CN110548021A

CN110548021A - Application of long-chain unsaturated fatty acid in preparation of composition for preventing Edwardsiella

Info

Publication number: CN110548021A
Application number: CN201810553639.0A
Authority: CN
Inventors: 王启要; 魏立帆; 张元兴; 刘琴; 刘晓红; 马悦
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2018-05-31
Filing date: 2018-05-31
Publication date: 2019-12-10

Abstract

The invention relates to application of long-chain Unsaturated Fatty Acid (UFA) in preparation of a composition for preventing Edwardsiella. The UFA is disclosed to have extremely remarkable effect on inhibiting the host from being infected by the Edwardsiella for the first time. UFA reduce the ability of edwardsiella to infect or colonize a host by binding to the EsrC protein of edwardsiella to reduce or inhibit the ability of the EsrC protein to activate the three-type (T3SS) and six-type (T6SS) secretion systems in the organism.

Description

Application of long-chain unsaturated fatty acid in preparation of composition for preventing Edwardsiella

Technical Field

The invention belongs to the field of fish culture, and particularly relates to application of long-chain unsaturated fatty acid in preparation of a composition for preventing Edwardsiella.

Background

With the continuous expansion of the aquaculture scale of the aquaculture industry, large-scale outbreaks of aquaculture diseases often occur. The annual loss of infectious diseases in fish accounts for more than 20% of the yield, and large-scale outbreaks have become a major obstacle in the aquaculture industry. The main causes of infectious diseases in fish include bacteria, parasites and viruses.

The Edwardsiella can cause Edwardsiellosis, is an important fish pathogenic bacterium, can cause diseases to more than 20 kinds of freshwater and seawater fishes such as catfish, turbot, eel and the like, cause gastrointestinal inflammation and hemorrhagic septicemia, cause a great amount of fish death, and seriously threaten the aquaculture industry. Among them, Edwardsiella piscicola is one of the most toxic species of Edwardsiella. The virulence associated factors necessary for successful infection of the host by edwardsiella are mainly the three-type (T3SS) and six-type (T6SS) secretion systems. In Edwardsiella piscida (Edwardsiella pisciida), Edwardsiella tarda (Edwardsiella tarda), Edwardsiella ictaluri (Edwardsiella ictaluri), T3SS and T6SS are strictly regulated by the global regulator EsrC.

At present, the large-scale outbreak of the disease is generally controlled by chemically synthesized medicines or antibiotics in mariculture production, but a plurality of disadvantages occur in long-term medication: 1) sometimes, fish diseases have complex etiology, blindness exists when a large amount of medicines are used, and many diseases can not be treated by targeted medicines at present; 2) the chemical drugs have weak preventive effect, and sick fishes have poor food intake and cannot take effective drug dosage; 3) drugs ingested by fish bodies often remain in the fish bodies, which is harmful to human health, and long-term use of the drugs causes environmental pollution and causes the appearance of drug resistance of a large number of microorganisms. Moreover, under the maintenance of long-term medicines, a large number of eliminated individuals with weak disease resistance survive, so that the quality of fish meat is influenced, the disease resistance of the whole population is reduced, and the development of the mariculture industry is seriously influenced.

Therefore, the development of a product or a method with low toxicity or no toxicity, environmental friendliness and ideal effect for preventing and treating diseases in the fish culture process is an urgent problem to be solved in the field. In addition, the industrial characteristics of the aquaculture industry require that the disease control technology must be economical, convenient to apply and implement, so that the products or methods to be developed should also meet the characteristics of economy and practicality.

Disclosure of Invention

The invention aims to provide application of long-chain unsaturated fatty acid in preparation of a composition for preventing Edwardsiella.

In a first aspect of the invention, there is provided the use of a long chain unsaturated fatty acid for the preparation of a composition for inhibiting edwardsiella infection in a host; the long-chain unsaturated fatty acid comprises: oleic acid (CAS #:143-19-1), or palmitoleic acid (CAS #: 373-49-9).

In a first aspect of the invention, there is provided the use of a long chain unsaturated fatty acid for the preparation of a composition for the prevention of edwardsiella infection in fish; the long-chain unsaturated fatty acid comprises: oleic acid (CAS #:143-19-1), or palmitoleic acid (CAS #: 373-49-9).

In a preferred embodiment, the composition is a medicament, food or feed.

In another preferred embodiment, the fish is a fish that hosts edwardsiella, i.e., the fish is an edwardsiella-susceptible fish.

In another preferred embodiment, the fish includes (but is not limited to): fish of the order flounders (including flounder), fish of the order cypriniformes (including cyprinid), fish of the order perciformes (including the family capreoviridae); preferably, including (but not limited to): turbot of flounder family, zebrafish of carp family, catfish, eel, flounder, salmon, tilapia, etc.

In another preferred example, the Edwardsiella bacteria is Edwardsiella pisciida, Edwardsiella tarda, Edwardsiella ictaluri.

In another aspect of the present invention, there is provided a method of inhibiting infection of a host by edwardsiella, the method comprising: treating or culturing Edwardsiella with long chain unsaturated fatty acid; the long-chain unsaturated fatty acid comprises: oleic acid (CAS #:143-19-1), or palmitoleic acid (CAS #: 373-49-9).

In a preferred embodiment, the long chain unsaturated fatty acid reduces the ability of the short chain unsaturated fatty acid to infect or colonize a host by binding to EsrC, thereby reducing the ability of EsrC to activate both the three-type (T3SS) and six-type (T6SS) secretion systems in the organism.

In another aspect of the present invention, there is provided a composition for inhibiting edwardsiella infection in a host, said composition comprising a long chain unsaturated fatty acid, and a dietetic or pharmaceutically acceptable carrier or excipient; in the composition, the content of long-chain unsaturated fatty acid is 20-200 mu M; preferably 20 to 100 μ M.

In a preferred embodiment, the dietetic or pharmaceutically acceptable carrier or excipient comprises BSA.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, UFA can inhibit EsrC binding to DNA.

A-B, the addition of different fatty acids affected the transcription and protein expression levels of T3 SS.

C, EMSA experiments prove that UFA influences the combination of EsrC and DNA.

D, EsrCR38G was not affected by fatty acids.

E, sites that mimic the interaction of fatty acids and EsrC.

FIG. 2 shows the death curve of turbot. Injecting PBS, Edwardsiella mixed BSA (WT + BSA), Edwardsiella mixed unsaturated fatty acid (WT + UFA) and Edwardsiella esrC deletion strain (delta esrC) into the abdominal cavity of turbot, and recording the death condition.

FIG. 3, death curves of zebrafish. Zebrafish were injected intramuscularly with PBS, edwardsiella mixed BSA (WT + BSA), edwardsiella mixed unsaturated fatty acid (WT + UFA), edwardsiella esrC deficient strain (Δ esrC) and the mortality was recorded.

FIG. 4, pUTT plasmid map.

Detailed Description

The present inventors have conducted extensive and intensive studies and have revealed for the first time that a long-chain Unsaturated Fatty Acid (UFA) has an extremely significant effect on inhibiting infection of a host by edwardsiella. The long-chain unsaturated fatty acid is combined with the EsrC protein of the Edwardsiella to weaken or inhibit the capability of the EsrC protein to activate a three-type secretion system (T3SS) and a six-type secretion system (T6SS) in a living organism, thereby reducing the capability of the Edwardsiella to infect or colonize a host.

Long chain unsaturated fatty acids

The invention employs long chain unsaturated fatty acids, which are straight chain fatty acids with 1-2 double bonds and carbon chain lengths of 16-22 carbon atoms. More preferably, the long chain unsaturated fatty acid has 1 double bond. More preferably, the long chain unsaturated fatty acids have a carbon chain length of, for example, 16, 17, 18, 19, 20, 21, 22 carbon atoms.

In a further preferred mode of the invention, the long chain unsaturated fatty acid is oleic acid or palmitoleic acid.

Oleic acid (Oleic acid) is a monounsaturated fatty acid having the formula C ₁₈ H ₃₄ O ₂ and the formula:

Palmitoleic acid (Palmitoleic acid), a monounsaturated fatty acid, also known as "cis-9-hexadecenoic acid," has the molecular formula C ₁₆ H ₃₀ O ₂ and has the following structural formula:

In addition to the above-mentioned most preferred long chain unsaturated fatty acids, the present invention further includes analogs or derivatives of said long chain unsaturated fatty acids, such as those wherein one or more of the groups are substituted but still retain their activity.

The invention also includes the dietetic or pharmaceutically acceptable salts, hydrates or precursors of said long chain unsaturated fatty acids, as long as they also have the effect of preventing, alleviating or treating an edwardsiella infection. The "dietotherapy or pharmacy acceptable salt" refers to salt generated by the reaction of a compound and inorganic acid, organic acid, alkali metal or alkaline earth metal and the like. These salts include (but are not limited to): (1) salts with the following inorganic acids: such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid; (2) salts with organic acids such as acetic acid, oxalic acid, succinic acid, tartaric acid, methanesulfonic acid, maleic acid, or arginine. Other salts include those formed with alkali or alkaline earth metals (such as sodium, potassium, calcium or magnesium), in the form of esters, carbamates, or other conventional "precursors".

By "precursor" is meant that the precursor undergoes a metabolic or chemical reaction in vivo to convert to a long chain unsaturated fatty acid or analog thereof when administered by an appropriate method.

The present invention also includes isomers and racemates of the long-chain unsaturated fatty acids, as long as they also have an effect of preventing and treating an edwardsiella infection. The term "isomer" as used herein includes: geometric isomers, enantiomers, diastereomers (e.g., cis-trans isomers, conformational isomers). The compounds have one or more asymmetric centers. Thus, these compounds may exist as racemic mixtures, individual enantiomers, individual diastereomers, mixtures of diastereomers, cis or trans isomers.

It will be understood by those skilled in the art that, once the structure of the long chain unsaturated fatty acid is known, it can be obtained by a variety of methods well known in the art, using well known starting materials, such as chemical synthesis or extraction from organisms (e.g., animals or plants), and such methods are encompassed by the present invention. In addition, the long-chain unsaturated fatty acids can also be obtained by a commercially available route.

Use of

In Edwardsiella, the three-type (T3SS) and six-type (T6SS) secretion systems are strictly regulated by the global regulatory factor EsrC. The research of the inventor finds that long-chain unsaturated fatty acid can be directly combined with EsrC, so that the structure of EsrC protein is changed, and the EsrC loses the capability of activating T3SS and T6 SS. When T3SS and T6SS were turned off, Edwardsiella piscicola, Edwardsiella tarda, Edwardsiella ictaluri, etc. could not successfully infect the host.

EsrC is an AraC family transcriptional regulator consisting of 230 amino acids (aa). The research of the inventor finds that UFA can be directly combined with EsrC, so that the structure of EsrC protein is changed, and the EsrC loses the capability of activating T3SS and T6 SS. When T3SS and T6SS were turned off, Edwardsiella pisicides could not successfully infect the host.

In the examples of the present invention, the present inventors investigated the interaction of proteins and long chain unsaturated fatty acids and DNA. The results demonstrate that EsrC can activate T3/T6SS expression by binding directly to DNA, but when EsrC binds to long chain unsaturated fatty acids, it loses the ability to activate T3/T6SS, eventually losing the ability to infect and colonize the host.

In the embodiment of the invention, the inventor directly carries out infection experimental research on fishes, and confirms that the long-chain unsaturated fatty acid can obviously protect a host from being poisoned by Edwardsiella and can effectively prevent large-scale epidemic diseases caused by Edwardsiella in the aquaculture process.

Based on the new discovery of the inventor, the invention provides the application of long-chain unsaturated fatty acid in preparing a composition for preventing and treating Edwardsiella infection.

The host associated with the Edwardsiella infection includes marine fish and freshwater fish, and the host includes any fish as the Edwardsiella host. Examples include, but are not limited to: of the order Flounderiformes (including the family Paralichthys), of the order Cypriniformes (including the family Cyprinaceae). More specifically such as but not limited to: turbot of flounder family, zebrafish of carp family, catfish, eel, flounder, salmon, tilapia, etc.

Composition comprising a metal oxide and a metal oxide

As used herein, the term "composition of the invention" is generally a food composition, feed composition or pharmaceutical composition containing a long-chain unsaturated fatty acid (or an analog thereof or an isomer, racemate, bromatologically or pharmaceutically acceptable salt, hydrate or precursor thereof) as an active ingredient for the control of edwardsiella infection; and a pharmaceutically acceptable carrier or excipient.

In the present invention, the term "comprising" means that various ingredients can be used together in the mixture or composition of the present invention. Thus, the terms "consisting essentially of and" consisting of are encompassed by the term "comprising.

In the present invention, a "dietetic or pharmaceutically acceptable" ingredient is a substance that is suitable for use in an animal without undue adverse side effects (such as toxicity, irritation and allergic response) commensurate with a reasonable benefit/risk ratio.

In the present invention, the "dietetic or pharmaceutically acceptable carrier" is a pharmaceutically or dietetically acceptable solvent, suspending agent or excipient for delivering the long-chain unsaturated fatty acid of the present invention (or its analogue or its isomer, racemate, pharmaceutically acceptable salt, hydrate or precursor) to an animal. The carrier may be a liquid or a solid. Pharmaceutically acceptable carriers suitable for use in the present invention include (but are not limited to): BSA, saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof.

The invention also provides a method for preparing a composition for preventing and treating the Edwardsiella infection, which comprises the steps of mixing an effective amount of long-chain unsaturated fatty acid (or analogues thereof or isomers, racemes, pharmaceutically acceptable salts, hydrates or precursors thereof) with a pharmaceutically acceptable carrier to obtain the composition of the invention, wherein the weight proportion of the active ingredients in the composition can be 0.0001-50 wt%; it is preferably 0.001 to 20 wt%.

The dosage form of the composition of the present invention may be various, and any dosage form may be used as long as it can allow the active ingredient to efficiently reach the animal. From the standpoint of ease of preparation and administration, the preferred composition is an oral or injectable formulation. Such as may be selected from: granule, tablet, capsule, solution, suspension, or powder. Various conventional carriers or auxiliary materials required for preparing different dosage forms can be added into the composition, such as fillers, flavoring agents, antioxidants, perfumes, pigments, lubricants, glidants, wetting agents, emulsifiers, pH buffering substances and the like. These additives are well known to those skilled in the art.

In a preferred embodiment of the present invention, the composition is prepared by mixing the unsaturated fatty acid with BSA, and excellent technical effects are achieved in vivo.

The invention also provides a method for preventing and treating the Edwardsiella infection, which comprises the following steps: administering to a subject (fish) in need thereof an effective amount of a long chain unsaturated fatty acid (or an analog thereof or an isomer, racemate, pharmaceutically acceptable salt, hydrate or precursor thereof). The amount of active ingredient administered is a prophylactically and therapeutically effective amount, which is generally about 10ng to 1mg per kg of animal body weight. Of course, the particular dosage should also take into account factors such as the route of administration.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

1. Bacterial species and plasmids

The species and plasmids used in this example are listed in table 1. All strains were stored at-80 ℃ in LB medium containing 20% glycerol. The culture temperature of the Edwardsiella piscicola is 30 ℃, and the culture temperature of the escherichia coli is 37 ℃. When no special indication is given, the rotation speed of the shaking table used for liquid culture is 200 rpm. When needed, antibiotics are added to the medium: polymyxin (polymyxin, Col, 16. mu.g/ml), carbenicillin (Carb, 24. mu.g/ml), kanamycin (kanamycin, Km, 50. mu.g/ml). DMEM medium was purchased from Gibco.

TABLE 1 strains and plasmids

2. Preparation of main reagent and buffer solution

Palmitic acid (palmitate) was purchased from Sigma; palmitoleic acid (palmitolate) was purchased from Sigma; oleic acid (oleate) from Sigma; stearic acid (stearate) was purchased from Sigma.

Preparing an antibiotic solution: the antibiotic powder was dissolved in deionized water or absolute ethanol, filter sterilized with a 0.22 μm filter (Millipore, Germany), and dispensed into EP tubes for storage at-20 ℃ for future use. Polymyxin sulfate (PolymyxinB, Inalco), Kanamycin (Kanamycin, Inalco) and carbenicillin (Carbenicilin, Inalco) were dissolved in water, and the concentrations of the stock solutions were 16mg/ml, 50mg/ml and 50mg/ml, and the stock solutions were diluted 1000 times and used as the working concentrations. Chloramphenicol (Chloromycetin, Inalco) is dissolved in absolute ethyl alcohol at a concentration of 75mg/ml mother liquor, and is subpackaged in an EP tube and stored at-20 ℃ for later use. Chloramphenicol was diluted 3000-fold and used as the working concentration. It is noted that chloramphenicol is highly toxic.

LB: weighing the components according to 5g/l of yeast powder, 10g/l of tryptone and 10g/l of NaCl, adding deionized water, adjusting the pH value to 7.0 by using 10mol/l of NaOH, and fixing the volume by using the deionized water. Mixing, and sterilizing with high pressure steam at 121 deg.C for 25 min.

LB solid agar: weighing each component according to 5g/l of yeast powder, 10g/l of tryptone, 10g/l of NaCl and 15g/l of agar, adding deionized water, adjusting the pH value to 7.0 by using 10mol/l of NaOH, and fixing the volume by using the deionized water. Mixing, and sterilizing with high pressure steam at 121 deg.C for 25 min.

10 XTAE buffer solution 242g Tris base was dissolved in 600ml double distilled water, 57.1ml glacial acetic acid and 37.2g Na ₂ EDTA.2H ₂ O were added, the volume was adjusted to 1000ml, and the solution was diluted 10 times before use.

1.0% agarose gel: weighing 1.0g of agarose, dissolving in 100ml of 1 XTAE buffer solution, heating in a microwave oven for about 2min, pouring into a gel making table quickly after the agarose is completely dissolved, and carrying out spot electrophoresis after cooling for 15 min.

5 × TBE buffer: 54g of Tris base, 27.5g of boric acid and 4.12g of EDTA are dissolved in 1000ml of ultrapure water.

6% polyacrylamide non-denaturing gel: 9.63ml of ultrapure water, 0.75ml of 50% glycerol, 1.5ml of 5 XTBE buffer, 3ml of 30% AB solution, 0.11ml of 10% APS, 0.01ml of TEMED.

PBS (1L) 8.0g NaCl, 0.2g KCl, 1.44g Na ₂ HPO ₄, 0.24g KH ₂ PO ₄, and 1L deionized water.

PBST (1L) 8.0g NaCl, 0.2g KCl, 1.44g Na ₂ HPO ₄, 0.24g KH ₂ PO ₄, 1L deionized water mixed, and 500. mu.l Tween-20 added and mixed.

Sealing liquid: 10% skim milk powder was dissolved in PBST.

Electrotransfer buffer (1L): 3.03g of Tris alkali, 14.4g of glycine and 800ml of deionized water are fully dissolved, 200ml of anhydrous methanol is added and mixed evenly.

Preparing a fatty acid solution for animal experiments: palmitic acid, palmitoleic acid, oleic acid, and stearic acid were purchased from Sigma. Dissolving fatty acid in 10% BSA PBS, adding KOH according to the molar ratio of 1:1 to the fatty acid, and preparing the mother liquor with the concentration of 10 mM. Storing at-20 deg.C for use.

3. Strain construction

(1) Construction of esrC in-frame deletion Strain (. DELTA.esrC)

In this experiment, an in-frame marker-free deletion strain was constructed using pDMK (plasmid pDM4 having a kanamycin resistance gene inserted therein).

The pDMK plasmid was extracted and digested with SalI/XbaI in a 37 ℃ water bath for 1 to 1.5 hours. And carrying out DNA agar gel electrophoresis separation on the plasmid subjected to enzyme digestion, selecting a band with the size of 8,700bp, tapping and recovering, and placing the recovered linear DNA at-20 ℃ for later use.

³ ⁵Crude extraction of E.pisciida EIB202 genome, using it as template, respectively using primer pair P1/P2 primer pair and P3/P4 primer pair to amplify upstream and downstream fragments of target gene, purifying and recovering, then using primer pair P1/P4 to make Overlap-PCR, connecting upstream and downstream fragments together, mixing the connected upstream and downstream DNAs and digested pDMK according to mole number 3:1, adding ITA Mix, water bathing at 50 deg.C for 1 hr, transferring into DH 5. alpha. pir, coating chloramphenicol LB agar plate, placing the plate into 37 deg.C incubator overnight to culture, 12-24 monoclones, inoculating LB, 37 deg.C, 200rpm, 2-5h, using universal primer pair to verify pDF/MK-R, inoculating into fresh LB, 37 deg.C, 200rpm, overnight, extracting, transferring into correct plasmid, sequencing, inoculating into SM 2. Bao SM 2, inoculating primer pair to check, inoculating single pDfF/MK-R, inoculating into fresh LB-agar plate, inoculating to check single pDsF, inoculating to agar 23, inoculating to check single pDsF, inoculating to single pDsF-F, inoculating to single pDsF, inoculating to agar plate, inoculating to check single pDsF-20-24, inoculating to check single pDsF, inoculating to single pDsF-20, inoculating to single pDmK, inoculating to check pDmK, inoculating to single pDmK-20, inoculating to check, inoculating to check pDF, inoculating to.

P1 primer: cccccccgagctcaggttacccggatctatGCTGCTGGAGGGCATCAGC (SEQ ID NO:1)

P2 primer: ACCGTGTTTACATGAGGTGCTCCTGACTGA (SEQ ID NO:2)

P3 primer: GCACCTCATGTAAACACGGTAAGGAGCCT (SEQ ID NO:3)

P4 primer: gagtacgcgtcactagtggggcccttctagAGTCCGAAGAGCAGAATGGC (SEQ ID NO:4)

Universal primer pDMK-F: CTAGAAGGGCCCCACTAGTG (SEQ ID NO:5)

Universal primer pDMK-R: ATAGATCCGGGTAACCTGAGC (SEQ ID NO:6)

Out-F primer: CCATCGACGGCGATTTTCAG (SEQ ID NO:7)

Out-R primer: CCTGCGGCGCGTTCATCAGG (SEQ ID NO:8)

In-F:CCAGACAACATCGCGCTCC(SEQ ID NO:9)

In-R:GCAGTAGCCAGCGTTTCGG(SEQ ID NO:10)

(2) Construction of esrC complementation strain and eseB promoter-driven luciferase gene (luxAB) reporter plasmid

In this experiment, a complementation expression plasmid was constructed using pUTT plasmid.

The map of plasmid pUTT is shown in FIG. 4. The pUTT plasmid was extracted and digested with HindIII/EcoRI in a water bath at 37 ℃ for 1-1.5 hours. Carrying out DNA agar gel electrophoresis separation on the plasmid after enzyme digestion, selecting a band with the size of 2,700bp, tapping and recovering, and placing the recovered linear pUTT plasmid at the temperature of-20 ℃ for later use.

Respectively amplifying an eseB promoter (an amplified suicide Edwardsiella fish genome) and a luciferase Gene (luxAB), carrying out DNA gel electrophoresis, respectively mixing an eseB promoter fragment/luxAB fragment and a linearized pUTT vector after enzyme digestion according to the mole number of 3:1, adding ITA Mix (Gibson assembly, Gene Company Limited), carrying out water bath at 50 ℃ for 1 hour, transferring into DH5 alpha lambda pir, coating carbenicillin LB agar plate, putting the plate into a 37 ℃ incubator for overnight culture, selecting 12-24 monoclones, inoculating LB, 37 ℃, 200rpm and 2-5 hours, verifying by using a universal primer pUTT-F/pUTT-R, inoculating the positive clone into fresh LB, carrying out verification at 37 ℃, 200rpm, overnight extracting plasmids, and sequencing to obtain pUTT-P _eseB -luxAB.

(3) Construction of esrC ^R38G, esrC ^H39G and esrC ^F43G

The esrC point mutation complementation strain was constructed as in (2). Primers EsrC-R38G-R/EsrC-R38G-F, EsrC-H39G-R/EsrC-H39G-F, EsrC-F43G-R/EsrC-F43G-F are designed, and a point mutation fragment is amplified and cloned to a pUTT carrier. After obtaining the point mutation plasmid, transferring the point mutation plasmid into delta esrC to construct a point mutation strain.

(4) Luciferase assay

The method comprises the following steps of inoculating glycerol bacteria into a fresh LB liquid culture medium, culturing at 37 ℃ and 200rpm overnight, inoculating the strain into a DMEM culture medium according to the bacterial quantity of 1% OD ₆₀₀, standing and culturing at 28 ℃, adding 200 mu l of bacterial liquid into a 96-well plate which is completely covered by black edges at different time points, repeating three groups of operations for each sample, measuring the OD ₆₀₀ light absorption value of the 96-well plate by using a Microplate Reader (Bio-Tek), and adding 40 mu l of 1% decanal (dissolved in pure alcohol) serving as a substrate by using a chemiluminescence instrument (Microplate Luminometer) to measure the luciferase expression quantity.

(5) Immunoblot hybridization (Western blotting)

And (5) taking down the adhesive tape after electrophoresis is finished, and soaking the adhesive tape in an electrotransformation buffer solution. And cutting the PVDF membrane and the filter paper with corresponding sizes according to the size of the adhesive tape of the target area, and sequentially soaking the PVDF membrane in absolute methanol for 15-30s, in deionized water for 2min and in an electrotransfer buffer solution for more than 5 min. The electric rotary device is sequentially paved according to the sequence of a negative black carbon plate, fibers, 2 layers of filter paper, albumin glue, a PVDF film, 2 layers of filter paper, fibers and a positive white carbon plate. The electrotransfer process is carried out in an ice-water bath, the voltage is 100V, and the electrotransfer time (min) is approximately 2 times of the molecular weight (kDa) value of the target protein. And (3) after the electro-transformation is finished, taking down the PVDF membrane to seal in a sealing solution for 1-2 h at 75rpm and 37 ℃. Diluting EseB and DnaK antibodies with a blocking solution according to the ratio of 1:1000, transferring the PVDF membrane into a primary antibody dilution solution, and incubating overnight at 4 ℃ or blocking for 2-3 h at 37 ℃ at 75 rpm. PVDF membrane was washed with PBST, rinsed at 37 ℃ for 10min at 75rpm, and repeated 3 times. Diluting goat-anti-mouse or goat-anti-rabbit secondary antibody with a confining liquid according to a ratio of 1:2000, transferring the PVDF membrane into the secondary antibody diluent, and incubating for 1.5-2 h at 75rpm and 37 ℃. PVDF membrane was washed 3 times with PBST, 10min each time. And dripping developing solution, exposing, and taking a picture by using a chemiluminescence instrument.

(6) EsrC protein expression purification

EsrC was cloned into the BamHI/XhoI site of pET28b-HisSUMO to yield pET28 b-HisSUMO-EsrC.

The expression strain pET28b-HisSUMO-EsrC is cultured in 50ml LB culture medium overnight, and then secondary seeds are inoculated, and the secondary seeds are shaken until OD is about 0.6-0.8, and then 0.2mM IPTG is added for induction, and induction is carried out at 25 ℃ for 12-18 hours.

Preparation of the cells before disruption: centrifuging the bacterium solution at a high speed of 5000g for 30min, cleaning and resuspending the bacterium precipitate by PBS, putting the bacterium precipitate into a 50ml centrifuge tube, centrifuging the bacterium solution for 15min at a speed of 5000g, and discarding the supernatant. The cells were resuspended in buffer (20mM Tris pH 9.0, 1mM EDTA, 500mM NaCl) and reselected until the cells were uniformly dispersed without clumping.

High-pressure crushing: the instrument was pre-cooled to below 10 ℃ before disruption. And (3) breaking the bacteria for 3-5 times at 800-900bar until the bacteria liquid is in a semitransparent state. Centrifuging at 13000g for 30min at 4 deg.C by using a high pressure resistant centrifuge tube, and placing the supernatant on ice for later use. And separating and purifying the protein sample by using a Ni column to obtain the purified fusion protein HisSUMO-EsrC. ULP1 was added to the fusion protein to cleave the HisSUMO protein tag. And (4) passing the protein mixture after enzyme digestion through a Ni column again, and separating to obtain single EsrC protein.

(7) Gel migration retardation assay (EMSA)

taking 5 × TBE buffer solution, diluting ten times with ultrapure water to obtain 0.5 × TBE buffer solution, performing 120V pre-electrophoresis for 1-2 h, and blowing holes to remove broken rubber blocks after pre-electrophoresis. Reaction system 20. mu.l: 10ng of promoter fragment, 250ng of poly (dI-dC), gradient concentration protein, protein buffer make-up 20. mu.l. The system is reacted for 30min at 25 ℃ and then loaded. Electrophoresis was performed for 2h at 100V in an ice-water bath. After the electrophoresis, pictures were taken by scanning with Typhoon FLA 9500.

(8) Toxicity test of Zebra fish

EIB202 wild strain and Δ esrC were inoculated in LB medium, overnight, and secondary inoculated in DMEM, and cultured at 28 ℃ under static conditions. The cells were collected by centrifugation at 5000g for 4min, washed 3 times with sterile PBS, and diluted to 100 CFU/. mu.l each. 5 μ l of diluted bacterial suspension was injected intramuscularly to each fish, while zebrafish injected with 5 μ l PBS per tail muscle was used as a control. Each group is provided with 15 fishes. And observing and recording the morbidity and the mortality of the experimental group and the control group 12h after the challenge, and timely cleaning dead fish and changing water. And finally, counting the survival and death conditions of each group of fishes, and plotting survival.

Example 1 demonstration that UFA can inhibit EsrC binding to DNA

1. Luciferase level assay to determine the Effect of Long-chain unsaturated fatty acid treatment on T3SS

The constructed luciferase plasmid pUTT-P _eseB -luxAB is transferred into Edwardsiella piscicola wild type strain (WT) to be used as a report strain.

The strain is cultured in a culture medium, palmitic acid (palmitate), palmitoleic acid (palmitate), oleic acid (oletate) and stearic acid (stearate) are added into the culture medium at different concentrations (0.025%, 0.050%, 0.100%; percentages are mass ratio) respectively, and the expression level of luciferase is detected after culturing for 12 h. As a negative control, pUTT-luxAB was transferred to WT.

The results are shown in fig. 1A, and it can be seen that there was a significant decrease in luciferase expression levels given to palmitoleic acid or oleic acid treated bacterial cultures, indicating that palmitoleic acid or oleic acid significantly inhibited T3SS expression.

2. Immunoblot hybridization to determine the Effect of Long-chain unsaturated fatty acid treatment on EseB expression levels

Wild type Edwardsiella E.pisciida EIB202 was cultured in DMEM medium, and different concentrations of palmitic acid (final concentration 0.100%), palmitoleic acid (final concentration 0.100%), oleic acid (final concentration 0.100%), and stearic acid (final concentration 0.100%) were added to the medium, and pUTT-luxAB was transferred to WT as a negative control. After 24h of culture, the cells were collected and immunoblotted with anti-EseB antibody and anti-DnaK antibody (internal control). Anti-DnaK was used as an internal control.

As shown in fig. 1B, the results show that levels of EseB were significantly reduced given palmitoleic acid or oleic acid treated cell cultures. EseB is a major element protein of T3SS and can reflect the expression level of T3 SS. Thus, palmitoleic acid or oleic acid was shown to be able to very significantly affect the virulence associated system, the type three secretion system (T3SS) necessary for edwardsiella to infect the host.

3. Gel migration blocking assay (EMSA) to verify the effect of UFA on EsrC binding to DNA

The inventors constructed protein expression strains (esrC ^R38G, esrC ^F43G) with wild-type esrC and mutants thereof, esrC ^R38G, and esrC ^F43G, and performed EMSA experiments by co-incubation of esrC protein and Cy5 fluorescently-labeled esrB promoter DNA.

The results are shown in fig. 1C, where EsrC can normally bind DNA without the addition of oleic acid-when UFA (including palmitoleic acid or oleic acid, at concentrations of 0.01% (mass ratio), respectively) was added to affect the binding of EsrC to DNA, but the EsrC point muteins EsrC ^F43G and EsrC ^R38G were not affected by fatty acids.

4. Immunoblot hybridization to determine the Effect of Long-chain unsaturated fatty acid treatment on EsrC ^R38G

The inventor constructs wild type and EsrC mutant Edwardsiella strains esrC ^R38G, esrC ^H39G and esrC ^F43G, point mutation anaplerosis strains are respectively cultured in DMEM medium with or without oleic acid (0.100% of final concentration), thalli are collected after 24h of culture, immunoblot hybridization is carried out by using Anti-EseB antibody and Anti-DnaK antibody (internal reference), and Anti-DnaK is used as the internal reference.

As shown in fig. 1D, the results showed that the levels of EseB were significantly reduced with oleic acid-treated wild-type cell cultures, that esrC ^F43G strain did not express EseB with or without oleic acid, and that esrC ^R38G strain expressed EseB, which is the major element protein of T3SS, with or without oleic acid, reflecting the expression level of T3SS, thus indicating that esrC ^R38G was not affected by fatty acids.

5. Fatty acid and EsrC interaction

The interaction between fatty acid and EsrC is simulated by the simulation of software by the inventor, and as shown in FIG. 1E, the interaction sites of the fatty acid and the EsrC exist at ARG-38 and PHE-43 of EsrC protein and are also interaction sites.

Example 2 validation of animal level

1. Validity verification for turbot

Injecting PBS, Edwardsiella mixed BSA (WT + BSA), Edwardsiella mixed unsaturated fatty acid (WT + UFA) and Edwardsiella esrC deletion strain (delta esrC) into the abdominal cavity of the turbot, and continuously observing and recording the death condition of the turbot at 15 tails of each group.

Edwardsiella is diluted to 10 ⁴ CFU/ml with PBS, and 100. mu.M UFA (stock solution: 10mM UFA dissolved in 5% BSA in PBS) and 0.05% BSA are mixed, respectively, followed by injection of 100. mu.l into the abdominal cavity of a healthy turbot weighing 30. + -.3 g.

Animal toxicity experiments prove that the death number of turbots injected with 100 mu M UFA is obviously less than that of a control group. This data demonstrates that UFA can significantly protect the host from the poisoning by edwardsiella.

As a result, as shown in FIG. 2, administration of wild type Edwardsiella to turbot resulted in massive death of fish in a short period of time, survival of fish to which Edwardsiella delbrueckii esrC-deficient strain (. DELTA.esrC) was administered was good, and survival of fish to which wild type Edwardsiella and UFA was administered was also good. Compared with the turbot without UFA, the mortality of the injected turbot with UFA is lower than 20%, which shows that UFA can effectively protect the turbot from being poisoned by Edwardsiella.

In addition to oleic acid, applicants also applied palmitoleic acid to turbot at the same working concentration, replacing oleic acid, and as a result produced the same effect as oleic acid.

Therefore, the UFA can effectively close the virulence expression of the Edwardsiella, so that the Edwardsiella loses the capability of infecting a host, and the fish is remarkably protected from being damaged by the Edwardsiella.

2. Validation of zebrafish

Injecting PBS, Edwardsiella mixed BSA (WT + BSA), Edwardsiella mixed unsaturated fatty acid (WT + UFA) and Edwardsiella esrC deletion strain (delta esrC) into zebrafish (zebrafish weighing 0.5-1g), wherein the working concentration of UFA (oleic acid) is 100 mu M. The death of zebrafish was recorded. An injection amount of 500CFU bacteria; unsaturated Fatty Acids (UFA) were pre-dissolved in 5% BSA in PBS.

As a result, as shown in fig. 3, the wild type edwardsiella administered to zebrafish resulted in massive death of the fish in a short period of time, the survival of the fish administered with the edwardsiella deletion strain (Δ esrC) was good, and the survival of the fish administered with wild type edwardsiella and UFA was also good.

In addition to oleic acid, applicants also applied palmitoleic acid to zebrafish at the same working concentration, replacing oleic acid, and as a result produced the same effect as oleic acid.

Thus, UFA very significantly protected fish from edwardsiella.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> university of east China's college of science

Application of <120> long-chain unsaturated fatty acid in preparation of composition for preventing Edwardsiella

<130> 182512

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 49

<212> DNA

<213> primers (Primer)

<400> 1

cccccccgag ctcaggttac ccggatctat gctgctggag ggcatcagc 49

<210> 2

<211> 30

<212> DNA

<213> primers (Primer)

<400> 2

accgtgttta catgaggtgc tcctgactga 30

<210> 3

<211> 29

<212> DNA

<213> primers (Primer)

<400> 3

gcacctcatg taaacacggt aaggagcct 29

<210> 4

<211> 50

<212> DNA

<213> primers (Primer)

<400> 4

gagtacgcgt cactagtggg gcccttctag agtccgaaga gcagaatggc 50

<210> 5

<211> 20

<212> DNA

<213> primers (Primer)

<400> 5

ctagaagggc cccactagtg 20

<210> 6

<211> 21

<212> DNA

<213> primers (Primer)

<400> 6

atagatccgg gtaacctgag c 21

<210> 7

<211> 20

<212> DNA

<213> primers (Primer)

<400> 7

ccatcgacgg cgattttcag 20

<210> 8

<211> 20

<212> DNA

<213> primers (Primer)

<400> 8

cctgcggcgc gttcatcagg 20

<210> 9

<211> 19

<212> DNA

<213> primers (Primer)

<400> 9

ccagacaaca tcgcgctcc 19

<210> 10

<211> 19

<212> DNA

<213> primers (Primer)

<400> 10

gcagtagcca gcgtttcgg 19

<210> 11

<211> 21

<212> DNA

<213> primers (Primer)

<400> 11

gccgagtatg accggtcgac g 21

<210> 12

<211> 21

<212> DNA

<213> primers (Primer)

<400> 12

cgtcgaccgg tcatactcgg c 21

<210> 13

<211> 21

<212> DNA

<213> primers (Primer)

<400> 13

gccgagtacc ccgggtcgac g 21

<210> 14

<211> 21

<212> DNA

<213> primers (Primer)

<400> 14

cgtcgacccg gggtactcgg c 21

<210> 15

<211> 22

<212> DNA

<213> primers (Primer)

<400> 15

cacggatagc tacctagccg ag 22

Claims

1. Use of a long chain unsaturated fatty acid for the preparation of a composition for inhibiting edwardsiella infection of a host; the long-chain unsaturated fatty acid comprises: oleic acid, or palmitoleic acid.

2. Use of long chain unsaturated fatty acids for the preparation of a composition for the prevention of edwardsiella infection in fish; the long-chain unsaturated fatty acid comprises: oleic acid, or palmitoleic acid.

3. Use according to claim 1 or 2, wherein the composition is a medicament, food or feed.

4. The use according to claim 2, wherein the fish is a fish that hosts edwardsiella.

5. The use as claimed in claim 4, wherein said fish comprises: fish of the order flounders, carpiformes, Perciformes; preferably, it comprises: turbot of flounder family, zebrafish of carp family, catfish, eel, flounder, salmon, tilapia, etc.

6. The use according to claim 1 or 2, wherein the Edwardsiella sp.piscicida, Edwardsiella tarda, Edwardsiella ictaluri (Edwardsiella ictaluri) is Edwardsiella ictaluri.

7. A method of inhibiting infection of a host by edwardsiella, the method comprising: treating or culturing Edwardsiella with long chain unsaturated fatty acid; the long-chain unsaturated fatty acid comprises: oleic acid, or palmitoleic acid.

8. The method of claim 7, wherein the long chain unsaturated fatty acid reduces the ability of the EsrC to infect or colonize a host by binding to the EsrC such that the ability of the three-type and six-type secretion systems in the EsrC kinase is reduced or inhibited.

9. A composition for inhibiting edwardsiella infection in a host, said composition comprising a long chain unsaturated fatty acid, and a dietetic or pharmaceutically acceptable carrier or excipient; in the composition, the content of the long-chain unsaturated fatty acid is 20-200 mu M.

10. The composition of claim 9, wherein the dietetic or pharmaceutically acceptable carrier or excipient comprises BSA.