CN110496138B

CN110496138B - Extraction method and application of yak milk exosome

Info

Publication number: CN110496138B
Application number: CN201910501990.XA
Authority: CN
Inventors: 任发政; 高海娜; 王鹏杰; 张炎
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2019-06-11
Filing date: 2019-06-11
Publication date: 2021-08-27
Anticipated expiration: 2039-06-11
Also published as: CN110496138A

Abstract

The invention provides an extraction method and application of yak milk exosomes. Firstly, extracting and obtaining Yak milk-derived exosomes and Holstein Cow milk-derived exosomes, comparing miRNA in Yak-Exo and Cow-Exo by high-throughput sequencing analysis, analyzing sequence quality, category, length distribution and the like of small RNA in a library by a bioinformatics method, and screening out miRNA with obvious expression difference on the basis. And verifying the reliability of the miRNA by using a tailing method and qRT-PCR (quantitative reverse transcription-polymerase chain reaction) to obtain the high-throughput sequencing. And finally, carrying out GO and KEGG enrichment analysis and target gene prediction on the miRNA with differential expression. bta-mi-RNA31 and bta-mi-RNA34a related to the hypoxia process in Yak-Exo effectively relieve the damage of small intestine epithelial cells under the hypoxia condition by effectively activating a HIF hypoxia signal path and a p53 apoptosis signal path.

Description

Extraction method and application of yak milk exosome

Technical Field

The invention belongs to the technical field of food biology, and particularly relates to an extraction method and application of yak milk exosomes.

Background

Exosomes (Exo) are membrane structure vesicles which are generated by active secretion of cells in a physiological state, are round or oval, have diameters of 30-200nm, and have a density of 1.13-1.19 g/mL. It is present in various body fluid environments, such as serum, urine, milk, amniotic fluid, and the like. Since exosomes have a lipid bilayer membrane structure, they can effectively protect internal nucleotides, are not hydrolyzed by rnases and are absorbed by the gastrointestinal tract, and therefore exosomes may be the main form of the body for transporting bioactive nucleotides.

Disclosure of Invention

The invention aims to provide an extraction method and application of yak milk exosomes.

The purpose of the invention is realized by the following technical scheme:

the yak milk exosome comprises bta-miRNA31 and bta-miRNA34a, and the sequences of the two mi RNAs are as follows:

bta-miRNA-31: AGGCAAGAUGCUGGCAUAGCU, and

bta-miRNA-34a:UGGCAGUGUCUUAGCUGGUUGU。

furthermore, the yak milk exosome is applied to preparation of a medicine for activating an HIF hypoxia signal pathway.

Furthermore, the yak milk exosome is applied to preparation of a medicine for activating an apoptosis signal pathway of p53 cells.

Furthermore, the yak milk exosome is applied to preparation of a medicament for activating a VEGF hypoxia signal pathway.

Further, the food comprises milk beverage, cheese and yoghourt.

A modified yak milk exosome is an exosome with increased miRNA-31 and miRNA-34a contents.

The application of mi RNA derived from yak milk exosomes as a medicine or food for preparing intestinal injury caused by hypoxia, wherein the mi RNA is bta-mi-RNA31 and/or bta-mi-RNA34a, and the sequences of the two mi RNAs are respectively as follows:

bta-miRNA-31: AGGCAAGAUGCUGGCAUAGCU, and

bta-miRNA-34a:UGGCAGUGUCUUAGCUGGUUGU。

an extraction method of yak milk exosomes comprises the following steps:

removing fat and cell fragments in milk by ultracentrifugation of yak milk under a low-temperature condition, removing residual fat and cell fragments in skim milk supernatant by ultracentrifugation of skim milk supernatant again under the low-temperature condition, then adding rennin into the skim milk supernatant, incubating at 37 ℃ to remove casein in the skim milk supernatant, filtering the obtained whey with a filter membrane to remove redundant cell fragments, discarding the supernatant by ultracentrifugation at an ultrahigh speed under the low-temperature condition, and allowing trace faint yellow precipitates to be visible at the bottom to obtain a yak milk exosome primary product, fully blowing and resuspending the obtained yak milk exosome primary product with PBS, then centrifuging at the ultrahigh speed, fully blowing and resuspending the obtained precipitates with PBS, and filtering with the filter membranes of 0.45 mu m and 0.22 mu m in sequence to obtain the yak milk exosome.

Compared with the prior art, the invention has the beneficial effects that:

1. the Yak milk-derived exosome (Yak-Exo) and the common milk-derived exosome (Cow-Exo) are extracted by an optimization method, then miRNA in the Yak-Exo and the Cow-Exo are compared by high-throughput sequencing analysis, sequence quality, category, length distribution and the like of small RNA in a library are analyzed by a bioinformatics method, mi RNA with obvious expression difference is screened on the basis, and compared with Cow-Exo, 20 miRNA which are expressed differentially and are obviously up-regulated in the Yak-Exo are obtained;

2. and verifying the reliability of the miRNA obtained by high-throughput sequencing by a tailing method and fluorescent quantitative PCR (qRT-PCR). And finally, carrying out GO and KEGG enrichment analysis and target gene prediction on the miRNA with differential expression. The miRNA-bta-mi-RNA 31 and bta-mi-RNA34a, bta-mi-RNA31 and bta-mi-RNA34a related to the hypoxia process in the Yak-Exo are found to effectively activate the HIF hypoxia signal pathway to relieve the apoptosis of cells under hypoxia, so that the damage of the epithelial cells of the small intestine under the hypoxia condition is effectively relieved;

3. bta-mi-RNA31 and bta-mi-RNA34a or yak milk exosomes containing bta-mi-RNA31 and bta-mi-RNA34a are used for preparing the medicine or food for treating the intestinal injury caused by hypoxia, so that the medicine or food is safe and effective, has no toxic or side effect, and has important significance;

4. the method provided by the invention has the advantage that whether the yak milk can inhibit intestinal injury caused by hypoxia is judged by directionally detecting the content of bta-mi-RNA31 and bta-mi-RNA34a in the yak milk.

Drawings

FIG. 1 is an annotated classification scheme of small RNA molecules in Yak-Exo and Cow-Exo;

FIG. 2 is a graph of the differential miRNA Wen in Yak-Exo and Cow-Exo;

FIG. 3 is a graph showing differential miRNA expression in Yak-Exo and Cow-Exo;

FIG. 4 is a graph of clustering analysis of miRNA expression in Yak-Exo and Cow-Exo;

FIG. 5 is a graph of GO analysis results for target genes;

FIG. 6 is a graph of the results of KEGG analysis of target genes;

FIG. 7 is a bar graph identifying the transfection efficiency of mi RNA31 cells;

FIG. 8 is a graph showing the results of the determination of transfection efficiency of mi RNA31 cells;

FIG. 9 is a schematic representation of the effect of miRNA31 on HIF-associated signal proteins under hypoxic conditions;

FIG. 10 is a schematic diagram showing the effect of miRNA31 on apoptosis-related signaling proteins under hypoxic conditions;

FIG. 11 is a graph of results of a dual luciferase assay reporting miR-31 overexpression targeting Casp-9 gene;

FIG. 12 is a bar graph showing the identification of transfection efficiency of mi RNA34a cells;

FIG. 13 is a graph showing the results of the determination of transfection efficiency of mi RNA34a cells;

FIG. 14 is a schematic illustration of the effect of miRNA34a on apoptosis-related signaling proteins under hypoxic conditions;

FIG. 15 is a schematic representation of the effect of miRNA34a on HIF-associated signal proteins under hypoxic conditions;

FIG. 16 is a graph showing the results of a dual-luciferase assay reporting miR-34a overexpression targeting Casp-9 gene.

Detailed Description

Example 1 extraction of Yak milk exosomes

The yak milk is ultracentrifuged for 30min at 8,000 Xg at 4 deg.C to remove fat and cell debris in milk. The skim milk supernatant was ultracentrifuged at 13,200 Xg for 1 hour at 4 ℃ to remove the remaining fat and cell debris. Then 0.025g/L rennin was added to the skim milk supernatant and incubated at 37 ℃ for 6h to remove casein from the skim milk supernatant. Filtering the obtained whey by a 0.45-micron filter membrane to remove redundant cell fragments, centrifuging at the temperature of 4 ℃ for 90min at the ultrahigh speed of 120,000 Xg, discarding the supernatant, and allowing trace faint yellow precipitate to be visible at the bottom, thus obtaining the yak milk exosome primary product. And fully blowing and resuspending the obtained primary yak milk exosome product by PBS, and centrifuging for 90min at the ultrahigh speed at the temperature of 4 ℃ at the speed of 120,000 Xg. And (3) fully blowing and resuspending the obtained precipitate by PBS, and filtering the precipitate by filter membranes of 0.45 mu m and 0.22 mu m in sequence to obtain the Yak milk exosome (Yak-Exo).

Example 2 biological analysis of Yak-Exo and Cow-Exo sequencing results

Small RNA Classification annotation in Yak-Exo and Cow-Exo:

the sequences of the RNA from Yak-Exo and Cow-Exo after small RNA length screening were compared with the Cow genome database, miRBase 20.0, where the small RNAs were annotated into different classes, and the results are shown in FIG. 1, where the small RNA species in the clean sequence included mi RNA, r RNAs, sno RNAs, sn RNAs, t RNA and other s RNAs, where the proportion of miRNAs was greatest in either Yak-Exo or Cow-Exo. The total amount of the rRNA is used as a quality control index of a sample, and the proportion of the total amount of the rRNA in the Yak-Exo and the Cow-Exo is lower than 40 percent, so that the research samples all accord with the quality control index.

Consensus sequence between differential expressions in Yak-Exo and Cow-Exo:

comparing the miRNA expression profiles of the Yak-Exo and Cow-Exo groups, the distribution is shown in figure 2, wherein 28% of miRNA is only expressed in the Cow-Exo (SY) group, 63.7% of miRNA is only expressed in the Yak-Exo (Yak) group, and only 8.3% of miRNA is expressed in the two groups at the same time. These shared functions of differentially expressed mirnas are worthy of further study.

Differential expression miRNA analysis:

counting the known miRNAs in Yak-Exo and Cow-Exo by using an Expdiff method, determining whether the expression quantity of the miRNAs is significantly different between samples, comparing the known miRNAs with log2-ratio and Scatter plot respectively, and taking | log2(Fold Change) | ≧ 1 as a threshold value as shown in figure 3, wherein each point in the threshold value represents one miRNA, the X axis represents the expression quantity in Cow-Exo, and the Y axis represents the expression quantity in Yak-Exo; green dots indicate down-regulation of miRNA expression, gray dots indicate no change in miRNA expression, and red dots indicate up-regulation of miRNA expression. In 794 miRNAs obtained by high-throughput result analysis, 130 miRNAs with differential expression exist in total, 51 miRNAs are highly expressed in the Yak-Exo, and 79 miRNAs are lowly expressed in the Yak-Exo.

Clustering analysis of differential expression miRNA:

in order to deeply research the different expression patterns of the differentially expressed miRNAs in the Yak-Exo and the Cow-Exo, hierarchical clustering analysis is carried out on the miRNAs in the Yak-Exo and the Cow-Exo according to the sequencing result, the result is shown in FIG. 4, each row represents one miRNA, and each column represents one sample. The color of each cell shows the differential expression of one miRNA in the sample, red for high miRNA expression in the sample and green for low expression in the sample. The clustering analysis chart clearly shows the miRNA expression change in the Yak-Exo sample and the Cow-Exo sample. Mirnas with obvious differences also exist with insignificant differences, and the differentially expressed mirnas may have similar biological functions or participate in the same biological process because of similar expression patterns. The good clustering of the expression patterns in the two groups of Yak-Exo and Cow-Exo indicates that relatively good consistency exists between biological repeats.

Example 3 Mi RNA analysis of differential expression

Target gene GO significance analysis:

in this example, GO enrichment analysis was performed on differentially expressed miRNAs analyzed in example 1, and as shown in fig. 5, target genes of 51 miRNAs whose expression was up-regulated in Yak-Exo mainly participate in various biological processes such as intracellular communication (intracellular signal transmission) and membrane vesicle transport (vacuolar transport). Green represents biological processes, orange represents cellular composition, and yellow represents molecular functions of genes.

Target gene KEGG significance analysis:

in order to more intuitively display the significance degree of the miRNA enrichment pathway with significant difference in Yak-Exo and Cow-Exo, the dispersion analysis is carried out on the miRNA enrichment pathway (as shown in FIG. 6), and the larger the enrichment factor, the more significant the enrichment is (P < 0.05). KEGG enrichment analysis shows that the ribosome pathway (Lysosome) is a very significant enrichment item, and 79 candidate target genes (P <0.01) are enriched. The tumor necrosis factor signaling pathway (TNF signaling pathway), the mitogen-activated protein kinase signaling pathway (MAPK signaling pathway), the Long-term synaptic potentiation signaling pathway (Long-term signaling), the Central carbon metabolism in cancer (Central carbon metabolism in cancer), the Sphingolipid signaling pathway (Sphingolipid signaling pathway), the AGE-anger signaling pathway of diabetic complications (AGE-RAGE signaling pathway in metabolic compositions), the Phosphatidylinositol signaling pathway (Phosphophatidylinositol signaling system), and the neurohormonal signaling pathway (neurohormonal signaling pathway) are significantly enriched (P < 0.05). Whereas the hypoxia signaling pathway (HIF-1 signaling pathway) can enrich 58 candidate genes from 98 background genes (P ═ 0.052).

And (3) verification of the target gene of the differential expression miRNA:

to further study the biological function of differentially expressed mirnas between samples, the miRanda, PITA and RNAhybrid software was used to predict intersection and screen known mirnas that may be associated with hypoxia progression from the differentially expressed mirnas in the Yak-Exo and Cow-Exo libraries, with the results shown in table 1/2: in the first 20 miRNAs that were differentially expressed and significantly up-regulated (as in table 3), miR-31 and miR-34a were highly expressed in Yak-Exo compared to Cow-Exo, and miR31 and miR34a target genes were predicted using comprehensive assessment of biological analysis. The prediction results indicate that both miR31 and miR34a are associated with the hypoxic process. Wherein miR-31 is associated with the HIF signaling pathway (P0.0078 <0.01), miR-34a is associated with the VEGF signaling pathway (P0.018 <0.05), and miR31 and miR34a may both influence HIF activity and P53 synthesis through a series of signaling cascades.

TABLE 1 miR-31 target Gene prediction

TABLE 2 miR-34a target Gene prediction

TABLE 3 high expression (TOP 20) of differential miRNAs in Yak-Exo

miRNA ID	Yak-Exo	Cow-Exo	Log2(fold change)	Significance-Lab
					bta-miR-2284a	18.5567	0.5528	5.069	**
bta-miR-193b	2.2082	0.1162	4.2482	**
					bta-miR-31	8.7238	0.5284	4.0453	**
bta-miR-2285o	5.1098	0.4122	3.6319	**
					bta-miR-145	1.7935	0.2039	3.1368	**
bta-miR-199a-3p	3.6306	0.4485	3.017	**
					bta-miR-451	4.5368	0.5978	2.9239
bta-miR-34a	13.9841	1.9224	2.8628	**
					bta-miR-133a	5.4265	0.7787	2.8009	**
bta-miR-10b	59.8829	8.6626	2.7893	**
					bta-miR-490	3.3888	0.4903	2.789	**
bta-miR-218	5.4395	1.0775	2.3358	**
					bta-miR-29c	55.3679	11.7918	2.2313	**
bta-miR-135a	29.7527	6.7185	2.1468	**
					bta-miR-143	240.963	59.5807	2.0159	**
bta-miR-381	4.5291	1.124	2.0106	**
					bta-miR-500	30.6698	8.5888	1.8363	**
bta-miR-30b-5p	307.1827	90.9787	1.7555	**
					bta-miR-1	85.3687	25.6055	1.7373
bta-miR-29b	65.9363	20.2159	1.7056	**

Example 4 mechanism of action of mi RNA31 to alleviate Small intestinal epithelial cell injury under hypoxic conditions

Analysis of the high-throughput sequencing results shows that: compared with Cow-Exo, miR-31 and miR-34a are highly expressed in Yak-Exo in the first 20 miRNAs which are differentially expressed and are obviously up-regulated, and the comprehensive evaluation prediction result of biological analysis shows that miR-31 and miR-34a are both related to an anoxic process. Wherein miR-31 is associated with the HIF signaling pathway (P0.0078 <0.01), and miR-34a is associated with the VEGF signaling pathway (P0.018 < 0.05).

The embodiment researches the action way and mechanism of miR-31 and miR-34a for relieving IEC-6 cell injury caused by hypoxia. bta-miR-31 is transfected to overexpress 100pmol/well respectively; bta-miR-31 silences 100 pmol/well; bta-miR-31 silences 200 pmol/well; bta-miR-34a overexpresses 100 pmol/well; bta-miR-34a silences 100 pmol/well; bta-miR-34a silences 200pmol/well, utilizes qRT-PCR to detect the transfection efficiency of miRNA, and screens the optimal addition concentration of overexpression and silencing of miRNAs. MTT and Immunofluorescence (IF) are used to detect the influence of miR-31 and miR-34a on IEC-6 cell survival rate. WB was used to detect P53 and HIF signal pathway element factor expression. The dual-luciferase is used for verifying the targeting relationship between miR-31 and miR-34a and casp9, and a potential target and a theoretical basis are provided for the treatment of the high altitude hypoxia intestinal tract injury.

Effect of miRNA31 on IEC-6 cell viability under hypoxia induction:

as shown in FIG. 7, the conditions of IEC-6 cell survival rate under normal and anoxic conditions were detected by MTT method after IEC-6 cells were transfected with miR-31mimic and miR-31inhibitor for 12h and 24 h. MTT results show that: compared with the IEC-6 cell survival rate under the normoxic condition, the IEC-6 cell survival rate is remarkably reduced after 12h and 24h of hypoxia (P < 0.05). When miR-31mimic is transfected, hypoxia is carried out for 12h and 24h, and the IEC-6 cell survival rate level is obviously improved (P is less than 0.05) compared with a negative control group (hypoxia group) and a miR-31inhibitor transfected group. After miR-31mimic transfection, compared with 24h hypoxia, the IEC-6 cell survival rate is relatively and remarkably recovered when the cell is in 12h hypoxia. In conclusion, the miR-31 can effectively relieve IEC-6 cell damage under the anoxic condition.

As shown in figure 8, in order to further illustrate that miR-31 can effectively relieve IEC-6 cell injury under the anoxic condition, an immunofluorescence method is used for detecting the Ki67 protein expression quantity. Ki67 is a nuclear protein involved in ribosomal RNA transcription. Can be used as a marker for cell proliferation. As a result, as shown in FIG. 8, Ki67 expression level in IEC-6 cells was reduced in hypoxia for 12 hours as compared with that in normoxic atmosphere. Compared with a negative control group (a hypoxia group) and a miR-31inhibitor transfected group, the expression level of Ki67 protein in IEC-6 cells is obviously increased (P <0.05) after miR-31mimic transfection. In conclusion, the miR-31 can effectively relieve IEC-6 cell damage under the anoxic condition. The detection result is consistent with the MTT result.

The regulation and control effect of miRNA31 on anti-apoptosis HIF signal pathway protein under hypoxia induction is as follows:

in order to further research the action mechanism of miR-31 for relieving small intestine epithelial cell injury under the anoxic condition, a WB method is used for detecting and detecting the hypoxia of IEC-6 cells for 12 hours after the IEC-6 cells are respectively transfected with miR-31mimic and miR-31inhibitor, and the expression of the hypoxia-related protein of the IEC-6 cells under the normal and anoxic conditions. The results are shown in FIG. 9, where HIF- α and VEGF proteins were expressed in high amounts and PHD-1 protein was expressed in low amounts under hypoxic conditions. Compared with the method of adding miR-31inhibitor with the same concentration under the anoxic condition, the addition of miR-31 micic can obviously promote the expression of PHD-1 protein and reduce the expression of HIF-alpha and downstream factor VEGF protein. In conclusion, by adding miR-31 imic, the damage of the epithelial cells of the small intestine under hypoxia can be relieved by effectively activating the HIF hypoxia signal pathway.

The miRNA31 has the following regulation effect on the anti-apoptosis P53 signal pathway protein induced by hypoxia:

in order to further research the action mechanism of miR-31 for relieving small intestine epithelial cell injury under the anoxic condition, a WB method is used for detecting and detecting the hypoxia of IEC-6 cells for 12 hours after the IEC-6 cells are respectively transfected with miR-31mimic and miR-31inhibitor, and the expression of IEC-6 cell apoptosis-related protein under the normal and anoxic conditions. The results are shown in FIG. 10, in which the p53 protein, the pro-apoptosis related protein Bax, Casp-9 protein and Casp-3 protein were highly expressed as compared with those under hypoxic conditions under normoxic conditions. Compared with the method under the anoxic condition and by adding the miR-31inhibitor with the same concentration, the expression quantity of p53 protein, Bax protein, Casp-9 protein and Casp-3 protein can be obviously reduced by adding the miR-31 micic. In conclusion, the addition of miR-31 effectively relieves apoptosis of cells under hypoxia.

Prediction of miRNA-31 target genes:

miRNA is combined with the 3' -UTR position of miRNA of the downstream target gene to negatively regulate the expression level of the target gene, thereby exerting the biological function of miRNA. And predicting the miR-31 target gene by adopting biological software. It was preliminarily determined that miR-31 is associated with the regulation of the hypoxic process. miR-31 is associated with the HIF signaling pathway (P ═ 0.0078< 0.01). miR-31 can regulate hypoxia and apoptosis pathways so as to relieve the damage of small intestine epithelial cells under the hypoxia condition.

And (3) predicting and discovering that miR-31 has a plurality of target genes by using bioinformatics software. The study mainly explores the recovery degree of small intestine epithelial cell injury in an anoxic environment. We selected the target gene of Casp-9 this miR-31. The bioinformatics software is used for predicting that bta-miR-31 has a plurality of target genes. The research mainly researches the recovery degree of bta-miR-31 after IEC-6 cell damage in an anoxic environment. We selected the target gene of bta-miR-31, Caspase-9. As a result, as shown in Table 4, bta-miR-31 and Caspase-9 have 1 possible effective binding site.

TABLE 4 miR-31 target Gene binding site sequences

Compared with NC contrast, the fluorescence of a wild type vector (WT) is reduced to some extent, the fluorescence of a mutant type vector (MUT) is recovered to some extent, and the miRNA is considered to have a regulating effect on a target gene, and the inhibition efficiency of the miRNA on the target gene sequence can be indirectly reflected by the strength of a fluorescence signal. As shown in FIG. 11, bta-miR-31 was transfected without significantly affecting bta-Casp9-WT fluorescence expression compared with bta-Casp 9-WT-NC. Compared with bta-Casp9-MUT 1-NC, bta-miR-31 transfected has no obvious effect on the fluorescence expression of bta-Casp9-MUT 1. Fluorescence expression of bta-Casp9-MUT1 after transfection of bta-miR-31 had no significant effect relative to fluorescence expression of bta-Casp9-WT after transfection of bta-miR-31. This result indicates that bta-miR-31 is likely to have no significant interaction with this site on the bta-Casp 93' UTR. The results only show that bta-miR-31 does not regulate the expression of the target gene through the site on the bta-Casp 93' UTR, and the absence of the targeting relationship between bta-miR-31 and Casp9 cannot be shown.

Example 5 mechanism of action of mi RNA34a to alleviate Small intestinal epithelial cell injury under hypoxic conditions

Effect of miRNA-34a on IEC-6 cell viability under hypoxia induction:

as shown in FIG. 12, the conditions of hypoxia for 12h and 24h and the cell survival rate of IEC-6 cells under normal and anoxic conditions after IEC-6 cells are transfected with miR-34a mimic and miR-34inhibitor respectively are detected by an MTT method. MTT results show that: compared with the IEC-6 cell survival rate under the normoxic condition, the IEC-6 cell survival rate is remarkably reduced after 12h and 24h of hypoxia (P < 0.05). When miR-34a mimic is transfected, the cell viability level of IEC-6 is obviously increased (P <0.05) compared with that of a negative control group (hypoxia blank group) after 12h and 24h of hypoxia. After miR-34a mimic transfection, compared with 24h hypoxia, the IEC-6 cell survival rate is relatively and remarkably recovered when the oxygen is deficient for 12 h. In conclusion, the miR-34 can effectively relieve IEC-6 cell damage under the anoxic condition.

In order to further illustrate that miR-34a can effectively relieve IEC-6 cell injury under the anoxic condition, an immunofluorescence method is used for detecting the Ki67 protein expression quantity. Ki67 is a nuclear protein involved in ribosomal RNA transcription. Can be used as a marker for cell proliferation. As a result, as shown in FIG. 13, the expression level of Ki67 in IEC-6 cells was reduced at hypoxia for 12 hours as compared with that at normoxia. Compared with a negative control group (a hypoxia group) and a miR-34a inhibitor transfected group, the expression level of Ki67 protein in IEC-6 cells is obviously increased (P <0.05) after miR-34a mimic is transfected. In conclusion, the miR-34a can effectively relieve IEC-6 cell damage under the anoxic condition. The detection result is consistent with the MTT result.

Regulation effect of miRNA34a on anti-apoptosis HIF signal pathway protein under hypoxia induction

In order to further research the action mechanism of miR-34a for relieving small intestine epithelial cell injury under the anoxic condition, a WB method is used for detecting and detecting the hypoxia for 12h after IEC-6 cells are respectively transfected with miR-34a mimic and miR-34inhibitor, and the expression of IEC-6 cell hypoxia-related protein under normal and anoxic conditions. The results are shown in FIG. 14, which shows that HIF-alpha and VEGF protein expression is high and PHD-1 protein expression is low under hypoxic conditions. Compared with the method that the miR-34a inhibitor with the same concentration is added under the anoxic condition, the addition of the miR-34a micid can obviously promote the expression of the PHD-1 protein and reduce the expression of the HIF-alpha and downstream factor VEGF protein. In conclusion, the miR-34a imic is added to more effectively activate the HIF hypoxia signal pathway and relieve the damage of the epithelial cells of the small intestine under hypoxia.

Regulation effect of miRNA34a on anti-apoptosis p53 signal pathway protein under hypoxia induction

In order to further research the action mechanism of miR-34a for relieving small intestine epithelial cell injury under the anoxic condition, a WB method is used for detecting and detecting the hypoxia of IEC-6 cells after the IEC-6 cells are respectively transfected with miRNA-34a mimic and miRNA-34 inhibitor for 12 hours, and the expression of IEC-6 cell apoptosis-related proteins under normal and anoxic conditions. As a result, as shown in FIG. 15, the expression levels of p53 protein, Bax protein, Casp-9 protein and Casp-3 protein were higher in the anoxic condition than in the normoxic condition. Compared with the miRNA-34a inhibitor with the same concentration under the anoxic condition, the miRNA-34a micic can obviously reduce the expression level of p53 protein Bax protein, Casp-9 protein and Casp-3 protein. In conclusion, the addition of miRNA-34a effectively relieves apoptosis of cells under hypoxia.

Prediction of miR-34a target gene:

miRNA is combined with the 3' -UTR position of miRNA of the downstream target gene to negatively regulate the expression level of the target gene, thereby exerting the biological function of miRNA. And predicting the miR-34a target gene by adopting biological software. It was preliminarily determined that miR-34a is associated with the regulation of the hypoxic process. miR-34a is associated with the VEGF signaling pathway (P ═ 0.018< 0.05). miR-34a can regulate hypoxia and apoptosis pathways so as to relieve the damage of small intestine epithelial cells under the hypoxia condition.

The bioinformatics software is used for predicting that bta-miR-34a has a plurality of target genes. The study mainly explores the recovery degree of small intestine epithelial cell injury in an anoxic environment. The software is used for predicting bta-miR-34a target gene Caspase-9 binding sites, the result is shown in Table 5, 5 possible effective binding sites exist between bta-miR-34a and Caspase-9, and relatively proper sites are selected according to the principle that the lower the absolute value of folding energy, the smaller the P value and the higher the comprehensive score of the predicted sites.

TABLE 5 miR-34a target Gene binding site sequences

The results are shown in FIG. 16, and compared with bta-Casp9-WT-NC, bta-Casp9-WT fluorescence expression is significantly up-regulated after bta-miR-34a is transfected. Compared with bta-Casp9-MUT2-NC, bta-miR-34a transfected significantly up-regulates the fluorescent expression of bta-Casp9-MUT 2. The fluorescence expression of bta-Casp9-MUT2 after bta-miR-34a transfection is obviously higher than that of bta-Casp9-WT after bta-miR-34a transfection, the fluorescence value is relatively increased by 26%, and the change trend of the fluorescence value accords with the function of miRNA regulation gene expression. The result shows that bta-miR-34a can regulate the expression of bta-Casp 93' -UTR upper site regulation target genes.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in China

<120> extraction method of yak milk exosomes and application thereof

<130> MP1913814Z

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aggcaagaug cuggcauagc u 21

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

uggcaguguc uuagcugguu gu 22

Claims

1. The application of the yak milk exosome is characterized in that the yak milk exosome is applied to preparation of a medicine or food for treating intestinal injury caused by hypoxia, the yak milk exosome comprises bta-miRNA31 and bta-miRNA34a, and the sequences of the two miRNA are as follows:

bta-miRNA-31: AGGCAAGAUGCUGGCAUAGCU, and

bta-miRNA-34a:UGGCAGUGUCUUAGCUGGUUGU。

2. the use of yak milk exosome according to claim 1, wherein the yak milk exosome is used for preparing a medicament for activating a HIF hypoxia signaling pathway.

3. The use of the yak milk exosome according to claim 1, wherein the yak milk exosome is used for preparing a medicament for activating a p53 apoptosis signaling pathway.

4. The use of the yak milk exosome according to claim 1, wherein the yak milk exosome is used for preparing a medicament for activating a VEGF hypoxia signaling pathway.

5. The use of yak milk exosomes according to claim 1, wherein the food comprises milk beverage, cheese, yoghurt.

6. The modified yak milk exosome is characterized in that the yak milk exosome is an exosome with increased miRNA-31 and miRNA-34a contents, and the sequences of the two miRNAs are respectively as follows:

bta-miRNA-31: AGGCAAGAUGCUGGCAUAGCU, and

bta-miRNA-34a:UGGCAGUGUCUUAGCUGGUUGU。

7. the application of the miRNA derived from the yak milk exosomes is characterized in that the miRNA is used for preparing medicines or foods for treating intestinal injury caused by hypoxia, the miRNA is bta-mi-RNA31 and/or bta-mi-RNA34a, and the sequences of the two miRNAs are as follows:

bta-miRNA-31: AGGCAAGAUGCUGGCAUAGCU, and

bta-miRNA-34a:UGGCAGUGUCUUAGCUGGUUGU。