CN110512020A - A kind of Rice Salt QTL, localization method, molecular labeling and its application - Google Patents
A kind of Rice Salt QTL, localization method, molecular labeling and its application Download PDFInfo
- Publication number
- CN110512020A CN110512020A CN201910786649.3A CN201910786649A CN110512020A CN 110512020 A CN110512020 A CN 110512020A CN 201910786649 A CN201910786649 A CN 201910786649A CN 110512020 A CN110512020 A CN 110512020A
- Authority
- CN
- China
- Prior art keywords
- salt
- rice
- qtl
- molecular labeling
- localization method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to genetic crop gene engineering technology field more particularly to a kind of Rice Salt QTL, localization method, molecular labeling and its applications.This research is that salt tolerant parent and salt density value parent treasure Shan 97 construct segregating population with extra large rice 86, by carrying out potting salt stress phenotypic evaluation to F2, in conjunction with the genetic linkage maps for resurveying sequence acquisition, carry out the positioning of salt tolerant quantitative trait locus, and molecular labeling is developed for the section of positioning, it can quickly and accurately realize the screening of salt-resistant type rice.
Description
Technical field
The invention belongs to genetic crop gene engineering technology field more particularly to a kind of Rice Salt QTL, localization method,
Molecular labeling and its application.
Background technique
The salinization of soil be limitation crop growth in world wide, cause the main abiotic stress of crop production reduction because
One of son.According to UNESCO and food and agricultural organization's incomplete statistics, whole world saline alkali land area has 9.54 hundred million hm2,
It is distributed in different continents arid area.China's saline alkali land area is 99,130,000 hm2, including 36,930,000 hm2Modern salt-soda soil,
44870000 hm2Remaining salt-soda soil and 17,330,000 hm2Potential salt-soda soil, be mainly distributed on northeast, North China, Northwest inland area with
And North of Yangtze River coastal area, and have the tendency that being gradually expanded, wherein the saline alkali land area of oceanfront is about 516.7hm2, river
Revive Coastal beach gross area 68.7hm2, account for about the 1/4 of the national beach gross area.In global range the salt-soda soil of large area at
An important factor for restrict world economy social sustainable development, even more limitation Agriculture Production, threaten the straight of grain security
Connect factor.
Rice is one of most important cereal crops and China the first generalized grain crop in the world.As China 60%
The importance in the staple food source of the above population, rice high and stable yields is self-evident.Saline Alkali Stress is to influence rice growth
A kind of serious adverse circumstance harm, rice cultivation will make its yield reduce nearly 30% on the soil of salinization of soil.Earth environment is increasingly
Deteriorate so that desertification and salinization of soil increasingly sharpen, the production and development of rice are also faced with huge threat, China by
The rice field area that salt damage influences accounts for about the 1/5 of rice cropping area.Rice is the crop of a kind of pair of salt stress medium sensitivity, the salt side of body
Compel the main restricting factor as saline and alkaline rice region rice normal growth.The study found that salt stress can seriously affect the growth of rice
Development, cell metabolic activity are remarkably decreased, endoplasmic reticulum damage and plasmolysis, the protein product of high electron density in cytoplasm
Tired, photosynthesis and respiration are severely impacted, and it is even dead to eventually lead to production loss.Wherein, in japonica rice salt tolerance
Deng more than, and long-grained nonglutinous rice salt tolerance is poor, cannot after planting emerge when serious.
In order to resist influence of the salt stress to Rice Production in agricultural production, drainage and irrigation project is usually built, by pouring water
Drainage of salt, this method waste water resource, economic input are big, and effect is not significant.In contrast, cultivate and plant salt tolerant rice
Kind is to repair wetland with saline-alkaline to improve hardened soil ecology, and developing agricultural production increases farmers' income, pushes agricultural economy can
Sustainable development has the small quick most effective measure of investment most directly, effectively, simultaneously.Therefore, carry out rice in saline-alkali field kind
It plants, the breeding and utilization of salt tolerant rice kind are a basic orientation.In salt-soda soil, plantation salt tolerant rice kind is arranged in conjunction with cultivation
The optimization applied improves rice yield, will play positive effect for developing salt-soda soil kind rice.Therefore, deepen to Rice Salt spy
Property research to cultivate salt tolerant rice be of great significance, quickly and accurately cultivated in particular with technique for gene engineering means
Salt stability rice.
Less to the research of Rice Salt gene at present, paddy rice anti contravariance correlated traits is mostly controlled by minor-polygene, and
Vulnerable to environment and genetics background influence, compares and be difficult to identify.There are three types of the common strategies of rice QTL positioning at present: the first is
It is marked based on segregating population binding molecule and carries out QTL positioning；Second is that the association analysis progress QTL based on linkage disequilibrium is fixed
Position；The third is that the selection screening method based on genotype selection carries out QTL positioning.QTL positioning is exactly detection molecules label and QTL
Between linkage relationship, while can also estimate the hereditary effect of QTL.In general, relatively good molecular labeling will be dispersed throughout base
It because of group and is uniformly distributed, detection means is simple and quick, and development cost and use cost are cheap.Therefore, it filters out to Rice Salt
The QTL of main effect, and corresponding molecular labeling is developed, it can accurately and rapidly screen salt tolerant rice.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of Rice Salt QTL, molecular labeling and its applications.
The invention is realized in this way a kind of Rice Salt QTL, the QTL are located at the 7th chromosome Chr7:27639767-
28702394 sections.
A kind of molecular labeling for above-mentioned QTL exploitation, the primer sequence of the molecular labeling see SEQ ID NO:1 and
SEQ ID NO:2。
A kind of molecular labeling for above-mentioned QTL exploitation, the primer sequence of the molecular labeling see SEQ ID NO:3 and
SEQ ID NO:4。
A kind of localization method of such as above-mentioned Rice Salt QTL, comprising the following steps:
S1: being hybridized with salt density value type rice treasure Shan 97 with salt-resistant type rice sea rice 86, obtains F2 group；
S2: salt stress phenotypic analysis is carried out to F2 group；
S3: resurveying sequence to F2 group, carries out variation detection, constructs genetic linkage maps；
S4: in conjunction with step S2 phenotypic analysis and S3 in genetic linkage maps carry out salt tolerant QTL scanning and heredity effect
It should analyze, determine main effect QTL.
Further, the scanning of salt tolerant QTL and the analysis of hereditary effect, choosing are carried out in step S3 using WinQTLCart 2.5
Select Kosambi mapping function and composite interval mapping method.
Further, walk speed is set as 0.5cm, and the threshold value that QTL determines is set as 2.5.
Application of the Rice Salt QTL in Rice Salt breeding as described in claim 1.
Application of the molecular labeling in assisting sifting salt tolerant rice kind as claimed in claim 2.
Application of the molecular labeling in assisting sifting salt tolerant rice kind as claimed in claim 3.
Application of the localization method of Rice Salt QTL as described in claim 4-6 is any in rice strain breeding.
In conclusion advantages of the present invention and good effect are as follows:
This research is that salt tolerant parent and salt density value parent construct segregating population with extra large rice 86, by carrying out the potting salt side of body to F2
Compel phenotypic evaluation, in conjunction with the genetic linkage maps for resurveying sequence acquisition, carries out the positioning of salt tolerant quantitative trait locus, and for positioning
Section develop some molecular labelings, can quickly and accurately realize the screening of salt-resistant type rice.
Detailed description of the invention
Fig. 1 is the electronics character frequency disribution that F2 group takes pictures；
Fig. 2 is that salt damage is manually graded frequency disribution three times for F2 group；
Fig. 3 is distribution of the label in linkage group of the extra large rice 86F2 of precious Shan 97/；
Fig. 4 is the extra large rice 86F of precious Shan 97/2The qtl analysis peak figure of three classes character；
Fig. 5 is molecular labeling electrophoresis result figure.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
The present invention discloses a kind of Rice Salt QTL, localization method, molecular labeling and its application, each implementation specific as follows
Shown in example.
Embodiment 1F2 group salt stress phenotypic evaluation
Precious Shan 97 is more sensitive to salt damage, and extra large rice 86 more salt tolerant.Hybridized by extra large rice 86 with precious Shan 97 and obtain F2 group:
Precious 97/ sea rice 86F2 (300 single plants) of Shan.
The mode of the transplanting of summer in 2017 is first by F2 single plant kind in Hua Zhong Agriculture University's rice test field.In plant tillering
The each single plant of peak period separates 6 more consistent tillers of size, and 3 kinds in field for taking blade sample and subsequent receipts to be selfed
Kind, another 3 difference single plant kinds do stress tests in potting indigo plant bucket (bucket depth 30cm, back cut diameter 20cm).When the tiller of transplanting
Restoration ecosystem and before not earing starts to carry out salt stress.
Salt stress is divided into carry out three times, and the specific stress time of F2 group and detection time are as shown in the table.Every time when stress,
Certain density salting liquid is configured, is after mixing evenly poured into salting liquid in blue bucket with the triangular flask of 150mL, guarantees every barrel of stress
Degree is consistent, and wherein the mass ratio of the degree of salt stress sodium chloride and soil indicates.
The extra large rice 86F of the precious Shan 97/ of table 12It coerces three times
After obvious phenotype (i.e. significant difference occurs in growing way) occurs in salt stress, (quite by three single plants of each F2
In three repetitions) it handles with care to Hua Zhong Agriculture University's crop phenotype platform ((Yang and Guo et al.Combining
high-throughput phenotyping and genome-wide association studies to reveal
Natural genetic variation in rice.Nat Commun, 2014,5:5087) it carries out automating lossless phenotype survey
It is fixed.Later period analyzes software with associated picture and carries out image segmentation to side view, and extracts reflection and hold green and leaf roll character, i.e.,
GPAR (Green projected area ratio, drop shadow green's area ratio), GPA (Green projected area, green
Projected area), TPA (Total projected area, total projection area), TBR (Total projected area/
Bounding rectangle area ratio, total projection area/bounding rectangles area ratio), PAR (Perimeter/
Projected area ratio, perimeter/projected area ratio).Detailed phenotype is extracted referring to document (Guo et
al.Genome-Wide Association Studies of Image Traits Reveal Genetic
Architecture of Drought Resistance in Rice.Mol Plant,2018,11:789-805)。
Outside the electronics character obtained except through picture, salt damage also is carried out to the single plant in picture and has manually been graded.Reference
Standard from the saline and alkaline harmful rank evaluation of International Rice Research Institute's rice standard, by the entirety after each F2 single plant salt stress
Performance is divided into 5 grades, as shown in the table.
2 rice salt damage rating scale of table
The building of 2 genetic linkage maps of embodiment
The building of genetic map is completed by sequencing company Jino match gram (GENOSEQ), and main flow includes test material (water
Rice blade) preparation, library construction and sequencing, the building of variation detection and genetic linkage maps.Surveyed using based on a new generation
DdRAD seq (double digested restrict-site associated DNA sequencing) skill of sequence platform
Art carries out resurveying sequence to 500 single plants of F2 group.The comparing that sequence obtains will be resurveyed and refer to genome (MSU to OryzasativaLcv.Nipponbare
7.0) on, variation detection (including SNP and InDel) is carried out.The scanning and heredity of salt tolerant QTL are carried out using WinQTLCart 2.5
The analysis of effect.Genotype data and phenotypic data are imported into analysis software WinQTLCart 2.5, select Kosambi mapping letter
Several and compound section (composite interval mapping, CIM) graphing method, walk speed are set as 0.5cM, and QTL sentences
Fixed threshold value is set as 2.5.
In production genetic linkage map time spectrum, there are following corresponding relationships:
AA→2→A
Aa→1→H
aa→O→B
The corresponding precious Shan 97 of the genotype of AA, is abbreviated as A, is substituted when doing bin figure conversion with 2；The corresponding extra large rice of the genotype of aa
86, it is abbreviated as B, is substituted when doing bin figure conversion with 0.Due toSo
When additive effect value is negative value, show that the allele from salt tolerant parent sea rice 86 plays synergistic effect；Additive effect value is positive
When, show that the allele from sensitive varieties treasure Shan 97 plays synergistic effect.
Salt-tolerant phenotype analysis and QTL positioning of the embodiment 3 based on F2 group
One F2 single plant separates the consistent rice container made of bamboo, wicker, ratten, etc. kind of three size growing ways and goes down, and is equivalent to three repetitions.Image character
GPAR and artificial grading are used directly for evaluation salt tolerance, and in addition Δ TPA/TPA can reflect plant growth rate.Table three times
Type take pictures acquisition GPAR and Δ TPA/TPA frequency disribution it is as shown in Figure 1.GPAR value in Liang Ge F2 group is all in skewness point
Cloth, and all show that GPAR value is bigger, the bigger trend of frequency, the value of most of plant is between 0.9-1.Δ TPA/TPA is in
Now inclined normal distribution.
To reduce human error, first for choosing each F2 picture is independently given a mark and is averaged by two people, as salt
The score of evil grading.It is illustrated in fig. 2 shown below as the Liang Ge F2 group frequency disribution that salt damage is manually graded three times.On the whole, group
The corresponding salt damage rank of single plant mostly between 3-7, frequency of the score between 7-9 is less, minimum between 1-3.
In single plant level, the single plant artificial rank score occurred less than 5 and greater than 7 twice or more is defined as salt resistance
Single plant and sensitive single plant.Sensitive single plant and salt resistance single plant number in the extra large rice 86F2 of precious Shan 97/ are respectively as follows: 298,212,218,
286,279；35,7,19,36,49.
The result summary that sequence is resurveyed by group is as shown in the table.The mean coverage of sequencing reaches 4.6%, and being averaged for sequencing is covered
Lid depth is 30.57 ×, the genetic map overall length of the extra large rice 86F2 of precious Shan 97/ is 1143.1cM, and genetic map bin sum is
2343, genetic map label sum is 45471.The SNP and InDel of acquisition are screened to obtain the label of high quality, really
Determine linkage group, infer the genotype of parent, determines the source of allele；Then using based on Hidden Markov Model
The algorithm of (Hidden Markov Model, HMM) fills up the genotype of missing, genetic distance is calculated, to obtain final something lost
Linkage map is passed, as shown in Figure 3.As seen from the figure, the genetic marker of acquisition is distributed on 12 pairs of chromosomes of rice, quantity it is abundant and
It is distributed more uniform.
3 F2 group of table weight sequencing result
For convenience, precious 97/ sea rice 86F2 of Shan is abbreviated as ZS2, and artificial grading is abbreviated as PR, and -1, -2, -3 represent 1-
3 phenotypic evaluations.
Phenotypic data in conjunction with F2 group based on picture and the genetic linkage maps constructed utilize analysis software
WinQTLCart2.5 carries out the scanning of salt tolerant QTL and the analysis of hereditary effect.
Scanning altogether is manually graded to 42 QTL, respectively by picture character and salt damage in precious 97/ Hai Dao 86F2 group of Shan
On Isosorbide-5-Nitrae, 7,8,9,11 chromosomes.Wherein, maximum is contributed positioned at the QTL that the 7th chromosomal inheritance distance is 39.71cM,
Its phenotypic variation explained is 21.6%, LOD value 12.26, and by manually grading (PR-1) and GPAR-1, GPAR-2 have and be total to
Positioning, the section from Salt-tolerant Materials sea rice 86 play synergistic effect.Peak figure is shown in Fig. 4.
Further, the common location to F2 and F2:3 as a result, by salt resistant gene be locked in the 7th chromosome segment (Chr7:
LOC_Os07g47100 (OsNHX1) and LOC_Os07g47350 (OsHAK7) in 27639767-28702394), the two bases
Because all related to ion transport.
The exploitation of embodiment 4 has the molecular labeling of potential using value QTL
Based on the result of study of QTL in the comparing result and embodiment 3 for resurveying sequence in embodiment 2, molecule is designed
WSC127-WSC129 is marked, part primer sequence is as follows:
WSC127-F:CCCACGATGAAGAACAAGCA is shown in SEQ ID NO:1；
WSC127-R:CATCTTCTCCGAGGGTGTCC is shown in SEQ ID NO:2；
WSC129-F:TAAATAAGGTGCTGACTGGTTGC is shown in SEQ ID NO:3；
WSC129-R:CAAGAAGCCCAATAACAACG is shown in SEQ ID NO:4.
PCR amplification is carried out by template of the DNA sample of two materials, the extracting method of DNA is referring to " Rice biology experiment
Guide " (rice research team, crop genetic improvement National Key Laboratory writing, the 43-44 pages) description CTAB method.PCR is anti-
Answering system is 0.5 μ L DNA profiling 0.5 μ L, 10 μ L 2xTsingke mix, F/R primer each 0.5 μ L, 8.5 μ L ddH2O.PCR
Response procedures: 95 DEG C of 5min；95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s (32cycles)；72℃7min；25℃1s.Agarose is solidifying
Gel electrophoresis, which detects, whether there is difference between product.It is illustrated in fig. 5 shown below, the amplified production of the corresponding precious Shan 97 of Z, the corresponding extra large rice 86 of S
Amplified production.
The results show that WSC127-F/R and WSC129-F/R two can be parent with precious Shan 97 and extra large rice 86 to molecular labeling
Derivative family in screen salt tolerant single plant (WSC128-F/R amplify come product it is poor without apparent size between two parents
It is different, abandon).
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>Wuhan Hai Dao international bio Science and Technology Ltd.
<120>a kind of Rice Salt QTL, localization method, molecular labeling and its application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (WSC127-F)
<400> 1
cccacgatga agaacaagca 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (WSC127-R)
<400> 2
catcttctcc gagggtgtcc 20
<210> 3
<211> 23
<212> DNA
<213>artificial sequence (WSC129-F)
<400> 3
taaataaggt gctgactggt tgc 23
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (WSC129-R)
<400> 4
caagaagccc aataacaacg 20
Claims (10)
1. a kind of Rice Salt QTL, it is characterised in that: the QTL is located at the 7th area chromosome Chr7:27639767-28702394
Section.
2. a kind of molecular labeling for QTL described in claim 1 exploitation, which is characterized in that the primer of the molecular labeling
Sequence is shown in SEQ ID NO:1 and SEQ ID NO:2.
3. a kind of molecular labeling for QTL described in claim 1 exploitation, which is characterized in that the primer of the molecular labeling
Sequence is shown in SEQ ID NO:3 and SEQ ID NO:4.
4. a kind of localization method of Rice Salt QTL as described in claim 1, which comprises the following steps:
S1: being hybridized with salt density value type rice treasure Shan 97 with salt-resistant type rice sea rice 86, obtains F2 group；
S2: salt stress phenotypic analysis is carried out to F2 group；
S3: resurveying sequence to F2 group, carries out variation detection, constructs genetic linkage maps；
S4: in conjunction with step S2 phenotypic analysis and S3 in genetic linkage maps carry out the scanning and hereditary effect point of salt tolerant QTL
Analysis, determines main effect QTL.
5. the localization method of Rice Salt QTL according to claim 4 a kind of, it is characterised in that: utilize Win in step S3
QTL Cart 2.5 carries out the scanning of salt tolerant QTL and the analysis of hereditary effect, and Kosambi mapping function and compound section is selected to make
Figure method.
6. the localization method of Rice Salt QTL according to claim 5 a kind of, it is characterised in that: in step S3, walk
Speed is set as 0.5cm, and the threshold value that QTL determines is set as 2.5.
7. a kind of application of Rice Salt QTL as described in claim 1 in Rice Salt breeding.
8. a kind of application of molecular labeling as claimed in claim 2 in assisting sifting salt tolerant rice kind.
9. a kind of application of molecular labeling as claimed in claim 3 in assisting sifting salt tolerant rice kind.
10. a kind of localization method answering in rice strain breeding of the Rice Salt QTL as described in claim 4-6 is any
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910786649.3A CN110512020A (en) | 2019-08-24 | 2019-08-24 | A kind of Rice Salt QTL, localization method, molecular labeling and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910786649.3A CN110512020A (en) | 2019-08-24 | 2019-08-24 | A kind of Rice Salt QTL, localization method, molecular labeling and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110512020A true CN110512020A (en) | 2019-11-29 |
Family
ID=68626697
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910786649.3A Pending CN110512020A (en) | 2019-08-24 | 2019-08-24 | A kind of Rice Salt QTL, localization method, molecular labeling and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110512020A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684856A (en) * | 2019-08-08 | 2020-01-14 | 中国水稻研究所 | Molecular marker of rice flourishing related trait gene and application thereof |
| CN111304359A (en) * | 2020-04-24 | 2020-06-19 | 山东省水稻研究所 | Molecular marker closely linked with salt tolerance of rice seed germination and application thereof |
| CN111733278A (en) * | 2020-07-21 | 2020-10-02 | 上海市农业科学院 | Rice sodium and potassium ion absorption QTL (quantitative trait loci) linked SNP (Single nucleotide polymorphism) molecular marker and application thereof |
| CN112662801A (en) * | 2020-12-31 | 2021-04-16 | 浙江师范大学 | Molecular marker of major QTL site qZn1-1 for regulating and controlling zinc ion stress resistance of rice and application |
-
2019
- 2019-08-24 CN CN201910786649.3A patent/CN110512020A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684856A (en) * | 2019-08-08 | 2020-01-14 | 中国水稻研究所 | Molecular marker of rice flourishing related trait gene and application thereof |
| CN110684856B (en) * | 2019-08-08 | 2021-06-04 | 中国水稻研究所 | Molecular marker of rice flourishing related trait gene and application thereof |
| CN111304359A (en) * | 2020-04-24 | 2020-06-19 | 山东省水稻研究所 | Molecular marker closely linked with salt tolerance of rice seed germination and application thereof |
| CN111304359B (en) * | 2020-04-24 | 2022-04-15 | 山东省水稻研究所 | Molecular marker closely linked with salt tolerance of rice seed germination and application thereof |
| CN111733278A (en) * | 2020-07-21 | 2020-10-02 | 上海市农业科学院 | Rice sodium and potassium ion absorption QTL (quantitative trait loci) linked SNP (Single nucleotide polymorphism) molecular marker and application thereof |
| CN112662801A (en) * | 2020-12-31 | 2021-04-16 | 浙江师范大学 | Molecular marker of major QTL site qZn1-1 for regulating and controlling zinc ion stress resistance of rice and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110512020A (en) | A kind of Rice Salt QTL, localization method, molecular labeling and its application | |
| Gregorich et al. | Changes in soil carbon under long-term maize in monoculture and legume-based rotation | |
| Woods et al. | Contemporary and historical patterns of connectivity among populations of an inland river fish species inferred from genetics and otolith chemistry | |
| Houston et al. | Phylogenetic relationships of the western North American cyprinid genus Richardsonius, with an overview of phylogeographic structure | |
| Hollingsworth Jr et al. | Temporal patterns of diversification and microendemism in Eastern Highland endemic barcheek darters (Percidae: Etheostomatinae) | |
| Theron et al. | High quality remnant patches in a complex agricultural landscape sustain high spider diversity | |
| Toft et al. | Effectiveness of living shorelines in the Salish Sea | |
| CN110423840A (en) | A kind of Rice Salt QTL, localization method and its application | |
| Jardim de Queiroz et al. | Multifactorial genetic divergence processes drive the onset of speciation in an Amazonian fish | |
| Liu et al. | Effects of farmland landscape pattern on spatial distribution of soil organic carbon in Lower Liaohe Plain of northeastern China | |
| Bosch et al. | New conservation viewpoints when plants are viewed at one level higher. Integration of phylogeographic structure, niche modeling and genetic diversity in conservation planning of W Mediterranean larkspurs | |
| Wang et al. | What is the mechanism of submerged macrophyte biodiversity affecting biomass productivity along water depth: Niche complementarity or selection effect? | |
| Raffo et al. | Integrating a growth degree-days based reaction norm methodology and multi-trait modeling for genomic prediction in wheat | |
| DiFazio | Measuring and modeling gene flow from hybrid poplar plantations: implications for transgenic risk assessment | |
| CN108486273A (en) | On No. 5 chromosomes with the excavation and application of the SSR marker of Rice Salt QTL close linkages | |
| Ma et al. | Rapid and repeated climate adaptation involving chromosome inversions following invasion of an insect | |
| Mäemets et al. | Inter-annual variability of Potamogeton perfoliatus stands | |
| CN108504760A (en) | The QTL of the excellent salt tolerant resource of rice is excavated and application | |
| Mulugeta et al. | Harnessing genome-wide genetic diversity, population structure and linkage disequilibrium in Ethiopian durum wheat gene pool | |
| Smith et al. | Small‐scale population‐genetic differentiation in the New Zealand caddisfly Orthopsyche fimbriata and the crayfish Paranephrops planifrons | |
| Zhang et al. | Genetic diversity and population structure of Garcinia paucinervis, an endangered species using microsatellite markers | |
| Meng et al. | Out of the Qinghai-Tibetan plateau: Origin, evolution and historical biogeography of Morchella (both Elata and Esculenta clades) | |
| Zong et al. | Performance of five typical warm‐season turfgrasses and their influence on soil bacterial community under a simulated tropical coral island environment | |
| Friis et al. | Rapid lineage diversification of gray mangroves (Avicennia marina) driven by isolation in cryptic glacial refugia and extreme environmental conditions in the Arabian Peninsula | |
| Lee | History, population structure and evolution of invasive Tamarix L. in the Southwestern US |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |