CN110499314A - Albumen eukaryotic expression promoter and protein expression vector and its construction method and application - Google Patents
Albumen eukaryotic expression promoter and protein expression vector and its construction method and application Download PDFInfo
- Publication number
- CN110499314A CN110499314A CN201910749622.7A CN201910749622A CN110499314A CN 110499314 A CN110499314 A CN 110499314A CN 201910749622 A CN201910749622 A CN 201910749622A CN 110499314 A CN110499314 A CN 110499314A
- Authority
- CN
- China
- Prior art keywords
- expression vector
- protein expression
- promoter
- albumen
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to albumen eukaryotic expression promoter and protein expression vector and its construction method and applications.Protein expression vector is a kind of circular vectors, include prokaryotic origin of replication, an eukaryon replication orgin, riddled basins and exogenous gene expression box, the exogenous gene expression box is successively made of albumen eukaryotic expression promoter, junction fragment and polyadenylic acid tailing signal from upstream to downstream, and the junction fragment contains AfeI identification sequence.Compared with prior art, protein expression vector of the invention drives exogenous gene expression using albumen eukaryotic expression promoter, the promoter element that the carrier contains all has efficient protein expression efficiency in fowl source and human archeocyte, and the building process of this carrier is easy, quick, economical, efficient.Protein expression vector of the invention has a good application prospect.
Description
Technical field
The invention belongs to technical field of bioengineering, more particularly, to a kind of albumen eukaryotic expression promoter and protein expression
Carrier and its construction method and application.
Background technique
Promoter is the important component and gene therapy and recombinant vaccine of carrier for expression of eukaryon, transgenosis
A kind of most element of equal fields application.Most common promoter includes SV40, CMV, Avianactin promoter etc., can
The type of selection is less.Identical promoter is used for multiple times in same animal or carrier, will cause homologous recombination phnomena, leads
Cause engineering carrier unstable.Be badly in need of at present different types of promoter it is available with use.
It is by traditional company during eukaryotic expression albumen plasmid construction expression alien gene plasmid used at present
Method connection is connect, using restriction enzyme site, carrier and target fragment are connected into a complete plasmid by T4DNA ligase.It passes
The problems such as that there are steps is more cumbersome for the connection method of this digestion of system, at high cost, and joint efficiency is lower.
Summary of the invention
It is an object of the present invention to overcome the above-mentioned drawbacks of the prior art and provide a kind of albumen eukaryotic expressions
Promoter and protein expression vector and its construction method and application.
The present invention provides a kind of new albumen eukaryotic expression promoters, and construct an albumen table based on this promoter
Up to carrier, this carrier can use homologous recombination and be cloned, and have the characteristics that simple and effective, it is contemplated that the carrier will be controlled in gene
It treats, plays a significant role in recombinant vaccine and Study on Transgenic Animal.
The purpose of the present invention can be achieved through the following technical solutions:
The present invention provides a kind of albumen eukaryotic expression promoter, and the albumen eukaryotic expression promoter is Aves
The promoter of polyomavirus 1 (APV) virus, the nucleotide sequence of the albumen eukaryotic expression promoter such as SEQ ID
Shown in NO.2, or the sequence with sequence homology shown in SEQ ID NO.2 higher than 80%.
The present invention also provides the applications that the albumen eukaryotic expression promoter is used to construct protein expression vector.
The present invention provides a kind of protein expression vector, is a kind of circular vectors, is named as pAPV, replicates comprising protokaryon
Point, riddled basins and exogenous gene expression box, the exogenous gene expression box is from upstream to downstream successively by the albumen
Eukaryotic expression promoter, junction fragment and polyadenylic acid tailing signal composition, the junction fragment contain AfeI identification sequence.
The albumen eukaryotic expression promoter, nucleotide sequence as shown in SEQ ID NO.2, or with SEQ ID NO.2 institute
Show the sequence that sequence homology is higher than 80%.
The polyadenylic acid tailing signal concretely bovine growth hormone gene polyadenylic acid tailing sequence (BGH
polyA)。
The nucleotide sequence of the protein expression vector is as shown in SEQ ID NO.1.
A kind of protein expression vector is linear carrier, is obtained with AfeI digestion pAPV carrier.
A kind of construction method of the protein expression vector, utilizes homologous recombination technique carrier construction, comprising the following steps:
1) using APV viral DNA as template, with following primer:
5'CGAAAAGTGCCACCTGACGTCCCTGTTGCTAGGGCGTAATA3'
And 5'CTGGCAACTAGAAGGCACAGCGCTATAGCTTTTTTCTCTG3'
PCR amplification is carried out, promoter fragment A is obtained；
2) using pCDNA3.0 plasmid as template, with following primer:
5'CAGAGAAAAA AGCTATAGC GCTGTGCCTTCTAGTTGCCAG3'
And 5'TATTACGCCCTAGCAACAGGGACGTCAGGTGGCACTTTTCG3'
PCR amplification is carried out, segment B is obtained；
3) segment A and segment B is imported in competent escherichia coli cell, is connected segment A and segment B by homologous recombination
It connects, obtains protein expression vector as described in claim 1, is i.e. recombination pAPV carrier.
Application of the protein expression vector as shuttle vector.
Building of the protein expression vector for the expression vector of foreign gene.
Compared with prior art, pAPV carrier of the invention can in birds, human cell high efficient expression foreign protein,
And this carrier can use the recombinant vector of homologous recombination construction expression alien gene, avoid traditional digestion, connection etc.
Link does not use any restriction endonuclease and ligase in entire building process, and 2-3 step is omitted than traditional connection procedure
Suddenly, the efficiency of connection is also more satisfactory.Use the process letter of the recombinant vector of pAPV vector construction expression alien gene of the invention
Just, quickly, it is economical, efficiently, the building of the expression vector of a large amount of foreign genes can be rapidly completed.PAPV carrier tool of the invention
There is good application prospect.
Detailed description of the invention
Fig. 1 is pAPV Vector map.
Fig. 2 is the fluorescence microscope result of green fluorescent protein.
In Fig. 2, A is pAPV-EGFP plasmid transfection DF-1 cell fluorescence result；B is that pAC-EGFP plasmid transfection DF-1 is thin
Born of the same parents' fluorescence results；C is negative control DF-1 cell.
Specific embodiment
The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings.
These examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.
Experimental method in the following example unless otherwise specified is conventional method.
The building of embodiment 1, pAPV carrier, with reference to Fig. 1,
1) building of pAPV carrier
The design primer upstream APV Promotor-F and the downstream APV Promotor-R, AMP/pBR322/BGHPolyA-F
The sequence in upstream and the downstream AMP/pBR322/BGHPolyA-R is as follows:
The upstream APV Promotor-F:
5'CGAAAAGTGCCACCTGACGTCCCTGTTGCTAGGGCGTAATA 3'；
The downstream APV Promotor-R:
5'CTGGCAACTAGAAGGCACAGCGCTATAGCTTTTTTCTCTG 3'。
The upstream AMP/pBR322/BGHPolyA-F:
5'CAGAGAAAAAAGCTATAGCGCTGTGCCTTCTAGTTGCCAG 3'(dashed part is that AfeI enzyme identifies position
Point)；
The downstream AMP/pBR322/BGHPolyA-R:
5'TATTACGCCCTAGCAACAGGGACGTCAGGTGGCACTTTTCG 3'。
Using APV viral DNA as template, expanded with the primer upstream APV Promotor-F and APV Promotor-R downstream PCR
Increase segment A, using pCDNA3.0 plasmid as template, with the upstream primer AMP/pBR322/BGHPolyA-F and AMP/pBR322/
BGHPolyA-R downstream PCR amplified fragments B.
PCR reaction system: 10 × PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, DNA profiling 1 μ L, MgCl2
3 0.5 μ L of μ L, Pfu-Taq (5U/ μ L) of (25mM) 3 μ L, dNTPs (each 2.5mM), last moisturizing to 50 μ L.
Reaction condition: 94 DEG C of thermal denaturation 5min；94 DEG C of denaturation 45s, 53 DEG C of annealing 45s, 72 DEG C of extension 6min, totally 30 are followed
Ring；72 DEG C of last extension 10min.
PCR product is recycled with DNA QIAquick Gel Extraction Kit, and method refers to its specification.
It is mixed after segment A and B is added in 50 μ L competent cells, segment A and B mass ratio is 100ng:500ng.After mixing
System ice bath 30min.42 DEG C water-bath heat shock 90 seconds, then place 3min on ice, the 900 μ L of LB culture medium of preheating be added, is placed in
At 37 DEG C, 180-200rpm shakes 90min, collects thallus, and thallus is resuspended with LB liquid medium, 200 μ L re-suspension liquids is taken to be coated with
(contain ampicillin) on LB plate, 37 DEG C of culture 12-16h.Picking monoclonal extracts plasmid, which is pAPV carrier.
The ability of embodiment 2, pAPV carrier expression EGFP albumen
1) building of the pAPV-EGFP-Vector of expressing green fluorescent protein
The upstream design primer EGFP and the downstream EGFP, primer sequence are as follows:
The upstream EGFP: GAAAAAAGCTATAGCATGGTGAGCAAGGGCGAGG；
The downstream EGFP: CACTAGAAGGCACAGCTTACTTGTACAGCTCGTCCA.
Using pEGFP-N1 as template, EGFP gene segment is expanded with the upstream primer EGFP and EGFP downstream PCR.
Reaction system: 10 × PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, DNA profiling 1 μ L, MgCl2(25mM)
33 0.5 μ L of μ L, Pfu-Taq (5U/ μ L) of μ L, dNTPs (each 2.5mM), last moisturizing to 50 μ L.
Reaction condition: 94 DEG C of thermal denaturation 5min；94 DEG C of denaturation 45s, 50 DEG C of annealing 45s, 72 DEG C of extension 1min, totally 30 are followed
Ring；72 DEG C of last extension 10min.
PCR product is recycled with DNA QIAquick Gel Extraction Kit, and method refers to its specification.
PAPV carrier is linearized with AfeI endonuclease digestion, recycles the pAPV carrier of linearisation.
Digestion system is as follows:
1 μ L, pAPV carrier of 10 × D buffer10 μ L, BSA, 2 μ L (purchase of 20U PROMEGA company), moisturizing to 100 μ
L, 37 DEG C of digestions are stayed overnight.
Digestion products electrophoresis in the Ago-Gel that 1 × TAE is prepared, 120v, electrophoresis 30 minutes, DNA QIAquick Gel Extraction Kit
Recycle target fragment.- 80 DEG C of recovery product save backup.
Be added in 50 μ l competent cells linearisation pAPV carrier and EGFP gene segment after mix, the pAPV of linearisation
Carrier and EGFP gene fragment masses ratio are 100ng:500ng.System ice bath 30min after mixing.42 DEG C water-bath heat shock 90 seconds, so
It places 3min on ice afterwards, the 900 μ L of LB culture medium of preheating is added, is placed at 37 DEG C, 180-200rpm shakes 90min, collects bacterium
Thallus is resuspended with LB liquid medium in body, takes on 200 μ L re-suspension liquids coating LB plate (containing ampicillin), 37 DEG C of culture 12-
16h.Picking monoclonal extracts plasmid, which is named as pAPV-EGFP-Vector.
2) detection of green fluorescent protein
5 μ L lipofectamine 2000 (Invitrogen company) are taken to be added to the OPTI-MEMI culture medium of 250 μ L
In (Invitrogen company), 5 minutes are placed at room temperature for, obtains solution 1；2 μ g pAPV-EGFP-Vector plasmids are added to
In the OPTI-MEM culture medium of 250 μ L, solution 2 is obtained；Solution 1 and 2 is mixed, is incubated at room temperature 20 minutes, adds 500 μ L's
OPTI-MEM culture medium obtains solution 3.Fowl source fibroblast (DF-1) and source of people renal epithelial cell (293T) are placed in 6 holes
It is cultivated in cell plates, when waiting cell long to 60-80% twice by cells rinsed with PBS, is then added 3,37 DEG C of solution and is incubated for 5
Solution 3 is sucked out in a hour, and the OPTI-MEM culture medium containing 10% fetal calf serum is added, continues to cultivate.After culture for 24 hours, glimmering
The expression of viewed under light microscopy fluorescin.
In order to compare this pAPV Vector promoter expression EGFP protein efficiency, if one contains fowl Actin promoter
The control of pAC-EGFP expression plasmid, 2 μ g pAC-EGFP plasmids of transfection to DF-1 and 293T cell.It is aobvious in fluorescence after culture for 24 hours
The expression of micro- microscopic observation fluorescin.
Fluorescence microscope result is as shown in Fig. 2, 24 hours DF-1 and 293T are thin after showing pAPV-EGFP-Vector transfection
Born of the same parents have stronger fluorescence signal, and negative control group does not have fluorescence, it was demonstrated that pAPV-EGFP-Vector plasmid can DF-1 with
293T expressing green fluorescent protein simultaneously have good protein expression ability, also illustrate BFV promoter can avian cells with
High efficient expression foreign protein in mammalian cell.And in the DF-1 cell of fowl source (Fig. 2), pAPV-EGFP-Vector is expressed glimmering
Luminous intensity is better than pAC-EGFP plasmid, illustrates that BFV promoter expression efficiency in avian cells is better than fowl Actin promoter.
The above description of the embodiments is intended to facilitate ordinary skill in the art to understand and use the invention.
Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein general
Principle is applied in other embodiments without having to go through creative labor.Therefore, the present invention is not limited to the above embodiments, ability
Field technique personnel announcement according to the present invention, improvement and modification made without departing from the scope of the present invention all should be of the invention
Within protection scope.
Sequence table
<110>Shanghai Communications University
<120>albumen eukaryotic expression promoter and protein expression vector and its construction method and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2404
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 1
cctgttgcta gggcgtaata tcctgtaaaa aggtcacgta cgcctccctt ttatggagcg 60
gcacgtaata tgggacgata ggcggagtct gggagaccgc ctgtttggat acaaacatgg 120
gcatatccgt attccttata tggaatgcat gttatgtaag tcccaagtat ggatttccgc 180
attcccttat ttggaatgca tgttatgtaa cgattgctca gcacttccct tgtttttata 240
aatcgcgctc tggcaagcca gtgcactata cagagaaaaa agctatagcg ctgtgccttc 300
tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc 360
cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg 420
tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa 480
tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa gaaccagctg 540
gggctctagg gggtatcccc acgcgccctg tagcggcgca ggaaagaaca tgtgagcaaa 600
aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 660
ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 720
aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 780
gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 840
tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 900
tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 960
gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 1020
cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 1080
cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag 1140
agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg 1200
caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 1260
ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 1320
aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 1380
tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 1440
agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 1500
gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 1560
accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 1620
tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 1680
tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc 1740
acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 1800
atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 1860
aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 1920
tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 1980
agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc 2040
gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 2100
ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 2160
atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 2220
tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt 2280
tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg 2340
tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 2400
cgtc 2404
<210> 2
<211> 289
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 2
cctgttgcta gggcgtaata tcctgtaaaa aggtcacgta cgcctccctt ttatggagcg 60
gcacgtaata tgggacgata ggcggagtct gggagaccgc ctgtttggat acaaacatgg 120
gcatatccgt attccttata tggaatgcat gttatgtaag tcccaagtat ggatttccgc 180
attcccttat ttggaatgca tgttatgtaa cgattgctca gcacttccct tgtttttata 240
aatcgcgctc tggcaagcca gtgcactata cagagaaaaa agctatagc 289
Claims (8)
1. a kind of albumen eukaryotic expression promoter, which is characterized in that the albumen eukaryotic expression promoter is Aves
The promoter of polyomavirus 1 (APV) virus, the nucleotide sequence of the albumen eukaryotic expression promoter such as SEQ ID
Shown in NO.2, or the sequence with sequence homology shown in SEQ ID NO.2 higher than 80%.
2. a kind of application of albumen eukaryotic expression promoter as described in claim 1, which is characterized in that the albumen eukaryotic expression
Promoter is for constructing protein expression vector.
3. a kind of protein expression vector, which is characterized in that be a kind of circular vectors, include prokaryotic origin of replication, selection markers base
Cause and exogenous gene expression box, the exogenous gene expression box are successively true by albumen as described in claim 1 from upstream to downstream
Nuclear expression promoter, junction fragment and polyadenylic acid tailing signal composition, the junction fragment contain AfeI identification sequence.
4. a kind of protein expression vector according to claim 3, which is characterized in that the nucleotide of the protein expression vector
Sequence is as shown in SEQ ID NO.1.
5. a kind of protein expression vector, which is characterized in that be linear carrier, with AfeI digestion egg as claimed in claim 3
White expression vector obtains.
6. a kind of construction method of protein expression vector as claimed in claim 3, which is characterized in that utilize homologous recombination technique structure
Build carrier, comprising the following steps:
1) using APV viral DNA as template, with following primer:
5'CGAAAAGTGCCACCTGACGTCCCTGTTGCTAGGGCGTAATA3'
And 5'CTGGCAACTAGAAGGCACAGCGCTATAGCTTTTTTCTCTG3'
PCR amplification is carried out, promoter fragment A is obtained；
2) using pCDNA3.0 plasmid as template, with following primer:
5'CAGAGAAAAA AGCTATAGC GCTGTGCCTTCTAGTTGCCAG3'
And 5'TATTACGCCCTAGCAACAGGGACGTCAGGTGGCACTTTTCG3'
PCR amplification is carried out, segment B is obtained；
3) segment A and segment B is imported in competent escherichia coli cell, is connected segment A with segment B by homologous recombination,
Obtain protein expression vector as described in claim 1.
7. the application of protein expression vector as claimed in claim 3, which is characterized in that the protein expression vector is carried as shuttling
The application of body.
8. the application of protein expression vector according to claim 7, which is characterized in that the protein expression vector is used for external source
The building of the expression vector of gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910749622.7A CN110499314B (en) | 2019-08-14 | 2019-08-14 | Protein eukaryotic expression promoter, protein expression vector, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910749622.7A CN110499314B (en) | 2019-08-14 | 2019-08-14 | Protein eukaryotic expression promoter, protein expression vector, construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499314A true CN110499314A (en) | 2019-11-26 |
| CN110499314B CN110499314B (en) | 2021-11-12 |
Family
ID=68587477
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910749622.7A Active CN110499314B (en) | 2019-08-14 | 2019-08-14 | Protein eukaryotic expression promoter, protein expression vector, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499314B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101374949A (en) * | 2006-01-31 | 2009-02-25 | 国立水产科学院 | Production of a soluble native form of recombinant protein by the signal sequence and secretional enhancer |
| CN101481703A (en) * | 2009-01-14 | 2009-07-15 | 中国农业大学 | Avian origin promoter expression vector, construction method and use thereof |
| CN107828816A (en) * | 2017-10-20 | 2018-03-23 | 云南省烟草农业科学研究院 | One primary yeast Agrobacterium shuttle vector and construction method and application |
-
2019
- 2019-08-14 CN CN201910749622.7A patent/CN110499314B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101374949A (en) * | 2006-01-31 | 2009-02-25 | 国立水产科学院 | Production of a soluble native form of recombinant protein by the signal sequence and secretional enhancer |
| CN101481703A (en) * | 2009-01-14 | 2009-07-15 | 中国农业大学 | Avian origin promoter expression vector, construction method and use thereof |
| CN107828816A (en) * | 2017-10-20 | 2018-03-23 | 云南省烟草农业科学研究院 | One primary yeast Agrobacterium shuttle vector and construction method and application |
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "Genbank：MK516256.1", 《GENBANK》 * |
| P.W.J.RIGBY: "SV40病毒和多瘤病毒：通过DNA体外重组对它们进行分析以及它们做真核系统的载体", 《遗传工程》 * |
| 李劲 等: "禽类多瘤病毒APV-1晚期基因多顺反子的EGFP标记载体构建和表达", 《中南民族大学学报（自然科学版）》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499314B (en) | 2021-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101720332B (en) | Fsh producing cell clone | |
| CN108410787A (en) | A kind of recombined bacillus subtilis of synthesis new tetroses of lactoyl-N- and its construction method and application | |
| CN108949693A (en) | A kind of pair of T cell immune detection point access carries out the method and application of gene knockout | |
| CN113403294B (en) | Fusion protein, base editing tool and application thereof | |
| CN113943720A (en) | Apolygus lucorum GRK gene, dsRNA thereof, synthetic method and application thereof | |
| CN114196705A (en) | Recombinant adeno-associated virus packaging plasmid, recombinant adeno-associated virus and application thereof | |
| CN115044585B (en) | Eukaryotic cell promoter CF1 and application thereof in cell gene expression | |
| CN109929847B (en) | PEX26 gene, protein and application thereof | |
| GB2425534A (en) | Epsilon poly-L-lysine-nucleic acid complex | |
| US20010010928A1 (en) | Protozoan expression system | |
| CN114736308B (en) | Preparation and application of coccidian antigen peptide/IL 5 fusion protein gene engineering bacteria | |
| KR100721140B1 (en) | Shuttle vectors for Leuconostoc and E. coli | |
| CN110499314B (en) | Protein eukaryotic expression promoter, protein expression vector, construction method and application thereof | |
| CN106701806B (en) | Assess serial transcription factor Reporter System and its application of Chinese medicine and/or natural drug efficiency | |
| CN113355342A (en) | Biological preparation method for improving caffeic acid yield | |
| CN112481285A (en) | Synthesis method of target gene fragment | |
| CN109852615B (en) | Bidirectional promoter capable of expressing alkaline protease, application, plasmid and genetic engineering bacteria | |
| KR101535070B1 (en) | Recomnication expression vector of vascular growth factor and the vascular growth factor expressing stem cell line thereof | |
| CN106868044A (en) | A kind of transgenic animals hair color reporter gene expression box, expression vector and application | |
| CN108588100B (en) | Inhibin B double-gene fragment combined expression vector and application thereof | |
| CN116672442B (en) | Preparation of medicine for treating osteosarcoma by combining ligustilide and HER2-CAR-T cells | |
| CN112322626B (en) | CpG-ODN with specific immunostimulation effect on PRRSV and application thereof | |
| TW201805020A (en) | Use of colicin ib and microorganism expressing colicin Ib for preparation of meat-growth agent | |
| CN112626029B (en) | Transgenic modified Daudi cell and preparation method and application thereof | |
| CN114181939B (en) | Recombinant coccidium vector expressing NA4 protein and fluorescent tag and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 200030 Dongchuan Road, Minhang District, Minhang District, Shanghai Applicant after: Shanghai Jiaotong University Address before: 200030 Huashan Road, Shanghai, No. 1954, No. Applicant before: Shanghai Jiaotong University |
|
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |