, and the peak protein was harvested to give protein in the form of P-particle 24-mer. And detecting the multimeric structure of the three proteins by non-denaturing polyacrylamide gel electrophoresis, wherein the protein bands are above 250kDa, as shown in FIG. 2C, so that the recombinant P protein can be self-assembled into P protein particles in the form of 12-mer and 24-mer in vitro, and the recombinant P protein can be kept in balance; after purification of the protein, the multimeric form is maintained. Electron microscopy analysis of the purified PP-3K protein particles showed that PP-3K was polymorphic into large aggregates of particles (as shown in figure 5).

Example 4: coupling reaction of PP-3C and phosphorylated polypeptide antigen vaccine

Example 4-1: the purified PP-3C was subjected to a liquid exchange treatment with a desalting column from GE company, and the buffer system of the protein was replaced with 0.1M ammonium bicarbonate solution (ph=7.5). The PP-3C after the liquid exchange was quantified and diluted to a concentration of 0.3mg/mL. According to the mole amount of protein: molar amount of polypeptide = 1:30 the respective lyophilized forms of the phosphorylated polypeptide antigen vaccine prepared in example 1 were added and slowly mixed. The mixture was incubated at 2-8deg.C for 48 hours with slow shaking. The resulting product was concentrated by ultrafiltration to remove unbound polypeptide and the buffer system was replaced with PBS buffer system.

Example 4-2: the purified PP-3C was subjected to a liquid exchange treatment with a desalting column from GE company, and the buffer system of the protein was replaced with 1M ammonium bicarbonate solution (ph=8.0). The PP-3C after the liquid exchange was quantified and diluted to a concentration of 0.5mg/mL. According to the mole amount of protein: molar amount of polypeptide = 1:50 the respective lyophilized forms of the phosphorylated polypeptide antigen vaccine prepared in example 1 were added and slowly mixed. The mixture was incubated at 2-8deg.C for 48 hours with slow shaking. The resulting product was concentrated by ultrafiltration to remove unbound polypeptide and the buffer system was replaced with PBS buffer system.

Examples 4-3: the purified PP-3C was subjected to a liquid exchange treatment with a desalting column from GE company, and the buffer system of the protein was replaced with 0.1M ammonium bicarbonate solution (ph=7.8). The PP-3C after the liquid exchange was quantified and diluted to a concentration of 0.3mg/mL. According to the mole amount of protein: molar amount of polypeptide = 1:100 to each of the lyophilized forms of the phosphorylated polypeptide antigen vaccine prepared in example 1 was added and mixed slowly. The mixture was incubated at 2-8deg.C for 48 hours with slow shaking. The resulting product was concentrated by ultrafiltration to remove unbound polypeptide and the buffer system was replaced with PBS buffer system.

Examples 4-4: the purified PP-3C was subjected to a liquid exchange treatment with a desalting column from GE company, and the buffer system of the protein was replaced with 0.1M ammonium bicarbonate solution (ph=8.8). The PP-3C after the liquid exchange was quantified and diluted to a concentration of 0.3mg/mL. According to the mole amount of protein: molar amount of polypeptide = 1:30 the respective lyophilized forms of the phosphorylated polypeptide antigen vaccine prepared in example 1 were added and slowly mixed. The mixture was incubated at 2-8deg.C with slow shaking for 72 hours. The resulting product was concentrated by ultrafiltration to remove unbound polypeptide and the buffer system was replaced with PBS buffer system.

Example 5: coupling reaction of PP-3K and phosphorylated polypeptide antigen vaccine

Example 5-1: BCA quantification was performed on the purified PP-3K solution and ph=7.2 was adjusted. 1mg/mL of thiomaleimide (suflo-SMCC) solution was taken in molar amounts of SMCC: PP-3K molar = 5:1, mixing the two protein solutions in proportion, and reacting the mixture for 30min at 25 ℃ in a water bath. The mixture was desalted using a GE desalting column, the system was replaced with PBS solution (ph=7.2-7.4), and unbound sulfo-SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:5, adding the lyophilized products of the phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system according to the proportion, slowly mixing, and then transferring the reaction system into a water bath at 25 ℃ for reaction for 30min. The reaction product was collected, the mixture was desalted with a GE desalting column, the system was replaced with PBS solution (ph=7.2-7.4), and unbound phosphorylated polypeptides were removed.

Example 5-2: BCA quantification was performed on the purified PP-3K solution. 1mg/mL of thiomaleimide (sulfo-SMCC) solution was taken in the molar amount of SMCC: PP-3K molar = 20:1, mixing the two protein solutions in proportion, and reacting the mixture for 30min at 25 ℃ in a water bath. The mixture was desalted using a GE desalting column, the system was replaced with PB solution (ph=8.5), and unbound sulfo-SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:30, adding the lyophilized products of the phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system, slowly mixing, and then transferring the reaction system into a water bath at 25 ℃ for reaction for 30min. The reaction product was collected, the mixture was desalted with a GE desalting column, the system was replaced with PB solution (ph=8.5), and unbound phosphorylated polypeptide was removed.

Examples 5-3: BCA quantification was performed on the purified PP-3K solution. 1mg/mL of thiomaleimide (sulfo-SMCC) solution was taken in the molar amount of SMCC: PP-3K molar = 20:1, mixing the two protein solutions in proportion, and reacting the mixture for 30min at 25 ℃ in a water bath. Desalting the mixture with a dialysis bag of 20kd cut-off molecular weight, dialysis volume ratio of 1000: dialysis was carried out overnight at 1, 2-8deg.C, the system was replaced with PB solution (pH=7.0), and unbound sulfo-SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:50, adding the lyophilized products of each phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system, slowly mixing, and then transferring the reaction system into a water bath at 25 ℃ for reaction for 30min. Desalting the mixture with a dialysis bag with a molecular weight cut-off of 20kDa, dialysis volume ratio of 1000: dialysis was carried out overnight at 1, 2-8deg.C, the system was replaced with PB solution (pH=7.0), and unbound phosphorylated polypeptide was removed.

Examples 5 to 4: BCA quantification was performed on the purified PP-3K solution. 1mg/mL of thiomaleimide (sulfo-SMCC) solution was taken in the molar amount of SMCC: PP-3K molar = 20:1, mixing the two protein solutions in proportion, and slowly shaking the mixture at 2-8 ℃ for reaction overnight. Desalting the mixture with a dialysis bag of 20kd cut-off molecular weight, dialysis volume ratio of 1000: dialysis was carried out overnight at 1, 2-8deg.C, the system was replaced with PBS solution (pH=7.2-7.4), and unbound sulfoo-SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:50, adding the lyophilized products of each phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system, slowly mixing, and then slowly shaking the reaction system at 2-8 ℃ for reaction overnight. Desalting the mixture with a dialysis bag of 20kd cut-off molecular weight, dialysis volume ratio of 1000: dialysis was carried out overnight at 1, 2-8deg.C, the system was replaced with PBS solution (pH=7.2-7.4), and unbound phosphorylated polypeptide was removed.

Examples 5 to 5: BCA quantification was performed on the purified PP-3K solution. A20 mg/mL Solution of Maleimide (SMCC) in Dimethylformamide (DMF) was taken in molar amounts of SMCC: PP-3K molar = 10:1, mixing the two protein solutions in proportion, and reacting the mixture for 30min at 25 ℃ in a water bath. The mixture was desalted with a GE desalting column, the system was replaced with PBS solution (ph=7.2-7.4), and unbound SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:30, adding the lyophilized products of the phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system, slowly mixing, and then transferring the reaction system into a water bath at 25 ℃ for reaction for 30min. The reaction product was collected, the mixture was desalted with a GE desalting column, the system was replaced with PBS solution (ph=7.2), and unbound phosphorylated polypeptide was removed.

Examples 5 to 6: BCA quantification was performed on the purified PP-3K solution. A20 mg/mL Solution of Maleimide (SMCC) in Dimethylformamide (DMF) was taken in molar amounts of SMCC: PP-3K molar = 30:1, mixing the two protein solutions in proportion, and slowly shaking the mixture at 2-8 ℃ for reaction overnight. The mixture was desalted with a GE desalting column, the system was replaced with PBS solution (ph=7.2-7.4), and unbound SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:50, and adding the lyophilized products of each phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system, slowly mixing, and slowly shaking the mixture at 2-8 ℃ for reaction overnight. The reaction product was collected, the mixture was desalted with a GE desalting column, the system was replaced with PBS solution (ph=7.2), and unbound phosphorylated polypeptide was removed.

Examples 5 to 7: BCA quantification was performed on the purified PP-3K solution. A20 mg/mL Solution of Maleimide (SMCC) in Dimethylformamide (DMF) was taken in molar amounts of SMCC: PP-3K molar = 5:1, mixing the two protein solutions in proportion, and reacting the mixture in a water bath at 25 ℃ for 30min. Desalting the mixture with a dialysis bag with a molecular weight cut-off of 20kDa, dialysis volume ratio of 1000: dialysis was carried out overnight at 1, 2-8deg.C, the system was replaced with PBS solution (pH=7.2-7.4), and unbound SMCC was removed. Taking a reaction product according to the mole amount of PP-3K: phosphorylated polypeptide molar = 1:100, adding the lyophilized products of each phosphorylated polypeptide antigen vaccine prepared in the example 1 into the system, slowly mixing, and slowly shaking the mixture at 2-8 ℃ for reaction overnight. Collecting reaction products, desalting the mixture by using a dialysis bag with a molecular weight cut-off of 20kDa, and dialyzing the mixture to a volume ratio of 1000: dialysis was carried out overnight at 1, 2-8deg.C, the system was replaced with PBS solution (pH=7.2), and unbound phosphorylated polypeptide was removed.

Example 6: determination of the efficiency of ligation of phosphorylated polypeptide antigen products conjugated to PP-3C

Into the phosphorylated polypeptide antigen product coupled with PP-3C, the volume ratio is 1:1, 10mM dithiothreitol solution was added thereto, and after uniform mixing, the mixture was allowed to stand at room temperature for 16 hours. The reaction product was centrifuged at 16000g for 15min at 4 ℃. The supernatant was subjected to HPLC measurement. The concentration of the sample to be measured was quantitatively analyzed by taking the phosphorylated polypeptide dissolved in a 10mM dithiothreitol solution of 0.5mg/mL, 0.25mg/mL, 0.125mg/mL, 0.0625mg/mL, 0.03125mg/mL and 0.015625mg/mL as a standard substance and taking the peak area of the phosphorylated polypeptide as a standard curve with respect to the concentration of the standard substance (the results are shown in FIG. 13A, FIG. 13B and FIG. 13D).

Example 7: determination of the ligation efficiency of phosphorylated polypeptide antigen products conjugated to PP-3K

The phosphorylated polypeptide antigen product coupled with PP-3K is subjected to mass spectrometry, and the phosphorylated polypeptide dissolved in PBS is used as a standard substance to quantitatively analyze the concentration of a sample to be detected (the result is not shown).

Example 8: immunogenicity analysis of phosphorylated polypeptide antigen vaccine in wild mice

The phosphorylated polypeptide antigen of the sequences shown in SEQ ID NO. 201, SEQ ID NO. 225, SEQ ID NO. 306, SEQ ID NO. 387, SEQ ID NO. 468, SEQ ID NO. 558, SEQ ID NO. 567, SEQ ID NO. 769, SEQ ID NO. 784, SEQ ID NO. 875, SEQ ID NO. 1020, SEQ ID NO. 1101, SEQ ID NO. 1182, SEQ ID NO. 1272, SEQ ID NO. 1313, SEQ ID NO. 1330 was dissolved to 1mg/mL and the volume ratio with complete Freund's adjuvant or incomplete Freund's adjuvant was 1:1 are mixed into water-in-oil emulsion to prepare vaccines A1 to A16. Each wild rat was injected intramuscularly with 50 μl. Once every two weeks, the first immunization uses complete Freund's adjuvant, and the second, third and fourth immunization uses incomplete Freund's adjuvant for four total immunizations. And blood was collected two weeks after the fourth immunization, and the serum of the mice was collected for ELISA analysis.

Taking a polypeptide (the sequence of which is shown as SEQ ID NO: 1346) which is coupled to BSA and is phosphorylated relative to the 18 th amino acid of the full-length Tau protein as a coating antigen for detecting the antiserum titer aiming at the phosphorylated Y18 site; polypeptide (sequence shown as SEQ ID NO: 1347) coupled to BSA and phosphorylated with respect to amino acids 202 and 205 of the full-length Tau protein is used as a coating antigen for detecting antiserum titers aiming at phosphorylated S202 and T205 sites; polypeptide (sequence shown as SEQ ID NO: 1348) coupled to BSA and phosphorylated relative to amino acid 212/214 of full-length Tau protein is used as coating antigen for detecting antiserum potency aiming at phosphorylated T212S 214 sites; polypeptide (sequence shown as SEQ ID NO: 1349) coupled to BSA and phosphorylated with respect to 231/235 th amino acid of full-length Tau protein is used as coating antigen for detecting antiserum potency of the phosphorylated T231 and S235 sites; taking polypeptide (the sequence of which is shown as SEQ ID NO: 1350) which is coupled to BSA and phosphorylates 238 th amino acid relative to full-length Tau protein as a coating antigen for detecting antiserum potency aiming at the phosphorylating S238 site; polypeptide (sequence shown as SEQ ID NO: 1351) which is coupled to BSA and is phosphorylated relative to 262 th amino acid of full-length Tau protein is used as a coating antigen for detecting antiserum titer aiming at phosphorylated S262 site; polypeptide (sequence shown as SEQ ID NO: 1352) coupled to BSA and phosphorylated with respect to 396 th amino acid of full-length Tau protein is used as a coating antigen for detecting the antiserum titer aiming at the phosphorylated S396 site; a polypeptide (sequence shown as SEQ ID NO: 1353) conjugated to BSA phosphorylated at amino acid position 404 relative to the full-length Tau protein was used as a coating antigen for detecting the antiserum potency against the phosphorylated S404 site.

The antigens were dissolved in carbonate buffer at ph=9.5, diluted to 1 μg/mL, and added to ELISA plate at 100 μl/well overnight at 4 ℃. The plate was discarded, and the 96-well plate was washed 3 times with 300. Mu.L/well PBST, and the plate was discarded. 200. Mu.L/well of 3% BSA (PBS) solution was added and incubated at 37℃for 1 hour. The plate was discarded, and the 96-well plate was washed 3 times with 300. Mu.L/well PBST, and the plate was discarded. Mouse serum was added in 1% BSA (PBS) solution in a gradient, 100. Mu.L/well, and incubated at 37℃for 2 hours. The plate was discarded, and the 96-well plate was washed 3 times with 300. Mu.L/well PBST, and the plate was discarded. Goat anti-mouse HRP-labeled antibody solution diluted in 1% BSA (PBS) was added at 100. Mu.L/well and incubated at 37℃for 1 hour. The plate was discarded, and the 96-well plate was washed 3 times with 300. Mu.L/well PBST, and the plate was discarded. TMB 100. Mu.L/well was added and incubated at room temperature for 25min in the dark. The reaction was quenched by the addition of 1M aqueous sulfuric acid. The absorbance at 450nm was measured by a microplate reader.

The antibody levels against the different antigens in the fourth immune sera of vaccines A1-a 16 are shown in fig. 6. The results show that: the mice in each group of the vaccines A1-A6 can successfully produce antibodies aiming at the pY18 locus after being immunized, wherein the vaccine A2 and the vaccine A5 can produce high-concentration antibodies; vaccines A7-a 16 were almost incapable of producing antibodies to the pY18 site (fig. 6A). The mice in each group of the vaccines A1-A2 and the vaccines A7-A11 can successfully produce antibodies aiming at pS202/pT205 locus after being immunized, wherein the vaccines A8-A11 can produce high-concentration antibodies; vaccines A3 to A6 and vaccines A12 to A16 hardly produced antibodies against the pS202/pT205 locus (FIG. 6B). After the mice in each group of vaccine A3 and vaccine A12-A14 are immunized, high-concentration antibodies aiming at pT212/pS214 locus can be successfully generated, and vaccine A6, vaccine A8 and vaccine A11 can generate low-concentration antibodies; vaccine A1, vaccine A2, vaccine A4, vaccine A5, vaccine A7, vaccines A9 to a11, vaccine a15, vaccine a16 hardly produced antibodies against the pT212/pS214 site (fig. 6C). After mice in each group of vaccine A4, vaccine A7-A8 and vaccine A12 are immunized, high-concentration antibodies aiming at pS231/pS235 sites can be successfully generated, and vaccine A1, vaccine A5 and vaccine A14 can generate low-concentration antibodies; vaccine A2, vaccine A3, vaccine A6, vaccines A9 to a11, vaccine a13, vaccine a15, vaccine a16 hardly produced antibodies against the pS231/pS235 site (fig. 6D). The mice in each group of vaccine A5, vaccine A9, vaccine A13 and vaccine A15-A16 can successfully generate high-concentration antibodies aiming at pS238 locus after being immunized, and vaccine A8 and vaccine A14 can also generate higher-concentration antibodies; vaccines A1 to A4, A6, A7, and a10 to a12 hardly produced antibodies against the pS238 site (fig. 6E). After the mice in each group of vaccine A5, vaccine A9, vaccine A13 and vaccine A16 are immunized, high-concentration antibodies aiming at pS262 locus can be successfully generated, and vaccine A7 and vaccine A14 can also generate higher-concentration antibodies; vaccines A1 to A4, A6, A8, and a10 to a12 hardly produced antibodies against the pS238 site (fig. 6F). The mice in each group of vaccine A6, vaccine A10, vaccine A11 and vaccine A14-A16 can successfully produce high-concentration antibodies aiming at pS396 locus after immunization, and vaccine A8 can produce low-concentration antibodies; vaccines A1 to A5, A7, A9, and a12 to a13 hardly produced antibodies against the pS396 site (fig. 6G). The mice in each group of vaccine A6, vaccine A10, vaccine A11 and vaccine A14-A16 can successfully produce high-concentration antibodies aiming at pS404 locus after being immunized, and vaccine A8 can produce low-concentration antibodies; vaccines A1 to A5, A7, A9, and a12 to a13 hardly produced antibodies against the pS396 site (fig. 6H). In summary, each of the phosphorylated polypeptide vaccines designed in example 1 can produce antibodies against the corresponding phosphorylation site after immunization of animals, is immunogenic, and can also produce cross-protection reactions against other phosphorylation sites; it was also found that immunization with longer phosphorylated polypeptides could result in higher concentrations of antibodies.

Example 9: immunogenicity evaluation of phosphorylated polypeptide antigen conjugated to norovirus P protein PP-3C by intramuscular injection into wild-type mice

PP-3C protein was conjugated to A1, A5, A9, A10, A11, A12 and A15, respectively, to prepare a complex vaccine, wild mice were immunized by intramuscular injection, 6 mice per group were immunized with 25. Mu.g protein per mouse, and the immunized mice were immunized once at

weeks

0, 2, 4 and 6, and blood was collected two weeks after each immunization to obtain serum, and ELISA evaluation was performed, and the results were shown in FIGS. 7A to 7G, according to the method of example 8. As can be seen from the figure, mice immunized with the complex vaccine A1 can produce specific antibodies against pY18 and pS202/pT205 (fig. 7A); mice immunized with complex vaccine A5 can produce specific antibodies against pY18 and pS238 and pS262 (fig. 7B); mice immunized with complex vaccine A9 can produce specific antibodies against pS202/pT205, pS238 and pS262 (FIG. 7C); mice immunized with complex vaccine A9 can produce specific antibodies against pS202/pT205, pS396 and pS404 (FIG. 7D); mice immunized with complex vaccine A11 can produce specific antibodies against pS202/pT205, pS396 and pS404 (FIG. 7E); mice immunized with complex vaccine A12 can produce specific antibodies against pT212/pS214 and pS231/pS235 (FIG. 7F); mice immunized with the complex vaccine a15 can produce specific antibodies against pS238, pS262, pS396, and pS404 (fig. 7G). As can be seen, the serum-specific antibody concentrations of each group of complex vaccines were on an ascending trend after each immunization by muscle immunization, and high-concentration antibodies were generated after the fourth immunization, with the pY18 and pS202/pT205 epitopes being prone to elicit high-concentration specific antibodies. Muscle immunity is generally responsible for higher concentrations of antibodies relative to other immune pathways.

Example 10: evaluation of immunogenicity of phosphorylated polypeptide antigen conjugated to norovirus P protein PP-3C by intraperitoneal injection into immunized wild mice

PP-3C protein was conjugated to A2, A3, A7, A11 and A14 respectively to prepare a complex vaccine, wild mice were immunized by intraperitoneal injection, 6 mice each group had an amount of 25. Mu.g/mouse, and each group was immunized once at

weeks

0, 2, 4 and 6, and blood was collected two weeks after each immunization to obtain serum, and ELISA evaluation was performed, as in example 10, and the results are shown in FIG. 7H-7M. As can be seen from the figure, mice immunized with the complex vaccine A2 can produce specific antibodies against pY18 and pS202/pT205 (fig. 7H); mice immunized with the complex vaccine A3 can produce specific antibodies against pY18 and pT212/pS214 (fig. 7J); mice immunized with complex vaccine A7 can produce specific antibodies against pS202/pT205 and pS231/pS235 (FIG. 7K); mice immunized with complex vaccine A11 produced specific antibodies against pS202/pT205, pS396 and pS404 (FIG. 7L); mice immunized with complex vaccine A14 produced specific antibodies to pT212/pS214, pS396 and pS404 (FIG. 7M). Thus, the serum-specific antibody concentration of each group of complex vaccines was on the rise after each immunization by intraperitoneal immunization, and high-concentration antibodies were produced after the fourth immunization.

Example 11: evaluation of immunogenicity of phosphorylated polypeptide antigen conjugated to norovirus P protein PP-3C by subcutaneous injection in immunized wild mice

PP-3C protein was coupled to A4, A6, A8, A11, A13 and A16, respectively, to prepare a complex vaccine, wild mice were immunized by subcutaneous injection, 6 mice per group were immunized with 25. Mu.g of protein per mouse, and each of the immunized mice was immunized once at

weeks

0, 2, 4 and 6, and serum obtained by blood collection two weeks after each immunization was evaluated by ELISA, and the results are shown in FIG. 7N-7S. As can be seen, mice immunized with the complex vaccine A4 produced specific antibodies against pY18 and pS231/pS235 (fig. 7N); mice immunized with complex vaccine A6 can produce specific antibodies against pY18, pS396, and pS404 (fig. 7O); mice immunized with complex vaccine A8 can produce specific antibodies against pS202/pT205 and pS231/pS235 (FIG. 7P); mice immunized with complex vaccine A11 can produce specific antibodies against pS202/pT205, pS396 and pS404 (FIG. 7Q); mice immunized with complex vaccine A13 can produce specific antibodies against pT212/pS214, pS396 and pS404 (FIG. 7R); mice immunized with complex vaccine a16 can produce specific antibodies against pS238, pS262, pS396, and pS404 (fig. 7S). Thus, the serum-specific antibody concentration of each vaccine group was on the rise after each immunization by subcutaneous immunization, and high-concentration antibodies were produced after the fourth immunization.

Example 12: immunogenicity evaluation of phosphorylated polypeptide antigen conjugated to norovirus P protein in wild-type mice

Taking A11 vaccine AS an example, PP-3C or PP-3K is coupled with A11, and wild mice are respectively subjected to muscle immunization by combining CpG, AS02, AS03, MF59 and AS02 plus CpG adjuvants, 6 mice in each group are respectively subjected to immunization at the dosage of 25 mug/mouse, and the immunization is carried out at

weeks

0, 2, 4, 6 and 12, and blood is collected for two weeks after each immunization to obtain serum for ELISA evaluation. In ELISA experiments, a phosphorylated polypeptide having the sequence SEQ ID NO 1354 coupled to BSA was used as coating antigen, which phosphorylated at amino acids 202, 205, 396, 404 relative to the full-length Tau protein. The concentration of antibody in mouse serum was calibrated by taking a standard curve of the concentration of the gradient diluted AT8 antibody (Thermo scientific MN 1020) against the o.d. value. The change in antibody concentration for each group is shown in figure 8. AS can be seen from fig. 8, the norovirus P protein-coupled a11 vaccine combined with different adjuvants all elicited higher immune responses in wild rats, wherein the vaccine combined with AS02, AS03, MF59 gradually produced higher antibodies in four consecutive immunizations, and the non-stimulated elicited relatively higher immune responses in one immunization after 6 weeks apart; vaccine combined with CpG adjuvant and as02+ CpG adjuvant will gradually produce lower concentration of antibody in four consecutive immunizations, and will stimulate higher concentration of antibody in one immunization after 6 weeks interval, and the antibody content will be maintained at high level for a longer period. The antibody production was substantially identical in mice immunized with PP-3C and PP-3K conjugated A11 vaccine. Other phosphorylated polypeptide vaccines immunization of wild-type mice produced similar effects (results not shown).

Example 13: evaluation of immunogenicity of phosphorylated polypeptide antigen A5 conjugated to norovirus P protein in wild-type mice

Wild mice were subjected to muscle immunization with the phosphorylated polypeptide antigen A5 coupled to PP-3K in combination with an AS02+ CpG adjuvant AS a vaccine, 6 mice per group were immunized with 25. Mu.g/mouse, and serum was collected two weeks after each immunization and evaluated by ELISA. In ELISA experiments, a phosphorylated polypeptide having the sequence SEQ ID NO 1355, which phosphorylates at

amino acids

18, 238, 262 relative to the full-length Tau protein, was used as coating antigen, coupled to BSA. The change in antibody concentration in mouse serum is shown in fig. 9A. The result shows that the PP-3K-A5 compound vaccine is combined with the AS02+ CpG adjuvant to perform muscle immunity, the antibody is in an ascending trend after successive immunity, the immunogenicity of the vaccine is good, the high antibody concentration can be maintained for at least 6 weeks after the last immunity, and the antibody titer is more than or equal to 12800.

Example 14: immunogenicity evaluation of phosphorylated polypeptide antigen A5 conjugated to norovirus P protein in P301S transgenic mice

The phosphorylated polypeptide antigen A5 coupled with PP-3K is combined with AS02+ CpG adjuvant to be used AS vaccine to carry out muscle immunity on P301S transgenic mice, 8 mice in each group are respectively immunized once at

weeks

0, 2, 4, 6 and 12, and serum is obtained by blood sampling two weeks after each immunization for ELISA evaluation. In ELISA experiments, a phosphorylated polypeptide having the sequence SEQ ID NO 1355, which phosphorylates at

amino acids

18, 238, 262 relative to the full-length Tau protein, was used as coating antigen, coupled to BSA. The change in antibody concentration in mouse serum is shown in fig. 9B. The result shows that the PP-3K-A5 compound vaccine is combined with the AS02+ CpG adjuvant to perform muscle immunity, the antibody is in an ascending trend after successive immunity, the immunogenicity of the vaccine is good, the high antibody concentration can be maintained for at least 6 weeks after the last immunity, and the antibody titer is more than or equal to 12800.

Example 15: immunogenicity evaluation of phosphorylated polypeptide antigen A11 conjugated to norovirus P protein in P301S transgenic mice

The P301S transgenic mice are subjected to muscle immunization by combining with a phosphorylated polypeptide antigen A11 coupled with PP-3C and an AS02 plus CpG adjuvant AS a vaccine, wherein the amount of protein of an immunization dose is 25 mug/mouse in each group of 12 mice, and the mice are subjected to immunization at

weeks

0, 2, 4, 6 and 12 respectively, and blood is collected for two weeks after each immunization to obtain serum for ELISA evaluation. In ELISA experiments, a phosphorylated polypeptide having the sequence SEQ ID NO 1354 coupled to BSA, which phosphorylates at amino acids 202, 205, 396 and 404 relative to the full-length Tau protein, was used as coating antigen. The change in antibody concentration in mouse serum is shown in fig. 9C. The result shows that the PP-3K-A11 compound vaccine is combined with the AS02+ CpG adjuvant to perform muscle immunity, the antibody is in an ascending trend after successive immunity, the immunogenicity of the vaccine is good, the high antibody concentration can be maintained for at least 6 weeks after the last immunity, and the antibody titer is more than or equal to 12800.

Example 16: immunogenicity evaluation of phosphorylated polypeptide antigen A11 conjugated to norovirus P protein in P301S transgenic mice

The P301S transgenic mice are subjected to muscle immunization by combining with a phosphorylated polypeptide antigen A11 coupled with PP-3K and an AS02 plus CpG adjuvant AS a vaccine, wherein the amount of protein of an immunization dose is 25 mug/mouse in each group of 12 mice, and the mice are subjected to immunization at

weeks

0, 2, 4, 6 and 12 respectively, and blood is collected for two weeks after each immunization to obtain serum for ELISA evaluation. In ELISA experiments, a phosphorylated polypeptide having the sequence SEQ ID NO 1354 coupled to BSA, which phosphorylates at amino acids 202, 205, 396 and 404 relative to the full-length Tau protein, was used as coating antigen. The change in antibody concentration in mouse serum is shown in fig. 9D. The result shows that the PP-3K-A5 compound vaccine is combined with the AS02+ CpG adjuvant to perform muscle immunity, the antibody is in an ascending trend after successive immunity, the immunogenicity of the vaccine is good, the high antibody concentration can be maintained for at least 6 weeks after the last immunity, and the antibody titer is more than or equal to 12800.

Example 17: evaluation of immunogenicity of phosphorylated polypeptide antigen A12 conjugated to norovirus P protein in wild-type mice

Wild mice were subjected to muscle immunization with the phosphorylated polypeptide antigen A12 coupled to PP-3K in combination with an AS02+ CpG adjuvant AS a vaccine, 6 mice per group were immunized with 25. Mu.g/mouse, and serum was collected two weeks after each immunization and evaluated by ELISA at

weeks

0, 2, 4, 6, and 12, respectively. Phosphorylated polypeptides having the sequence SEQ ID NO 1356 coupled to BSA, which phosphorylate amino acids at positions 212, 214, 231 and 235 relative to the full-length Tau protein, were used as coating antigens in ELISA experiments. The change in antibody concentration in mouse serum is shown in fig. 9E. The result shows that the PP-3K-A12 compound vaccine is combined with the AS02+ CpG adjuvant to perform muscle immunity, the antibody is in an ascending trend after successive immunity, the immunogenicity of the vaccine is good, the high antibody concentration can be maintained for at least 6 weeks after the last immunity, and the antibody titer is more than or equal to 12800.

Example 18: immunogenicity evaluation of norovirus P protein-coupled phosphorylated polypeptide a12 in P301S transgenic mice were muscle immunized with a combination of a PP-3K-coupled phosphorylated polypeptide a12 and an AS02+ CpG adjuvant AS a vaccine, with each group of 12 mice having an immunizing dose of 25 μg/mouse, and each of the mice was immunized once at

weeks

0, 2, 4, 6, 12, and serum was collected two weeks after each immunization for ELISA evaluation. Phosphorylated polypeptides having the sequence SEQ ID NO 1356 coupled to BSA, which phosphorylate amino acids at positions 212, 214, 231 and 235 relative to the full-length Tau protein, were used as coating antigens in ELISA experiments. The change in antibody concentration in mouse serum is shown in fig. 9F. The result shows that the PP-3K-A12 compound vaccine is combined with the AS02+ CpG adjuvant to perform muscle immunity, the antibody is in an ascending trend after successive immunity, the immunogenicity of the vaccine is good, the high antibody concentration can be maintained for at least 6 weeks after the last immunity, and the antibody titer is more than or equal to 12800.

Example 19: cellular immune assessment-ELISPOT assay of phosphorylated polypeptide antigen A5 conjugated to norovirus P protein in P301S transgenic mice

A96-well plate was coated with a monoclonal antibody to cytokine interferon gamma (from elispot kit, available from BD company) at a concentration of 5. Mu.g/mL, 50. Mu.L per well, and covered overnight at 4 ℃. The coated antibody was discarded, and after washing once with a complete medium of 10% fetal bovine serum, 200. Mu.L of the complete medium was added to each well, and the medium was discarded after blocking at 37℃for 1 hour. The laboratory mice were sacrificed by pulling the neck, and spleen cells were taken to give a cell concentration of 10 ⁷ Cell suspensions were added to coated 96-well plates at 100 μl per well. 1 μg/mL of prokaryotic expressed full-length Tau protein and 100 μl of non-phosphorylated A5 polypeptide antigen were added per well, 37℃and 5% CO ₂ Culturing in an incubator for 24 hours, and stimulating and activating cells. After 24 hours, the cells were washed with sterile PBST (pH 7.4,0.01mol/L PBS, containing 0.05% Tween-20) buffer twice and washed 6 times with sterile water. Antibodies to interferon gamma (from elispot kit, available from BD company) were added to each well at 50 μl antibody concentration of 2 μg/mL and incubated for two hours at room temperature. Washing a 96-well plate, adding 50 mu L of horseradish peroxide labeled biotin secondary antibody (from elispot kit, purchased from BD company) per well, culturing for 2 hours at room temperature, washing with PBST four times, adding 50 mu LELispot chromogenic solution (AEC substrate) per well after washing with PBS 2 times, reacting for 5-60 minutes at room temperature in a dark place, discarding the staining solution, washing with distilled water, drying overnight, and calculating the number of activated cells in the sample by using a microscope.

The experimental results are shown in fig. 10A and 10B, and the PP-3K-A5 complex vaccine combined with the AS02+ CpG adjuvant group stimulated spleen cells to generate a smaller number of spots after five immunizations, demonstrating that no significant T cell response occurred in vivo, and that this immunization strategy was able to stimulate mice to generate the highest titers of antibodies specific for phosphorylated A5 polypeptides AS described in example 14. This immunization strategy may be a preferred immunization strategy for vaccine safety.

Example 20: cellular immune assessment-ELISPOT assay of phosphorylated polypeptide antigen A11 conjugated to norovirus P protein in P301S transgenic mice

The experimental procedure is as in example 19. The stimulus used 1. Mu.g/mL prokaryotic expression of full-length Tau protein and non-phosphorylated A11 polypeptide antigen 100. Mu.L.

The experimental results are shown in fig. 10C and 10D, and the PP-3K-a11 complex vaccine combined with the AS02+ CpG adjuvant group stimulated spleen cells to generate a smaller number of spots after five immunizations, demonstrating that no significant T cell response occurred in vivo, and that this immunization strategy was able to stimulate mice to generate the highest titers of antibodies specific for phosphorylated a11 polypeptides AS described in example 15. This immunization strategy may be a preferred immunization strategy for vaccine safety.

Example 21: cellular immune assessment-ELISPOT assay of phosphorylated polypeptide antigen A11 conjugated to norovirus P protein in P301S transgenic mice

The experimental results are shown in fig. 10E and 10F, and the PP-3C-a11 combined with the AS02+ CpG adjuvant group stimulated spleen cells to produce fewer spots, demonstrating that no significant T cell response occurred in vivo, and the immunization strategy was able to stimulate mice to produce the highest titers of antibodies specific for phosphorylated a11 polypeptides, AS described in example 15. This immunization strategy may be a preferred immunization strategy for vaccine safety.

Example 22: cellular immune assessment-ELISPOT assay of phosphorylated polypeptide antigen A12 conjugated to norovirus P protein in P301S transgenic mice

The experimental procedure is as in example 19. The stimulus used 1 μg/mL prokaryotic expression of full-length Tau protein and non-phosphorylated A12 polypeptide antigen 100 μl.

The experimental results are shown in fig. 10G and 10H, and the PP-3K-a12 combined with the AS02+ CpG adjuvant group stimulated spleen cells to produce fewer spots, demonstrating that no significant T cell response occurred in vivo, and the immunization strategy was able to stimulate mice to produce the highest titers of antibodies specific for phosphorylated a12 polypeptides, AS described in example 15. This immunization strategy may be a preferred immunization strategy for vaccine safety.

Example 23: behavioral assessment of phosphorylated polypeptide antigen A5 conjugated to norovirus P protein following immunization in P301S transgenic mice.

After immunization of P301S transgenic mice with phosphorylated polypeptide antigen A5 conjugated to PP-3K in combination with the AS02+ CpG adjuvant, immunized mice were taken every two weeks for rod tolerance testing starting at 8 weeks after the start of the experiment. The mice were placed on a mouse stick-turning machine, and the rotational speed was increased from 5rpm to 40rpm and maintained constant within 1.5min after the stick-turning machine was turned on. The time of the mice falling from the rotor bar within 300s was recorded. Experiments show that the tolerance of the immunized mice is enhanced in the rotarod experiment compared with the PBS group (the result is shown in figure 11A).

Example 24: behavioral evaluation of phosphorylated polypeptide a11 conjugated to norovirus P protein following immunization in P301S transgenic mice.

After immunization of P301S transgenic mice with phosphorylated polypeptide antigen a11 conjugated to PP-3C in combination with the AS02+ CpG adjuvant, immunized mice were taken every two weeks for rod tolerance testing starting at 8 weeks after the start of the experiment. The mice were placed on a mouse stick-turning machine, and the rotational speed was increased from 5rpm to 40rpm and maintained constant within 1.5min after the stick-turning machine was turned on. The time of the mice falling from the rotor bar within 300s was recorded. Experiments show that the tolerance of the immunized mice is enhanced in the rotarod experiment compared with the PBS group (the result is shown in FIG. 11B).

Example 25: behavioral evaluation of phosphorylated polypeptide antigen A11 coupled to norovirus P protein following immunization in P301S transgenic mice

After immunization of P301S transgenic mice with phosphorylated polypeptide antigen a11 conjugated to PP-3K in combination with the AS02+ CpG adjuvant, immunized mice were taken every two weeks for rod tolerance testing starting 8 weeks after the start of the experiment. The mice were placed on a mouse stick-turning machine, and the rotational speed was increased from 5rpm to 40rpm and maintained constant within 1.5min after the stick-turning machine was turned on. The time of the mice falling from the rotor bar within 300s was recorded. Experiments show that the tolerance of the immunized mice is enhanced in the rotarod experiment compared with the PBS group (the result is shown in figure 11C).

Example 26: behavioral evaluation of phosphorylated polypeptide antigen A12 coupled to norovirus P protein following immunization in P301S transgenic mice

After immunization of P301S transgenic mice with phosphorylated polypeptide antigen a12 conjugated to PP-3K in combination with the AS02+ CpG adjuvant, immunized mice were taken every two weeks for rod tolerance testing starting at 8 weeks after the start of the experiment. The mice were placed on a mouse stick-turning machine, and the rotational speed was increased from 5rpm to 40rpm and maintained constant within 1.5min after the stick-turning machine was turned on. The time of the mice falling from the rotor bar within 300s was recorded. Experiments show that the tolerance of immunized mice is enhanced in the rotarod experiment compared with the PBS group (the result is shown in figure 11D).

Example 27: behavioral evaluation of phosphorylated polypeptide antigen A5 coupled to norovirus P protein following immunization in P301S transgenic mice

Nesting experiments were performed 10 weeks after the start of the experiment after immunization of P301S transgenic mice with phosphorylated polypeptide antigen A5 conjugated to PP-3K in combination with an AS02+ CpG adjuvant. Each mouse was transferred to a new sterilized mouse box, and the new sterilized litter was spread evenly to a thickness of 0.8 cm/box, and two pieces of cotton of 5cm x 5cm were placed in the center of the right side of each mouse box, with the total weight of cotton being 1.2g-1.3g. Mice were assigned to 16:00 is transferred into a mouse box and indoor illumination is turned off, and the following day 7:00 turns on illumination and at 8: mice were scored for nesting effect at 00. The mouse numbering tags were hidden and scored independently by 3 trained operators, and the average of the three scores represents the score of one mouse in the nesting experiment.

Scoring criteria: 1, the cotton is not completely torn; 2, the cotton is completely torn for nesting, and the nest opening is shallow and flat; 3, the cotton is completely torn for nesting, but other parts except for drinking water ports are exposed, or the upper edge of the nest is lower than the head of the mouse; 4, the cotton is completely torn for nesting, and the nest opening is higher than the head of the mouse or the nest is three-dimensional and has no notch.

Nesting experiments can reflect the degree of completeness of mouse consciousness. Experiments show that the immunized mice perform significantly better than the PBS group in nesting experiments (the results are shown in fig. 12A).

Example 28: behavioral evaluation of phosphorylated polypeptide antigen A11 coupled to norovirus P protein following immunization in P301S transgenic mice

Nesting experiments were performed 10 weeks after the start of the experiment after immunization of P301S transgenic mice with phosphorylated polypeptide antigen a11 conjugated to PP-3C in combination with an AS02+ CpG adjuvant. The experimental procedure is as in example 27. Experiments show that the immunized mice perform significantly better than the PBS group in nesting experiments (the results are shown in fig. 12B).

Example 29: behavioral evaluation of phosphorylated polypeptide antigen A11 coupled to norovirus P protein following immunization in P301S transgenic mice

Nesting experiments were performed 10 weeks after the start of the experiment after immunization of P301S transgenic mice with phosphorylated polypeptide antigen a11 conjugated to PP-3K in combination with an AS02+ CpG adjuvant. The experimental procedure is as in example 27. Experiments showed that immunized mice performed better than PBS group in nesting experiments (results are shown in fig. 12C).

Example 30: behavioral evaluation of phosphorylated polypeptide antigen A12 coupled to norovirus P protein following immunization in P301S transgenic mice

Nesting experiments were performed 10 weeks after the start of the experiment after immunization of P301S transgenic mice with phosphorylated polypeptide antigen a12 conjugated to PP-3K in combination with an AS02+ CpG adjuvant. The experimental procedure is as in example 27. Experiments showed that immunized mice performed better than PBS group in nesting experiments (results are shown in fig. 12D).

Example 31: construction of pET28a-C-PA plasmid

Plasmids containing C-PA were obtained by sequence optimization and gene synthesis (Gilbert).

The C-PA gene is enriched by a PCR method, the gene sequence of the C-PA gene is shown as SEQ ID NO. 1363, and the specific implementation scheme is as follows:

1365 (forward direction): TTTAACTTTAAGAAGGAGATATACATATGGGTGGTGGTGGTTCTTGCGGCGGCG

SEQ ID NO 1366 (reverse): GTGGTGGTGGTGGTGGTGCTCGAGTTATTTAATACGCAGATACTGGCCAATCA the number of the individual pieces of the plastic,

the plasmid containing C-PA was subjected to PCR reaction in which the PCR reaction system was KOD-Plus DNA polymerase system (available from TOYOBO Co.) and the total volume of the reaction system was 50. Mu.L (buffer 5. Mu.L, dNTP 0.2mM, magnesium sulfate 1mM, each of the upstream and downstream primers was 0.3. Mu.M, template DNA 50ng, KOD enzyme 1. Mu.L, and water was added to make up to a final volume of 50. Mu.L). PCR was performed according to the reaction system instructions to obtain 50. Mu.L of a PCR product. The products were subjected to agarose gel electrophoresis and the target fragments were recovered using a gel recovery kit (purchased from Tiangen Biochemical technologies Co., ltd.).

Mu.g of pET28a vector plasmid (available from Novagen) was taken, 1. Mu.L of BamH I enzyme and Xho I enzyme (available from Takara) each were added, 5. Mu.L of digestion buffer (available from Takara) was added, and finally sterile water was added to the system to a final volume of 50. Mu.L at 37℃for 2 hours, and the product was subjected to agarose gel electrophoresis, and the vector fragment was recovered using a gel recovery kit (available from Tiangen Biotechnology Co., ltd.) to obtain a linear plasmid vector.

Mixing the carrier fragment and the target fragment (molar ratio is 1:3, total volume is 5 mu L) after double enzyme digestion, adding 5 mu L of homologous recombination mix (purchased from Zhongmeitai and Co.), connecting for 15min at 25 ℃, adding 10 mu L of connecting product into DH10B competent cells (purchased from Zhongmeitai and Co.), standing on ice for 30min, then heat-beating for 30s at 42 ℃, standing on ice for 2min, then adding the mixture into 600 mu L of non-resistant liquid LB medium, and resuscitating for 1h at 37 ℃ and 200 rpm. The bacterial solution was plated on LB solid plates containing kanamycin (15. Mu.g/mL) and cultured upside down at 37℃overnight. The recombinant clone is obtained, and the sequence is verified to be correct by sequencing, and the sequence is shown as SEQ ID NO. 1363. A pET28a-C-PA plasmid with the ability to express C-PA protein was obtained as shown in FIG. 15A.

Example 32: expression and purification of C-PA proteins

32.1 expression of C-PA proteins

1. Mu.L of the recombinant plasmid prepared in the above example was added to 100. Mu.L of competent cells of E.coli BL21 (purchased from TransGen Co.) and ice-bathed for 30min, followed by heat-shock in a water bath at 42℃for 90s and ice-bathing for 2min. To the mixture, 600. Mu.L of LB medium was added, 180rpm/min and incubated at 37℃for 1 hour. The mixture was uniformly spread on LB solid medium containing kanamycin (15. Mu.g/mL) resistance, and cultured at 37℃for 24 hours, thereby obtaining a strain capable of stably expressing recombinant proteins. Grown colonies were picked up and inoculated in 20mL LB medium at 37℃and cultured at 220rpm, and when the OD of the culture mixture reached 2.0, induction was performed with isopropyl thiogalactoside (IPTG, final concentration 1.0 mmol/L), at 37℃and at 220rpm for 6 hours. After the completion of the induction, the bacterial liquid was centrifuged at 4000rpm for 20 minutes, the supernatant was discarded, the bacterial pellet was resuspended in PBS, and the supernatant was discarded again by centrifugation at 4000rpm for 20 minutes to obtain a bacterial pellet containing the target protein.

Purification of 32.2C-PA protein

To the cell pellet obtained in 32.1, 20mL of a protein buffer (ph=7.0, containing 50mM Tris,300mM KCl) was added to resuspend, cells were broken by sonication on ice for 30min, and the mixture was centrifuged at 12000rpm at 4 ℃ for 30min, and the supernatant was discarded. Collecting the precipitate, re-suspending with 8M urea buffer solution (PH=7.0 containing 50mM Tris,300mM KCl,8M urea), stirring overnight at 4deg.C, collecting solution 16000rpm, centrifuging at 4deg.C for 30min, collecting supernatant, transferring into dialysis bag with cut-off size of 10kd, dialyzing with glycine dialysate volume: protein solution volume=10:1 ratio, changing liquid every 4 hours, dialyzing for 6 times to slowly renaturate the protein, collecting protein solution, ultrafiltering and concentrating until protein concentration reaches 1.0 mg/mL-2.0 mg/mL, and performing SDS-PAGE on the protein, wherein the protein molecular weight is about 24kd as shown in figure 15B.

Example 33: coupling reaction of phosphorylated polypeptide antigen vaccine with BLP

EXAMPLE 33.1 ligation of C-PA and BLP

The preparation method of BLP is described in Chinese patent application CN 105968213. Taking 1mL of 15mg/mLBLP solution, centrifuging for 30min at 4 ℃ with 5000g, and discarding the supernatant; the BLP was resuspended in 5mL of C-PA solution and slowly shaken at 25℃for 30min to prepare C-PA-BLP.5000g was centrifuged at 4℃for 30min, the supernatant was discarded and resuspended in 10mL of sterile PBS (pH=7.2). Repeated 4 times. The washed pellet was resuspended in 1mL PBS, OD600 was detected, and the C-PA-BLP concentration was calibrated with BLP standards.

EXAMPLE 33.2 ligation of C-PA and BLP

The preparation method of BLP is described in Chinese patent application CN 105968213. Taking 1mL of 15mg/mLBLP solution, centrifuging for 30min at 4 ℃ with 5000g, and discarding the supernatant; the BLP was resuspended in 3mL of C-PA solution and slowly shaken at 4℃for 6h to prepare C-PA-BLP.5000g was centrifuged at 4℃for 30min, the supernatant was discarded and resuspended in 10mL of sterile PBS (pH=7.2). Repeated 4 times. The washed pellet was resuspended in 1mL PBS, OD600 was detected, and the C-PA-BLP concentration was calibrated with BLP standards.

EXAMPLE 33.3 coupling reaction of phosphorylated polypeptide antigen vaccine with C-PA-BLP

With 0.1M ammonium bicarbonate solution (ph=7.5). Each lyophilized form of the phosphorylated polypeptide antigen vaccine prepared in example 1 was quantified by dissolving the phosphorylated polypeptide to 1 mg/mL. According to the molar weight of the C-PA protein: molar amount of polypeptide = 1:30 ratio the polypeptide solution was slowly added to the pellet after centrifugation of the C-PA-BLP and slowly mixed. The mixture was incubated at 2-8deg.C for 48 hours with slow shaking. The resulting product was centrifuged and the unbound polypeptide was resuspended in PBS.

EXAMPLE 33.4 coupling reaction of phosphorylated polypeptide antigen vaccine with C-PA-BLP

With 0.1M ammonium bicarbonate solution (ph=8.0). Each lyophilized form of the phosphorylated polypeptide antigen vaccine prepared in example 1 was quantified by dissolving the phosphorylated polypeptide to 2 mg/mL. According to the molar weight of the C-PA protein: molar amount of polypeptide = 1:100 ratio the polypeptide solution was slowly added to the pellet after centrifugation of the C-PA-BLP and slowly mixed. The mixture was incubated at 2-8deg.C for 48 hours with slow shaking. The resulting product was centrifuged and the unbound polypeptide was resuspended in PBS.

EXAMPLE 33.5 coupling reaction of phosphorylated polypeptide antigen vaccine with C-PA-BLP

Example 34: determination of efficiency of ligation of phosphorylated polypeptide antigen product coupled to BLP

Into the phosphorylated polypeptide antigen product coupled with C-PA-BLP, the volume ratio is 1:1, 10mM dithiothreitol solution was added thereto, and after uniform mixing, the mixture was allowed to stand at room temperature for 16 hours. The reaction product was centrifuged at 16000g for 15min at 4 ℃. The supernatant was subjected to HPLC measurement. The concentration of the sample to be measured was quantitatively analyzed by taking the phosphorylated polypeptide dissolved in a 10mM dithiothreitol solution of 0.5mg/mL, 0.25mg/mL, 0.125mg/mL, 0.0625mg/mL, 0.03125mg/mL and 0.015625mg/mL as a standard substance and taking the peak area of the phosphorylated polypeptide as a standard curve with respect to the concentration of the standard substance (the results are shown in FIG. 13A, FIG. 13C and FIG. 13D).

It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention, which should be construed as limited by the scope of the appended claims. It will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the spirit and scope of the invention, and such modifications and adaptations are intended to be comprehended within the scope of the invention.

And (3) a sequence table:

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

Claims

1. a phosphorylated polypeptide antigen vaccine comprising two polypeptide fragments from a human full-length Tau protein, wherein the two polypeptide fragments are from the following regions of the human full-length Tau protein: amino acids 194-266 of human full-length Tau protein and amino acids 392-408 of human full-length Tau protein, and contains phosphorylation sites; wherein the two polypeptide fragments are directly connected through peptide bond, the amino acid sequence after connection is shown as SEQ ID NO.875 or SEQ ID NO.1020, and the phosphorylation site is the amino acid site corresponding to the 202 st, 205 th, 396 th and 404 th amino acid sequence of the human full-length Tau protein, namely P-Ser ₂₀₂ 、P-Thr ₂₀₅ 、P-Ser ₃₉₆ And P-Ser ₄₀₄ Wherein the amino acid sequence of the human full-length Tau protein is shown as SEQ ID NO. 1332.

2. A complex vaccine formed from the phosphorylated polypeptide antigen vaccine of claim 1 coupled to a carrier.

3. The complex vaccine of claim 2, wherein the carrier is selected from the group consisting of human serum albumin, keyhole limpet hemocyanin, bacterial-like particle BLP, immunoglobulin molecules, thyroglobulin, ovalbumin, bovine serum albumin component V, influenza hemagglutinin, PAN-DR binding peptide, malaria circumsporon protein, hepatitis b surface antigen HBSAg19-28, heat shock protein 65, bcg, cholera toxin, attenuated cholera toxin variants, diphtheria toxin, norovirus capsid P protein, recombinant streptococcal C5a peptidase, streptococcus pyogenes ORF1224, streptococcus pyogenes ORF1664, streptococcus pyogenes ORF2452, pneumolysin, attenuated pneumolysin variants, chlamydia pneumoniae ORFT858, tetanus toxoid, HIV gp120T1, microbial surface components that recognize adhesion matrix molecules, growth factors, hormones and/or chemokines.

4. The complex vaccine of claim 3, wherein the carrier is a bacterial-like particle BLP.

5. The complex vaccine of claim 3, wherein the vector is a norovirus capsid P protein.

6. The complex vaccine of claim 5, wherein the norovirus capsid P protein is PP-3C, the sequence of which is shown as SEQ ID No.1357, or PP-3K, the sequence of which is shown as SEQ ID No. 1359.

7. A method of preparing the complex vaccine of claim 2, said method comprising the steps of:

1) Artificially synthesizing the phosphorylated polypeptide antigen vaccine of claim 1;

2) Preparing a carrier to be coupled to the phosphorylated polypeptide antigen vaccine;

8. The method of claim 7, wherein the vector in step 2) is a norovirus capsid P protein, said norovirus capsid P protein being PP-3C or PP-3K, comprising in particular the steps of:

ii) transferring the expression vector into a recipient cell;

iii) Expressing the PP-3C or PP-3K protein and self-assembling the recombinant P particles in a receptor cell.

9. The method of claim 8, further comprising the steps of isolating and purifying.

10. The method of claim 9, wherein the purification is performed using ion exchange chromatography and/or hydrophobic chromatography.

11. The method of claim 7, wherein step 3) is coupled using PP-3C as a vaccine carrier; or step 3) adopting PP-3K as a vaccine carrier for coupling.

12. The method of claim 11, wherein the buffer system coupled using PP-3C as a vaccine carrier is an ammonium bicarbonate buffer system.

13. The method of claim 12 wherein the ammonium bicarbonate buffer system has a pH in the range of 7.5 to 8.8.

14. The method of claim 13, wherein the phosphorylated polypeptide antigen vaccine is mixed with the carrier in a ratio of 10:1 to 100:1.

15. The method of claim 14, wherein the coupling reaction temperature ranges from 2 to 10 ℃.

16. The method of claim 11, wherein the buffer system coupled using PP-3K as a vaccine carrier is a phosphate buffer system.

17. The method of claim 16, wherein the pH of the phosphate buffer system ranges from 7.0 to 8.5.

18. The method of claim 17, wherein the phosphorylated polypeptide antigen vaccine is mixed with the carrier in a ratio of 10:1 to 100:1.

19. The method of claim 18, wherein the coupling reaction temperature ranges from 2 to 25 ℃.

20. The method of claim 7, wherein the carrier in step 2) is a bacterial-like particle BLP, and step 3) specifically comprises i) obtaining a purified protein-linker C-PA protein having the sequence shown in SEQ ID NO. 1364; ii) ligating the carrier bacterial-like particle BLP obtained in step 2) with a C-PA protein to obtain C-PA-BLP; iii) Coupling C-PA-BLP with the phosphorylated polypeptide antigen vaccine; wherein the coupling reaction buffer system is an ammonium bicarbonate buffer system.

21. The method of claim 20, wherein the coupling reaction temperature ranges from 2 ℃ to 30 ℃.

22. The method of claim 20, wherein the ammonium bicarbonate buffer system has a pH in the range of 7.5 to 8.8.

23. The method of claim 20, wherein the phosphorylated polypeptide antigen vaccine is mixed with the C-PA-BLP in a ratio of 10:1 to 100:1.

24. The method of claim 23, wherein the coupling reaction temperature ranges from 2 to 10 ℃.

25. The method of any one of claims 7 to 24, wherein step 4) comprises removing the unsuccessfully linked coupling agent and polypeptide antigen by desalting chromatography, dialysis and ultrafiltration.

26. A vaccine composition comprising the phosphorylated polypeptide antigen vaccine of claim 1 or the complex vaccine of any one of claims 2 to 6.

27. The vaccine composition of claim 26, wherein the vaccine composition further comprises a pharmaceutically acceptable adjuvant.

28. The vaccine composition of claim 27, wherein the pharmaceutically acceptable adjuvant is selected from one or more of CpG, MF59, AS02, AS03, freund's complete adjuvant, and freund's incomplete adjuvant.

29. Use of a phosphorylated polypeptide antigen vaccine according to claim 1 or a complex vaccine according to any one of claims 2 to 6 or a vaccine composition according to any one of claims 26 to 28 for the manufacture of a medicament for the prevention and/or treatment of a neurodegenerative disorder disease selected from one or more of alzheimer's disease, creutzfeldt-jakob disease, dementia pugilistica, down's syndrome, gerstmann-straussler-scheelitis, inclusion body myositis, prion protein cerebral amyloid vascular disease and traumatic brain injury, amyotrophic lateral sclerosis, parkinsonism-dementia syndrome, silver-particle dementia, basal ganglia degeneration, diffuse neurofibrillary tangle calcification, chromosome 17-linked frontotemporal dementia with parkinsonism, hao-construction, multiple system atrophy, type C nii-skin disease, pick disease, progressive subcutaneous gliosis and progressive supranuclear encephalitis.

30. The use of claim 29, wherein the neurodegenerative disorder disease is alzheimer's disease.

31. The use of claim 29, wherein the phosphorylated polypeptide antigen vaccine or complex vaccine or vaccine composition is immunized by subcutaneous or intraperitoneal or intramuscular route.

32. The use of claim 31, wherein the phosphorylated polypeptide antigen vaccine or complex vaccine or vaccine composition is immunized by the muscle route.