CN110527683A - A kind of Epinephelus coioides IRF10 gene promoter and preparation method - Google Patents

A kind of Epinephelus coioides IRF10 gene promoter and preparation method Download PDF

Info

Publication number
CN110527683A
CN110527683A CN201910654746.7A CN201910654746A CN110527683A CN 110527683 A CN110527683 A CN 110527683A CN 201910654746 A CN201910654746 A CN 201910654746A CN 110527683 A CN110527683 A CN 110527683A
Authority
CN
China
Prior art keywords
promoter
nucleotide sequence
irf10
seq
epinephelus coioides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910654746.7A
Other languages
Chinese (zh)
Inventor
黄贝
王志轩
李文星
张楚
梁英
黄文树
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jimei University
Original Assignee
Jimei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jimei University filed Critical Jimei University
Priority to CN201910654746.7A priority Critical patent/CN110527683A/en
Publication of CN110527683A publication Critical patent/CN110527683A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of Epinephelus coioides IRF10 gene promoter and preparation methods.The promoter contains the nucleotide sequence selected from following any one group and with promoter function: nucleotide sequence shown in a, Seq ID No.1；B, the nucleotide sequence complementary with Seq ID No.1；It c, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b under the conditions of high stringency；D, substitution, the missing, addition modified nucleotide sequence of one or more bases are carried out to nucleotide sequence shown in above-mentioned a or b；E, there is the nucleotide sequence of at least 90% identity with nucleotide sequence shown in above-mentioned a or b.The promoter can be applied in the expression regulation mechanism experiment system of building Epinephelus coioides IRF10 gene.

Description

A kind of Epinephelus coioides IRF10 gene promoter and preparation method
Technical field
The present invention relates to genetic engineering field more particularly to a kind of Epinephelus coioides IRF10 gene promoter and preparation sides Method.
Background technique
Interferon regulatory factor (Interferon regulatory factors, IRFs) is a kind of multi-functional transcription The factor, controllable interferon (Interferon, IFN) and interferon stimulation responses gene (Interferon-stimulated Gene, ISG) expression, body disease-resistant is malicious, antitumor, cell Proliferation and in terms of play an important role (Hiscott J.,Convergence of the NF-κB and IRF pathways in the regulation of the innate antiviral response.Cytokine&Growth Factor Reviews 2007,18(5-6): 483-490.).Existing report shows to have been found that 11 IRF family members, i.e. IRF1-11 in bony fish.According to being IRF points can be 4 subfamilies: IRF1 subfamily (IRF1, IRF2, IRF11), IRF3 subfamily by evolutionary analysis result of uniting (IRF3 and IRF7), IRF4 subfamily (IRF4, IRF8, IRF9, IRF10), there are also IRF5 subfamily (IRF5 and IRF6) (Huang B,Qi ZT,Xu Z,et al.,Global characterization of interferon regulatory factor(IRF) genes in vertebrates:Glimpse of the diversification in evolution.BMC Immunology 2010,11(1):22.).Eukaryotic gene transcription is by multi-level accurate tune Control, promoter and its cis-acting elements for being included directly affect the transcriptional expression of gene.
Summary of the invention
The purpose of the present invention is to provide a kind of Epinephelus coioides IRF10 gene with promoter function.
To achieve the above object, the present invention provides a kind of Epinephelus coioides IRF10 gene promoter, which is characterized in that institute It states promoter and contains the nucleotide sequence selected from following any one group and with promoter function:
A, nucleotide sequence shown in Seq ID No.1；
B, the nucleotide sequence complementary with Seq ID No.1；
It c, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b under the conditions of high stringency；
D, the core that substitution, missing, the addition for carrying out one or more bases to nucleotide sequence shown in above-mentioned a or b are modified Nucleotide sequence；
E, there is the nucleotide sequence of at least 90% identity with nucleotide sequence shown in above-mentioned a or b.
The present invention also provides a kind of nucleic acid constructs, comprising the promoter, the gene being operatively connected with promoter Sequence, wherein the promoter and the gene order source are same or different.
The present invention also provides a kind of carriers, it is characterised in that: the carrier contains the promoter or the nucleic acid Construct；Preferably, the carrier be the promoter or the nucleic acid construct with pGL3-Basic plasmid through recombinating Obtained recombinant vector.
The present invention also provides a kind of recombinant cells, it is characterised in that: the cell contains the promoter or described Nucleic acid construct or the carrier, it is preferred that the recombinant cell is EPC cell.
The present invention also provides one group of primer pair, the primer pair, which is used to expand, obtains the promoter, it is characterised in that: The sequence of the primer pair is shown in the sequence of SEQ ID NO:2-5.
Further, including
Using Epinephelus coioides genomic DNA as template, expanded using three pairs of amplimers, the amplimer according to SEQ ID NO:1 is directed to head and the tail in the sequence of Epinephelus coioides genomic DNA respectively and is designed, preferably the primer It is right.
The present invention also protects the promoter or the nucleic acid construct or the carrier or the recombination Cell is for regulating and controlling the purposes of luciferase.
The present invention has cloned Epinephelus coioides IRF10 gene promoter using chromosome walking technology, provides angled tape stone Spot fish IRF10 gene promoter sequence；It is reported that genetic analysis is the experiment proves that Epinephelus coioides IRF10 gene promoter It can be by intracellular and extracellular poly I:C induced activation；Three angled tape are identified through site-directed mutagenesis technique and reporter gene assays Grouper IRF10 gene transcription regulation core element；Therefore, the clone of Epinephelus coioides IRF10 gene promoter and its core The identification of heart controlling element theoretically provides the molecular regulation mechanism to study Epinephelus coioides IRF10 gene expression good Good experimental system, it is upper to construct carrier for expression of eukaryon efficiently expressing exogenous gene using the promoter or by the starting in application Son is applied to genetically engineered fish building and creates condition, and has important theoretical and practical significance.
The clone of the Epinephelus coioides IRF10 gene promoter and its identification of promoter core controlling element, can be It constructs and is applied in the expression regulation mechanism experiment system of Epinephelus coioides IRF10 gene.
Detailed description of the invention
Fig. 1 is the position view of three Binding site for transcription factor in SEQ ID NO:1 sequence of the present invention.
Fig. 2 is the schematic diagram of Epinephelus coioides IRF10 gene promoter core controlling element of the present invention.
Fig. 3 is living using the promoter of luciferase reporter gene detection system analysis Epinephelus coioides IRF10 gene Property figure.
Fig. 4 is the starting of Epinephelus coioides IRF10 gene after poly I:C and extracellular poly I:C stimulation in the cell The active variation diagram of son.
After ISRE1, ISRE2 and STAT controlling element mutation that Fig. 5 is recombinant plasmid EcIRF10pro-pGL3, into the cell The variation diagram of the promoter activity of poly I:C stimulation front and back Epinephelus coioides IRF10 gene.
After ISRE1, ISRE2 and STAT controlling element mutation that Fig. 6 is recombinant plasmid EcIRF10pro-pGL3, extracellularly The variation diagram of the promoter activity of poly I:C stimulation front and back Epinephelus coioides IRF10 gene.
Specific embodiment
The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings, wherein from beginning to end Same or similar label indicates same or similar element or element with the same or similar functions.Below with reference to attached The embodiment of figure description is exemplary, it is intended to is used to explain the present invention, and is not considered as limiting the invention.Embodiment In particular technique or condition person is not specified, described technology or conditions or according to the description of product according to the literature in the art Book carries out.Reagents or instruments used without specified manufacturer, being can be with conventional products that are commercially available.
Embodiment 1: the clone of Epinephelus coioides IRF10 gene promoter
The extraction of 1.1 Epinephelus coioides (market purchase) genomic DNA is provided referring to " Molecular Cloning:A Laboratory guide three " Phenol-chloroform method for extracting detects Epinephelus coioides genomic DNA quality with 0.6% agarose gel electrophoresis.Design three Specific primer:
SP1:5`-TGTTTCCTCTAATCTACGACGGGAC-3` SEQ ID NO:2；
SP2:5`-GACAGAGCAGCACAAAGATAGCTGG-3` SEQ ID NO:3；
SP3:5`-CAGTGTCGACCTTGAAGAGAGCTGC-3` SEQ ID NO:4；
AP1:5`-GTAATACGACTCACTATAGGGC-3` SEQ ID NO:5；
The Genome Walking Kit specification of 1.2 reference Takara companies, is amplified using the reaction of three-wheel nest-type PRC Epinephelus coioides IRF10 gene promoter sequence, the specific steps are as follows:
1. first round nested PCR reaction system:
PCR program is shown in Table 1.
1 PCR program list of table
2. second wheel nest-type PRC using first round PCR product as template, using AP1Primer and specific primer SP2 into Row, other ingredients and system are identical as the first round.PCR program is shown in Table 2.
2 PCR program list of table
3. third round nest-type PRC using second wheel PCR product as template, using AP1Primer and specific primer SP3 into Row, other ingredients, system and program are identical as the second wheel.
4. taking 5 μ L of third round PCR reaction product, electrophoresis is carried out using 1% Ago-Gel, clearly electrophoresis is recycled in cutting Recovery product is connected on pMD-19T (TaKaRa) carrier by band, thermal transition to Escherichia coli Escherichia coli In DH5 α competence, (Xiamen Bo Rui biotechnology company, below herewith) is sequenced after PCR detects positive colony, sequencing knot Fruit is as shown in SEQ ID NO:1:
TCACTGACTCCTATGAGGGGAATGAAAAGAGAATTTTCCATTAAAATATATATAATATATA TATATA TATATTTTAGCAGTTAGAGGACTATAAAAGTTGGCTGTCATTCCTTTTGTTTGCT TTTGATGATTTAGTATTTTC ATATATTGTGAGCAATGTTTATTTAGGAGGCTGGGTGATGA TAAGAGATGAAGATTCGCCTTCTGACAAATGTGA CCTTAACATGACTTTTGCAGGTTAC TCGAGTATCCACATGTCCTTATCACTCACAGACAATCTGTAAGGGATCCA GTGACCTGC TCGTTTATGACCCCCCCCCCCACACCTTACTTGGAAATGATTAAACTTTCGCAGCAGCT CAGCAC ACAGGAGGAAACCGAAAGTATCAAATGAGCTCAAAACTTTCGCTTTCACTTC CAAGAGCGCAACATAACCTTAGT TACGACTTCTGCATTTAACTTTGGCGTCCGTTTCTGT ACAACTTTCTTTTCTTATATATATAAACTGCATTATTT TATATGGCTTCAACATAATAATTC AACTCAGCCTAGGAGCGTCACCTGCGTCAGAATAATATACAGATTTATTTT CTCGCTCAT CAGGTAGGTGTGATTACATAGTGCTCGAGCCACTGTGCACATGCATGGCTGACATTTGA AAGTGA GGGTTTTGTTCCTGTAAGAGAGACTCGGTCTGTGCTGAAG。
The functional verification of 2. Epinephelus coioides IRF10 gene promoter of embodiment is tested
The building of 2.2 Epinephelus coioides IRF10 gene promoter reporter genes
2.2.1 utilizingDatabase analyzes the SEQ ID NO:1 sequence of above-mentioned acquisition, finds IRF10 There are two IFN-stimulated response element (Interferon-stimulated in the segment of promoter region (- 686/+19) Response element, ISRE) (NGAAANNGAAA) and a STAT binding site, three Binding site for transcription factor Fig. 1 is seen in position.
2.2.2 the building of Epinephelus coioides IRF10 promoter reporter plasmid EcIRF10pro-pGL3
The gene promoter area Epinephelus coioides IRF10 segment is cloned into Promega company luciferase reporter gene report In the multiple cloning sites for accusing plasmid pGL3-Basic, make the expression of IRF10 promoter regulation firefly luciferase gene, structure It builds to obtain recombinant plasmid and is named as EcIRF10pro-pGL3.
Specific steps are as follows:
1. primer；
Forward primer Ec-IRF10-pro-F with Kpn I restriction enzyme site:
5`-GGGGTACCTCACTGACTCCTATGAG-3`, SEQ ID NO:6；
Reverse primer Ec-IRF10-pro-R with Hind III digestion site:
5`-CCCAAGCTTCTTCAGCACAGACCGAG-3`, SEQ ID NO:7.
2. the Ex Taq polymerase using Takara company carries out PCR amplification.
PCR reaction system is shown in Table 3.
3 PCR reaction system table of table
PCR program is shown in Table 4.
4 PCR program list of table
PCR amplification product obtained is purified after agarose gel electrophoresis with gel DNA QIAquick Gel Extraction Kit (Omega).
3. DNA fragmentation after purification is carried out Kpn I/Hind III double digestion, digestion with pGL-3Basic carrier respectively System are as follows: digestion system is shown in Table 5.
5 digestion system table of table
10×M buffer 2μL
Kpn I 1μL
Hind I 1μL
PGL-3Basic/PCR product 1μg
Distilled water It mends to 20 μ L
37 DEG C water-bath digestion 4 hours.
4. the PCR product by Kpn I/Hind III double digestion is separately recovered using gel reclaims kit (Omega) With pGL-3Basic carrier, PCR product and pGL-3Basic load through double digestion are connected using 4 ligase of Takara company's T Body, linked system are shown in Table 6.
6 linked system table of table
10×T4DNA Ligase Buffer 1μL
T4DNA Ligase I 1μL
PCR product after double digestion 20ng
PGL-3Basic after double digestion 100ng
Distilled water It mends to 10 μ L
16 DEG C of connections are overnight.
5. connection product is transformed into Escherichia coli DH5 α competence, surveyed after PCR detects positive colony Sequence verifying, sequence is correctly recombinant plasmid EcIRF10pro-pGL3.
3. the activity analysis of Epinephelus coioides IRF10 gene promoter
The mutation in 3.1 Epinephelus coioides IRF10 gene promoter key regulatory sites
Overlapping extension (Higuchi et al.1988, the Ho et provided referring to " Molecular Cloning:A Laboratory guide three " Al.1989 point mutation) is carried out, mutant primer is designed, is expanded using regular-PCR method and obtains target fragment, by target fragment enzyme It is inserted into after cutting between the site Kpn I and Hind III of pGL-3Basic.
EcIRF10pro-ISRE1-F GCACACAGGAGGTTACCGTTAGTATCAAATGAGC；SEQ ID NO:8；
EcIRF10pro-ISRE1-R GCTCATTTGATACTAACGGTAACCTCCTGTGTGC；SEQ ID NO:9；
EcIRF10pro-ISRE2-F CTCAAAACTTTCGCTGGCACTGCCAAGAGCGCAAC；SEQ ID NO:10；
EcIRF10pro-ISRE2-R GTTGCGCTCTTGGCAGTGCCAGCGAAAGTTTTGAG；SEQ ID NO:11；
EcIRF10pro-STAT-F GAAAGTGAGGGTTAAGGACCAGGTAGAGAGACTCG；SEQ ID NO:12；
EcIRF10pro-STAT-R CGAGTCTCTCTACCTGGTCCTTAACCCTCACTTTC；SEQ ID NO:13.
Wherein the sequence that point mutation obtains is carried out through EcIRF10pro-ISRE1-F and EcIRF10pro-ISRE1-R to be known as muISRE1；The sequence that point mutation obtains is carried out through EcIRF10pro-ISRE2-F and EcIRF10pro-ISRE2-R to be known as muISRE2；The sequence that point mutation obtains is carried out through EcIRF10pro-STAT-F and EcIRF10pro-STAT-R to be known as muSTAT。
PCR reaction system, program and the same 2.2.2 of carrier construction method.Mutational site schematic diagram is shown in that Fig. 2, Fig. 2 are described Epinephelus coioides IRF10 gene promoter core controlling element, respectively ISRE1, ISRE2 and STAT.Marked number above box Word is position of the controlling element relative to translation initiation site ATG.Black matrix white alphabet shows the base for carrying out point mutation, diagram After base mutation, utilizeDatabase carries out predicting to determine that the position will not generate new controlling element.Wherein The wild-type promoters sequence that wtEcERT10pro refers to, i.e., the promoter sequence not being mutated.
3.2 analyze the basis of Epinephelus coioides IRF10 gene promoter using luciferase reporter gene detection system Activity
1. the recombinant vector that 3.1 steps obtain is sequenced, correct bacterium solution is sequenced and expands overnight incubation, reference Endo-Free Plasmid Midi Kit (Omega) specification, extracts Plasmid DNA endotoxin-free.
2. EPC cell culture is in (Gibco) containing 10%FBS, MEM (Hyclone) culture medium of 2%AP-SP (Hyclone) In.Take the good EPC cell inoculation of growth conditions in 24 orifice plates, every hole 1 × 106A cell, 25 DEG C of overnight incubations.
3. old culture medium is discarded when cell density reaches 80%, be replaced with not antibiotic culture medium.Reference LipofectamineTM3000Transfection Reagent (Invitrogen) specification is transfected, concrete operation step It is as follows:
Use Opti-MEMTM(Gibco) culture medium dilutes LipofectamineTM3000 reagents, mix well；It uses Opti-MEMTMDilution DNA prepares DNA premixed liquid, P3000 is then addedTMReagent mixes well；It is diluted in every pipe LipofectamineTMDiluted DNA (1:1 volume ratio) is added in 3000 reagents；It is incubated at room temperature 15min, DNA- rouge is added Liposome complex is into cell.Every hole institute's transfected plasmids include 0.025 μ g pRL-TK (Promega) and 0.25 μ g EcIRF10 promoter plasmid (i.e. recombinant plasmid EcIRF10pro-pGL3) or its point mutation plasmid (recombination that 3.1 steps obtain Carrier) or pGL-3Basic empty carrier, culture medium is replaced after transfecting 6 hours, continues culture 18 hours.
4. the detection of uciferase activity refers toReporter Assay System(Promega) Specification, concrete operations are as follows:
In 24 orifice plates, cell culture medium is sucked out, 500 μ L PBS rinsing is added once, exhaust PBS；100 μ L are added in every hole 1 × PLB cell pyrolysis liquid, room temperature shake 10min, draw 20 μ L lysate supernatants and are added in 1.5mL EP pipe；100 μ are added L Luciferase Assay Reagent LAR II, after mixing, with Junior LB9509 tubular type luminometer (Berthold, moral State) detection firefly luciferase value, take out 1.5mL EP pipe, be rapidly added 100 μ L Stop&Reagent, mixing are equal It is even, with the value of instrument detection sea cucumber luciferase.The relative luciferase activity use (value of firefly luciferase) in every hole/ (value of sea cucumber luciferase) indicates.To transfect the EPC cell of empty carrier pGL-3Basic as control, the promoter is calculated As a result relative activity is shown in Fig. 3.Fig. 3 is to analyze Epinephelus coioides IRF10 base using luciferase reporter gene detection system The promoter activity of cause.Abscissa pGL-3 indicates the relative luciferase activity of empty carrier pGL3-Basic transfection EPC cell (as control)；WtIRF10pro is the relative luciferase activity that recombinant plasmid EcIRF10pro-pGL3 transfects EPC cell； MuISRE1, muISRE2 and muSTAT are respectively ISRE1, ISRE2 and STAT tune to recombinant plasmid EcIRF10pro-pGL3 After controlling element mutations, the relative luciferase activity of EPC cell is transfected.It can be seen that recombinant plasmid EcIRF10pro- PGL3 transfects 3.7 times that the relative luciferase activity of EPC cell transfects EPC cell for empty carrier pGL3-Basic, illustrates Epinephelus coioides IRF10 gene promoter can preferably start the transcription of luciferase gene；STAT controlling element is mutated Afterwards, mutant plasmid muSTAT transfects the relative luciferase activity of EPC cell as recombinant plasmid EcIRF10pro-pGL3 transfection 5.97 times of EPC cell illustrate that the STAT controlling element plays a part of negative regulation during EcIRF10 gene expression.Often A sample does the repetition in three holes.Using the significant difference between double tail T method of inspection experiment with computing groups and control group, * P < 0.05, * P < 0.01 *.
The experiment of 3.3 immunostimulations
Following two scheme is implemented in immunostimulation experiment altogether:
1. by above-mentioned recombinant plasmid EcIRF10pro-pGL3 or its point mutation plasmid and pRL-TK plasmid co-transfection into EPC Cell transfects 1 μ g/mL poly I:C (Sigma company) after 24 hours, collect cell after continuing culture 24 hours.
2. by above-mentioned recombinant plasmid EcIRF10pro-pGL3 or its point mutation plasmid and pRL-TK plasmid co-transfection into EPC Cell is added poly I:C to 10 μ g/mL in 24 hours in the medium, collects cell after continuing culture 24 hours.
The activity change of Epinephelus coioides IRF10 gene promoter is referring to fig. 4 under poly I:C incentive condition.Fig. 4 is The variation of the promoter activity of Epinephelus coioides IRF10 gene after poly I:C and extracellular poly I:C stimulation in the cell Figure.Abscissa Null indicates that recombinant plasmid EcIRF10pro-pGL3 transfects the opposite of EPC cell when no poly I:C stimulation Uciferase activity (as control)；Intracellular poly I:C recombinates matter after indicating poly I:C stimulation in the cell The relative luciferase activity of grain EcIRF10pro-pGL3 transfection EPC cell；Extracellular poly I:C is indicated The relative luciferase activity of recombinant plasmid EcIRF10pro-pGL3 transfection EPC cell after extracellular poly I:C stimulation.It can be with Find out, after intracellular poly I:C stimulation, recombinant plasmid EcIRF10pro-pGL3 transfects the relative fluorescence element enzyme activity of EPC cell Property for do not stimulate when 22.16 times；After extracellular poly I:C stimulation, recombinant plasmid EcIRF10pro-pGL3 transfects EPC cell Relative luciferase activity be 13.32 times when not stimulating.Illustrate intracellular poly I:C stimulation and extracellular poly I:C Stimulation can induce the enhancing of the promoter activity of Epinephelus coioides IRF10 gene, Epinephelus coioides IRF10 gene promoter It can be by intracellular and extracellular poly I:C induced activation.Each sample does the repetition in three holes.It is calculated using double tail T methods of inspection real Test the significant difference between group and control group, P < 0.01 * P < 0.05, * *.
After Binding site for transcription factor mutation, the Epinephelus coioides IRF10 gene promoter under poly I:C incentive condition Activity change referring to figs. 5 and 6.Wherein the abscissa wtIRF10pro of Fig. 5 is expressed as intracellular poly I:C stimulation front and back The relative luciferase activity of recombinant plasmid EcIRF10pro-pGL3 transfection EPC cell；MuISRE1, muISRE2 and muSTAT After being respectively mutated to ISRE1, ISRE2 and STAT controlling element of recombinant plasmid EcIRF10pro-pGL3, EPC is transfected The relative luciferase activity of cell.As can be seen that after intracellular poly I:C stimulation, muISRE1 and muISRE2 and recombination Plasmid EcIRF10pro-pGL3 decreased significantly compared to its relative luciferase activity for transfecting EPC cell, illustrate ISRE1 Play a part of just regulating and controlling during regulating and controlling Epinephelus coioides IRF10 gene expression with ISRE2 controlling element；MuSTAT with Recombinant plasmid EcIRF10pro-pGL3 is dramatically increased compared to its relative luciferase activity for transfecting EPC cell, illustrates STAT Controlling element plays a part of negative regulation during regulating and controlling Epinephelus coioides IRF10 gene expression.Each sample does three holes Repetition.Utilize the significant difference between double tail T method of inspection experiment with computing groups and control group, P < 0.01 * P < 0.05, * *.Its The abscissa wtIRF10pro of middle Fig. 6 is expressed as extracellular poly I:C stimulation front and back recombinant plasmid EcIRF10pro-pGL3 and turns Contaminate the relative luciferase activity of EPC cell；MuISRE1, muISRE2 and muSTAT are respectively to recombinant plasmid After ISRE1, ISRE2 and STAT controlling element mutation of EcIRF10pro-pGL3, the relative fluorescence element of EPC cell is transfected Enzymatic activity.As can be seen that after extracellular poly I:C stimulation, muISRE1 and muISRE2 and recombinant plasmid EcIRF10pro- PGL3 decreased significantly compared to its relative luciferase activity for transfecting EPC cell, illustrate ISRE1 and ISRE2 controlling element Play a part of just regulating and controlling during regulating and controlling Epinephelus coioides IRF10 gene expression；MuSTAT and recombinant plasmid EcIRF10pro-pGL3 is dramatically increased compared to its relative luciferase activity for transfecting EPC cell, illustrates STAT controlling element Play a part of negative regulation during regulating and controlling Epinephelus coioides IRF10 gene expression.Each sample does the repetition in three holes.Benefit With the significant difference between double tail T method of inspection experiment with computing groups and control group, P < 0.01 * P < 0.05, * *.Transfecting 1 μ g/ After mL poly I:C stimulation, ISRE1, ISRE2, the relative luciferase activity in STAT point mutation plasmid transfection EPC cell is Wild type EcIRF10pro-pGL3 transfects 0.18 times, 0.34 times and 2.48 times of EPC cell.Poly I is added in the medium: When C to 10 μ g/mL is stimulated, ISRE1, ISRE2, the relative luciferase activity in STAT point mutation plasmid transfection EPC cell is Wild type EcIRF10pro-pGL3 transfects 0.27 times, 0.35 times and 4.5 times of EPC cell.Illustrate that ISRE1 and ISRE2 are regulating and controlling Play a part of just regulating and controlling in IRF10 gene expression, STAT plays a part of negative regulation in regulation IRF10 gene expression.*P< 0.05, * P < 0.01 *.
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example Property, it is not considered as limiting the invention, those skilled in the art are not departing from the principle of the present invention and objective In the case where can make changes, modifications, alterations, and variations to the above described embodiments within the scope of the invention.
。
SEQUENCE LISTING
<110>Collects The American University
<120>a kind of Epinephelus coioides IRF10 gene promoter and preparation method
<130> JMDXC-19013-CNI
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 705
<212> DNA
<213>Epinephelus coioides
<400> 1
tcactgactc ctatgagggg aatgaaaaga gaattttcca ttaaaatata tataatatat 60
atatatatat attttagcag ttagaggact ataaaagttg gctgtcattc cttttgtttg 120
cttttgatga tttagtattt tcatatattg tgagcaatgt ttatttagga ggctgggtga 180
tgataagaga tgaagattcg ccttctgaca aatgtgacct taacatgact tttgcaggtt 240
actcgagtat ccacatgtcc ttatcactca cagacaatct gtaagggatc cagtgacctg 300
ctcgtttatg accccccccc ccacacctta cttggaaatg attaaacttt cgcagcagct 360
cagcacacag gaggaaaccg aaagtatcaa atgagctcaa aactttcgct ttcacttcca 420
agagcgcaac ataaccttag ttacgacttc tgcatttaac tttggcgtcc gtttctgtac 480
aactttcttt tcttatatat ataaactgca ttattttata tggcttcaac ataataattc 540
aactcagcct aggagcgtca cctgcgtcag aataatatac agatttattt tctcgctcat 600
caggtaggtg tgattacata gtgctcgagc cactgtgcac atgcatggct gacatttgaa 660
agtgagggtt ttgttcctgt aagagagact cggtctgtgc tgaag 705
<210> 2
<211> 25
<212> DNA
<213>artificial synthesized
<400> 2
tgtttcctct aatctacgac gggac 25
<210> 3
<211> 25
<212> DNA
<213>artificial synthesized
<400> 3
gacagagcag cacaaagata gctgg 25
<210> 4
<211> 25
<212> DNA
<213>artificial synthesized
<400> 4
cagtgtcgac cttgaagaga gctgc 25
<210> 5
<211> 22
<212> DNA
<213>artificial synthesized
<400> 5
gtaatacgac tcactatagg gc 22
<210> 6
<211> 25
<212> DNA
<213>artificial synthesized
<400> 6
ggggtacctc actgactcct atgag 25
<210> 7
<211> 26
<212> DNA
<213>artificial synthesized
<400> 7
cccaagcttc ttcagcacag accgag 26
<210> 8
<211> 34
<212> DNA
<213>artificial synthesized
<400> 8
gcacacagga ggttaccgtt agtatcaaat gagc 34
<210> 9
<211> 34
<212> DNA
<213>artificial synthesized
<400> 9
gctcatttga tactaacggt aacctcctgt gtgc 34
<210> 10
<211> 35
<212> DNA
<213>artificial synthesized
<400> 10
ctcaaaactt tcgctggcac tgccaagagc gcaac 35
<210> 11
<211> 35
<212> DNA
<213>artificial synthesized
<400> 11
gttgcgctct tggcagtgcc agcgaaagtt ttgag 35
<210> 12
<211> 35
<212> DNA
<213>artificial synthesized
<400> 12
gaaagtgagg gttaaggacc aggtagagag actcg 35
<210> 13
<211> 35
<212> DNA
<213>artificial synthesized
<400> 13
cgagtctctc tacctggtcc ttaaccctca ctttc 35

Claims (7)

1. a kind of Epinephelus coioides IRF10 gene promoter, which is characterized in that the promoter contains selected from following any one group And the nucleotide sequence with promoter function:
A, nucleotide sequence shown in Seq ID No.1；
B, the nucleotide sequence complementary with Seq ID No.1；
It c, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b under the conditions of high stringency；
D, the nucleotide that substitution, missing, the addition for carrying out one or more bases to nucleotide sequence shown in above-mentioned a or b are modified Sequence；
E, there is the nucleotide sequence of at least 90% identity with nucleotide sequence shown in above-mentioned a or b.
2. a kind of nucleic acid construct, comprising promoter described in claim 1, the gene order being operatively connected with promoter, Wherein the promoter and the gene order source are same or different.
3. a kind of carrier, it is characterised in that: the carrier contains promoter described in claim 1 or as claimed in claim 2 Nucleic acid construct；Preferably, the carrier is promoter described in claim 1 or nucleic acid construct as claimed in claim 2 With pGL3-Basic plasmid through recombinating obtained recombinant vector.
4. a kind of recombinant cell, it is characterised in that: the cell contains promoter or claim 2 institute described in claim 1 The nucleic acid construct or carrier as claimed in claim 3 stated, it is preferred that the recombinant cell is EPC cell.
5. one group of primer pair, the primer pair obtains promoter described in claim 1 for expanding, it is characterised in that: described The sequence of primer pair is shown in the sequence of SEQ ID NO:2-5.
6. the method for preparing promoter shown in SEQ ID NO:1, including
Using Epinephelus coioides genomic DNA as template, expanded using three pairs of amplimers, the amplimer is according to SEQ ID NO:1 is directed to head and the tail in the sequence of Epinephelus coioides genomic DNA respectively and is designed, preferably as claimed in claim 6 Primer pair.
7. promoter described in claim 1 or nucleic acid construct as claimed in claim 2 or carrier as claimed in claim 3 Or recombinant cell as claimed in claim 4 is for regulating and controlling the purposes of luciferase.
CN201910654746.7A 2019-07-19 2019-07-19 A kind of Epinephelus coioides IRF10 gene promoter and preparation method Pending CN110527683A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910654746.7A CN110527683A (en) 2019-07-19 2019-07-19 A kind of Epinephelus coioides IRF10 gene promoter and preparation method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910654746.7A CN110527683A (en) 2019-07-19 2019-07-19 A kind of Epinephelus coioides IRF10 gene promoter and preparation method

Publications (1)

Publication Number Publication Date
CN110527683A true CN110527683A (en) 2019-12-03

Family

ID=68660704

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910654746.7A Pending CN110527683A (en) 2019-07-19 2019-07-19 A kind of Epinephelus coioides IRF10 gene promoter and preparation method

Country Status (1)

Country Link
CN (1) CN110527683A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058325A (en) * 2017-06-16 2017-08-18 集美大学 A kind of crocea interferon regulatory factor IRF7 promoters, nucleic acid construct, cell and its production and use
CN107326025A (en) * 2017-06-16 2017-11-07 集美大学 A kind of crocea interferon IFN1 promoters, nucleic acid construct, cell and its production and use

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058325A (en) * 2017-06-16 2017-08-18 集美大学 A kind of crocea interferon regulatory factor IRF7 promoters, nucleic acid construct, cell and its production and use
CN107326025A (en) * 2017-06-16 2017-11-07 集美大学 A kind of crocea interferon IFN1 promoters, nucleic acid construct, cell and its production and use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BEI HUANG等: "Interferon regulatory factor 10 (IRF10): Cloning in orange spotted grouper, Epinephelus coioides, and evolutionary analysis in vertebrates", 《FISH & SHELLFISH IMMUNOLOGY》 *

Similar Documents

Publication Publication Date Title
US11268089B2 (en) Method for the construction of specific promoters
Palazzo et al. Transcriptionally promiscuous “blurry” promoters in Tc1/mariner transposons allow transcription in distantly related genomes
Nguyen et al. Novel promoters derived from Chinese hamster ovary cells via in silico and in vitro analysis
US20220396790A1 (en) High-throughput screening platform for engineering next-generation gene therapy vectors
Crouch et al. Genetic requirements for homologous recombination in Autographa californica nucleopolyhedrovirus
CN107058325B (en) A kind of crocea interferon regulatory factor IRF7 promoter, nucleic acid construct, cell and its preparation method and application
Nakade et al. Promoter structure of the MxA gene that confers resistance to influenza virus
JP6960409B2 (en) promoter
Zieler et al. Intron‐dependent stimulation of marker gene expression in cultured insect cells
CN110527683A (en) A kind of Epinephelus coioides IRF10 gene promoter and preparation method
Liu et al. Improved and simplified recombineering approach for influenza virus reverse genetics
Ziarczvk et al. A short 5′ region of the long terminal repeat is required for regulation by hormone and heat shock of Drospohila retrotransposan 1731
CN107058326B (en) A kind of crocea interferon regulatory factor IRF3 promoter, nucleic acid construct, cell and its preparation method and application
CN108384790A (en) The method of the identification regulation and control active controlling element of FATP1 gene promoter transcriptions
CN107326025A (en) A kind of crocea interferon IFN1 promoters, nucleic acid construct, cell and its production and use
CN102978202A (en) Over-expression vector for muscle specific expression of pig IGF1 gene
US10711279B2 (en) Promoter sequences
Kang et al. Derivation and functional characterization of a consensus DNA binding sequence for the tas transcriptional activator of simian foamy virus type 1
Lufino et al. The infectious BAC genomic DNA expression library: a high capacity vector system for functional genomics
Singh et al. Evolution of transcriptional regulatory elements within the promoter of a mammalian gene.
CN114480496B (en) Double-luciferase reporter gene vector for insect cells, construction method, recombinant vector and application
Chernov et al. A new technique for selective identification and mapping of enhancers within long genomic sequences
JP2003111587A (en) REPORTER GENE CONSTRUCTION MATERIAL FOR DETECTING HIV Rev AND HIV Tat
Rohrwasser et al. Contribution of Sp1 to initiation of transcription of angiotensinogen
CN118147143A (en) Japanese eel IFNe gene promoter and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20191203

RJ01 Rejection of invention patent application after publication