CN110484644A - A kind of the fingerprint map construction method and application of larch-tree germplasm - Google Patents
A kind of the fingerprint map construction method and application of larch-tree germplasm Download PDFInfo
- Publication number
- CN110484644A CN110484644A CN201910835241.0A CN201910835241A CN110484644A CN 110484644 A CN110484644 A CN 110484644A CN 201910835241 A CN201910835241 A CN 201910835241A CN 110484644 A CN110484644 A CN 110484644A
- Authority
- CN
- China
- Prior art keywords
- primer
- larch
- seq
- tree
- germplasm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000010276 construction Methods 0.000 title claims abstract description 19
- 238000000034 method Methods 0.000 claims abstract description 24
- 239000003147 molecular marker Substances 0.000 claims abstract description 12
- 238000012408 PCR amplification Methods 0.000 claims description 21
- 238000011144 upstream manufacturing Methods 0.000 claims description 15
- 238000004519 manufacturing process Methods 0.000 claims description 13
- 230000004087 circulation Effects 0.000 claims description 11
- 238000000137 annealing Methods 0.000 claims description 8
- 238000004925 denaturation Methods 0.000 claims description 7
- 230000036425 denaturation Effects 0.000 claims description 7
- 239000000203 mixture Substances 0.000 claims description 6
- 230000003321 amplification Effects 0.000 claims description 4
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 4
- 230000009182 swimming Effects 0.000 claims description 4
- 102000004190 Enzymes Human genes 0.000 claims description 3
- 108090000790 Enzymes Proteins 0.000 claims description 3
- 239000000872 buffer Substances 0.000 claims description 3
- 239000003086 colorant Substances 0.000 claims description 3
- 238000001917 fluorescence detection Methods 0.000 claims description 3
- 239000011159 matrix material Substances 0.000 claims description 3
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 3
- 239000012498 ultrapure water Substances 0.000 claims description 3
- BFMYDTVEBKDAKJ-UHFFFAOYSA-L disodium;(2',7'-dibromo-3',6'-dioxido-3-oxospiro[2-benzofuran-1,9'-xanthene]-4'-yl)mercury;hydrate Chemical compound O.[Na+].[Na+].O1C(=O)C2=CC=CC=C2C21C1=CC(Br)=C([O-])C([Hg])=C1OC1=C2C=C(Br)C([O-])=C1 BFMYDTVEBKDAKJ-UHFFFAOYSA-L 0.000 claims description 2
- 108020004414 DNA Proteins 0.000 description 49
- 108091092878 Microsatellite Proteins 0.000 description 30
- 239000000047 product Substances 0.000 description 12
- 238000001514 detection method Methods 0.000 description 9
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 5
- 239000000463 material Substances 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 241000218652 Larix Species 0.000 description 4
- 230000008901 benefit Effects 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 241000196324 Embryophyta Species 0.000 description 3
- 235000005590 Larix decidua Nutrition 0.000 description 3
- 238000009395 breeding Methods 0.000 description 3
- 230000001488 breeding effect Effects 0.000 description 3
- 238000005251 capillar electrophoresis Methods 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 235000019441 ethanol Nutrition 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 2
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- VYPSYNLAJGMNEJ-UHFFFAOYSA-N Silicium dioxide Chemical compound O=[Si]=O VYPSYNLAJGMNEJ-UHFFFAOYSA-N 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 230000006872 improvement Effects 0.000 description 2
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 2
- 238000002372 labelling Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 241000894007 species Species 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 206010020675 Hypermetropia Diseases 0.000 description 1
- 235000019687 Lamb Nutrition 0.000 description 1
- 241000534018 Larix kaempferi Species 0.000 description 1
- 235000008331 Pinus X rigitaeda Nutrition 0.000 description 1
- 235000011613 Pinus brutia Nutrition 0.000 description 1
- 241000018646 Pinus brutia Species 0.000 description 1
- 241000607479 Yersinia pestis Species 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 235000009508 confectionery Nutrition 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 238000005034 decoration Methods 0.000 description 1
- 229960000935 dehydrated alcohol Drugs 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000005611 electricity Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 229960004756 ethanol Drugs 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000011094 fiberboard Substances 0.000 description 1
- 125000001449 isopropyl group Chemical group [H]C([H])([H])C([H])(*)C([H])([H])[H] 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 239000004570 mortar (masonry) Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000004537 pulping Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000000377 silicon dioxide Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of fingerprint map construction method of larch-tree germplasm and applications.The present invention is constructed based on SSR molecular marker identification method, constructs 92 parts collected from China and the Japanese finger-print of the larch-tree germplasm of totally 10 provinces and cities and the technical system for carrying out Germplasm Identification using 9 pairs of SSR primers.The technical system can not only accurately and efficiently construct the finger-print of different larch-tree germplasm, moreover it is possible to identify larch-tree germplasm, be conducive to the utilization and protection of larch-tree germplasm.
Description
Technical field
The invention belongs to spe cies identification technical field more particularly to a kind of fingerprint map construction sides of larch-tree germplasm
Method and application.
Background technique
Larch-tree (Larix kaempferi (Lamb.) Carr.) is Pinaceae Larch, originates in Japanese Honshu
Island middle part, it is (Shandong, Henan, sweet in the temperate zone (Jilin, Liaoning, Inner Mongol etc.) in China, warm temperate zone from after introducing China
It is respectful etc.) and middle north subtropical (Hubei, Hunan, Sichuan etc.) alpine region promoted and applied rapidly, show resistance, pest and disease damage
Few, growth is fast, material superior properties, be increasingly becoming China's pulping and papermaking industry and high density fiberboard production chief species it
One, there is important economy and the ecological value.
Larch-tree is smaller in the distribution of Proterozoic, and as external exotic tree, domestic larch-tree is drawn
Kind of resource is limited, uses minority germplasm as breeding parent plus long-term high-frequency, so that the heredity of larch-tree resource
Basis is narrow, and the morphological difference between strain is small, difficult to realize by phenotypic character identification or to distinguish different Japan and fall
Leaf pine germplasm, this just increases difficulty to ore grade indexes and intellectual property protection.With the fast development of molecular biology, DNA
The new method that finger-print is analyzed as a kind of genetic germplasm can directly reflect plant genetic material in DNA molecular level
Difference, have many advantages, such as accurate, efficient, economical, not affected by environment.The labeling method of building DNA fingerprinting has at present
A variety of, SSR (simple sequence repeat) molecular labeling is since amplification is stable, reproducible, easy to operate, is easy to push away
Extensively, the most widely used label system of Plant new variety protection is regarded as by International Plant variety right alliance (UPOV).
Pcr amplification product is detected in particular with fluorescent marker, so that the testing result of polymorphism product is more accurate, to ensure that
Constructed finger-print has higher confidence level.In addition, DNA fingerprinting is for assistant breeding, hybrid identification, genetic diversity
Property analysis etc. all have important meaning.
However, carrying out day in building larch-tree germplasm DNA fingerprinting and using SSR molecular marker technology at present
There is not been reported for the method for this larch germplasm identification.
Summary of the invention
In order to solve the problems, such as existing larch-tree germ plasm resource without effective identification method, it is an object of the invention to mention
For a kind of construction method of the finger-print of larch-tree germplasm, it is possible to identify or auxiliary identification larch-tree germ plasm resource,
To comb Relationships among Germplasm Resources, carry out the selection of breeding parent, realize germ plasm resource scientific management and efficiently utilize and
Kind protection aspect lays the foundation.
In order to achieve the above-mentioned object of the invention, the present inventor by a large number of experiments research and unremitting effort, be finally obtained as
Lower technical solution: a kind of fingerprint map construction method of larch-tree germplasm, method includes the following steps:
(1) the larch-tree standard items for choosing different germplasm origins, extract genomic DNA respectively；It should be noted that
The present invention is not particularly limited the mode for how extracting genomic DNA, using manner known in the art.Have in the present invention
In the embodiment of body, using the CTAB extraction method of improvement, commercial reagent box can also be used or voluntarily according to extracting genome DNA
Method preparation.
(2) using each standard items genomic DNA as template, using (AGTCC)4+(GTCCA)6、(GA)9、(GA)13、(TC)6、
(CAG)5、(CTG)5、(ACTGGC)4、(AGGCGG)3(AGC)7One of or a variety of SSR molecular markers primer respectively into
Row PCR amplification；The larch-tree germplasm of separate sources has different embodiments in SSR molecular marker of the present invention, uses
The the primer of above-mentioned SSR molecular marker the more, and the finger-print specificity finally constructed is stronger.In the present invention, it is preferred to right
The product that PCR amplification obtains carries out capillary electrophoresis detection, to determine whether PCR product.
(3) the identifiable number of computer is converted by the PCR amplification result of each standard items genomic DNA, obtains Japan
The finger-print of larch germplasm.
It should be noted that in the present invention (AGTCC)4+(GTCCA)6、(GA)9、(GA)13、(TC)6、(CAG)5、(CTG)5、
(ACTGGC)4、(AGGCGG)3(AGC)7In number refer to the number that base in repetition bracket arranges.
It is each in step (2) it is further preferred that the fingerprint map construction method of larch-tree germplasm as described above
The primer of SSR molecular marker uses the fluorochrome label of different colours, color and modification mode of the present invention to fluorescent marker
It is not particularly limited, fluorescence detection can be realized in DNA sequencer.The primer sequence of SSR molecular marker specifically:
(AGTCC)4+(GTCCA)6Primer single-stranded primer as shown in SEQ ID NO:1 and SEQ ID NO:2 shown in
Single-stranded primer composition；
(GA)9Primer single-stranded primer as shown in SEQ ID NO:3 and SEQ ID NO:4 shown in single-stranded primer sets
At；
(GA)13Primer single-stranded primer as shown in SEQ ID NO:5 and SEQ ID NO:6 shown in single-stranded primer sets
At；
(TC)6Primer single-stranded primer as shown in SEQ ID NO:7 and SEQ ID NO:8 shown in single-stranded primer sets
At；
(CAG)5Primer single-stranded primer as shown in SEQ ID NO:9 and SEQ ID NO:10 shown in single-stranded primer sets
At；
(CTG)5Primer single-stranded primer as shown in SEQ ID NO:11 and SEQ ID NO:12 shown in single-stranded primer
Composition；
(ACTGGC)4Primer single-stranded primer as shown in SEQ ID NO:13 and SEQ ID NO:14 shown in single stranded primer
Object composition；
(AGGCGG)3Primer single-stranded primer as shown in SEQ ID NO:15 and SEQ ID NO:16 shown in single stranded primer
Object composition；
(AGC)7Primer single-stranded primer as shown in SEQ ID NO:17 and SEQ ID NO:18 shown in single-stranded primer
Composition；
It is further preferred that the fingerprint map construction method of larch-tree germplasm as described above, described in step (2)
The system that PCR amplification uses, every 15 μ L, comprising: 1.5 μ L, Buffer (Mg of dNTP2+Plus) 1.5 μ L, 0.2 μ L (5u/ μ of Taq enzyme
L), each 0.6 μ L of upstream and downstream primer, 1 μ L of template DNA, 9.6 μ L of ultrapure water；The upstream primer or downstream primer concentration are respectively
10 μm of ol/L, the concentration of genomic DNA template are 30ng/ μ L.
It is further preferred that the fingerprint map construction method of larch-tree germplasm as described above, described in step (2)
PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60~50 DEG C of annealing 30s, 72 DEG C of extension 45s, 30
Circulation；It is saved after 72 DEG C of extension 7min in 4 DEG C again；
The PCR amplification program uses Touch down PCR program, and the preceding each circulation of 20 circulations is moved back in 30 circulations
Fiery temperature reduces by 0.5 DEG C, and annealing temperature is maintained at remaining 10 circulations of 50 DEG C of completions.
It, will be each in step (3) it is further preferred that the fingerprint map construction method of larch-tree germplasm as described above
The PCR amplification result of standard items is converted into the identifiable number of computer: PCR product carries out automatic glimmering in DNA sequencer
Light detection analyzes initial data with GeneMarker software, by the position of each peak value and same swimming lane GL500 intramolecular
Mark is compared, and obtains the length value of SSR amplified production, is lacked the SSR molecular marker amplified production and is counted as " 000 ", conversion
For the matrix being arranged successively, the finger-print of the identifiable larch-tree germplasm of computer is obtained.
The present invention is not particularly limited the source of larch-tree standard items, is including but not limited to originated from Chinese Collection and conservation
And source area Japan larch-tree.Therefore it is further preferred that the fingerprint image of larch-tree germplasm as described above
Construction method is composed, larch-tree standard items are LK001~LK092 in 1 table 1 of embodiment in step (1), amount to 92 Japan
Larch germplasm standard items material.
In addition, the present invention provides the finger-prints of above method building in the larch-tree for distinguishing different germplasm origins
In application.Specific application method are as follows: the genomic DNA for extracting larch-tree sample to be measured, using in above-mentioned steps (2)
The primer of identical SSR molecular marker carries out PCR amplification, according to position of the amplification in the finger-print, judge to
The germplasm origin of sample.
Compared with prior art, the construction method and Germplasm Identification of larch-tree germplasm finger-print provided by the invention
Method has the following advantages that and significant progress:
(1) 9 pairs of SSR primers have been selected, have been carried out using the primer pair larch-tree sample DNA of this 9 pairs of SSR molecular markers
It expands, on same SSR molecular marker site, the length for the SSR amplified production that the larch-tree germ plasm resource of separate sources obtains
It spends different, the larch-tree of different germplasm origins can be fast and effeciently distinguished according to the difference of product length.In addition
Finger-print is converted the identifiable finger-print of computer by the present invention, is directly retrieved using computer, is as a result compared
It is easily and fast again accurate.
(2) present invention uses Touch down PCR program, can effectively avoid determining best annealing temperature for different primers
Reaction optimization and the setting up procedure of degree and the complexity of progress, all 9 pairs of primers can get ideal under the setting of same PCR program
Expanding effect.
(3) present invention carries out PCR amplification using fluorescent marker, carries out pcr amplification product detection, benefit using DNA sequencer
Traditional polyacrylamide gel electrophoresis is replaced with Capillary Electrophoresis, different pcr amplification products can be pressed fluorescence color and production
It is detected simultaneously after object clip size reasonable combination, carries out the interpretation of result batch using software, examined with polyacrylamide gel electrophoresis
Survey method is compared, and detection data is more accurate, and detection efficiency is higher, have the advantages that it is quick, easy, reliable and high-throughput, and
And with the continuous development of molecular marking technique, the cost of capillary electrophoresis detection method is lower and lower, is particularly suitable for extensive
Detection.
Specific embodiment
Following embodiment further describes the implementation process and beneficial effect of the method for the present invention, and embodiment is only used for illustration
Purpose does not limit the scope of the invention, while the obvious change that those of ordinary skill in the art are made according to the present invention
It is also contained within the scope of the invention.
In the present invention, described (AGTCC)4+(GTCCA)6Primer preferably as shown in sequence 1 and sequence 2:
Upstream primer sequence 1:GGCTGAGGTTGCGAAAGA
Downstream primer sequence 2:CAATTACATAAGTGGGACGAGA
In the present invention, described (GA)9Primer preferably as shown in sequence 3 and sequence 4:
Upstream primer sequence 3:TCTGAATCAATGTATCATGTATCGAA
Downstream primer sequence 4:CTGTCAGTCATGCTGCGTTT
In the present invention, described (GA)13Primer preferably as shown in sequence 5 and sequence 6:
Upstream primer sequence 5:TCCATCTTTATTTGGCAGGC
Downstream primer sequence 6:CCATCAGAGATGGGAGTGCT
In the present invention, described (TC)6Primer preferably as shown in sequence 7 and sequence 8:
Upstream primer sequence 7:AGTGGCAGTCAGCATCTCCT
Downstream primer sequence 8:AGAAGATTTTGCAGAGGGCA
In the present invention, described (CAG)5Primer preferably as shown in sequence 9 and sequence 10:
Upstream primer sequence 9:AGGCGTCTGAGCTACCAAAA
Downstream primer sequence 10:CGACGACACCCAATACCTTT
In the present invention, described (CTG)5Primer preferably as shown in sequence 11 and sequence 12:
Upstream primer sequence 11:AAACCAATGAAAATGCCTGC
Downstream primer sequence 12:TCCCCAGCCAACTCTCATAC
In the present invention, described (ACTGGC)4Primer preferably as shown in sequence 13 and sequence 14:
Upstream primer sequence 13:AGCGTATGAATTGGTCCAGG
Downstream primer sequence 14:ACGAAGATAGCTCGAACGGA
In the present invention, described (AGGCGG)3Primer preferably as shown in sequence 15 and sequence 16:
Upstream primer sequence 15:TAAATACGCACAAGCCCACA
Downstream primer sequence 16:GGAGGAGCAAATGGATCAAA
In the present invention, described (AGC)7Primer preferably as shown in sequence 17 and sequence 18:
Upstream primer sequence 17:AATTCGTTGGCCTTCAGATG
Downstream primer sequence 18:CGATCTCGGGCATTATGAGT
Embodiment 1 constructs the application of larch-tree germplasm finger-print using 9 pairs of SSR primers
1, larch-tree extracting genome DNA
Referring to the CTAB method of improvement, concrete operations are as follows:
1) tender, the clean blade of the children of larch-tree difference variety standard product material is acquired, be stored in after silica dehydrator-
80 DEG C of refrigerators；
2) 1g standard items are worn into fine powdered with liquid nitrogen in mortar, and is put immediately in the case where protection of liquid nitrogen is added
Enter 2mL centrifuge tube, while the DNA extracting buffer solution of 65 DEG C of 800 μ L preheatings being added immediately, is then placed in 65 DEG C of water-baths
30~45min of water-bath, every 5min slightly overturns lower centrifuge tube during water-bath；
3) isometric chloroform: isoamyl alcohol (24:1, v/v) is added after being cooled to room temperature after water-bath, mild overturning 50 times with
Up to being sufficiently mixed uniformly, room temperature is centrifuged 12000rmp10 min；
4) it takes supernatant in new centrifuge tube, is extracted again by previous step 1 time；
5) step 4) is repeated；
6) it after extracting, takes supernatant in new centrifuge tube, and the isopropyl of 0.6~1.0 times of -20 DEG C of volume pre-cooling is added
Alcohol, and it is statically placed in 1h or more at -20 DEG C；
7) it is respectively washed once with 75% ethyl alcohol and dehydrated alcohol；
8) it outwells alcohol to air-dry, adds 50 μ L ddH2O dissolving DNAs, 4 DEG C of preservations；
9) a small amount of its purity of DNA electrophoresis detection is taken out, and measures DNA concentration using ultraviolet specrophotometer, by DNA solution
It is spare to be diluted to 30ng/ μ L.
The genomic DNA of 92 larch-tree variety standard product materials shown in table 1 is extracted using the above method.
1 larch-tree variety standard product material of table
2, SSR primer sequence
9 pairs of SSR primers shown in artificial synthesized table 2, and add different colours fluorescent decoration.Primer is by the farsighted Boxing section in Beijing
Bioisystech Co., Ltd provides.
2 larch-tree SSR primer sequence of table
3, SSR-PCR is expanded
PCR amplification is carried out using above-mentioned 9 pairs of primer pairs larch-tree sample gene group DNA, reaction system and program are such as
Under:
1) PCR amplification uses 15 μ L systems, comprising: 1.5 μ L, Buffer (Mg of dNTP2+Plus) 1.5 μ L, 0.2 μ L of Taq enzyme
(5u/ μ L), each 0.6 μ L of upstream and downstream primer, 1 μ L of template DNA, 9.6 μ L of ultrapure water.Upstream primer or downstream primer concentration are independently
For 10 μm of ol/L, the concentration of genomic DNA template is 30ng/ μ L.Reagent is provided by TAKARA company.
2) PCR amplification uses Touch down PCR program: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60~50 DEG C are moved back
Fiery 30s, 72 DEG C of extension 45s, 20 circulations, each cycle annealing temperature reduce by 0.5 DEG C；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s,
72 DEG C of extension 45s, 10 circulations；It is saved after 72 DEG C of extension 7min in 4 DEG C.Using PE9700 type PCR instrument (Applied
Biosystems, USA) operation PCR reaction.
9 pairs of SSR amplified productions of 92 larch-tree germplasm are obtained according to the above method.
4, electrophoresis detection and finger-print is constructed
Pcr amplification product is subjected to automatic fluorescence detection on ABI 3730XLDNA sequenator, is used
GeneMarker2.2.0 software analyzes initial data, by the position of each peak value and same 500 endogenous control of swimming lane GL
It is compared, obtains the length value of SSR amplified production, be entered into Excel, lack the SSR molecular marker amplified production meter
Make " 000 ", amplified production length value is arranged successively as matrix, the identifiable larch-tree Germplasm Identification of computer is obtained
Finger-print.The finger-print of 92 larch-tree germplasm is as shown in table 3.
The finger-print of 3 larch-tree germplasm of table
* digital representation kind DNA is expanded using SSR primer, and the SSR amplification read on automatic fluorescence detector produces
The length value of object.Each pair of primer reads two values, arranges according to sequence from small to large.
Embodiment 2 carries out Germplasm Identification using the larch-tree germplasm finger-print of building
1, the DNA of larch-tree germplasm is extracted
The method for using embodiment 1 is extracted in 1 range of table, interim number is U01, U02, U03, U04 and U05
The genomic DNA of 5 parts of larch-tree germplasm.
2, the SSR-PCR amplification of larch-tree germplasm
Using above-mentioned 5 parts of larch-tree germplasm genomic DNAs template, using embodiment 19 pairs of SSR primers respectively into
Row PCR amplification obtains the amplified production of 9 pairs of SSR primers of 5 parts of larch-tree germplasm.
3, electrophoresis and finger-print is constructed
The amplified production of 9 pairs of SSR primers of above-mentioned 5 portions of larch-trees germplasm is subjected to electricity according to the method for embodiment 1
Swimming detects and constructs SSR finger-print, and the results are shown in Table 4.
The SSR finger-print of 5 parts of larch-tree germplasm is compared with the SSR finger-print of each germplasm in table 3,
The finger-print of middle U01 and LK030, U02 and LK048, U03 and LK062, U04 and LK073, U05 and LK083 are completely the same, then
Determine that 5 parts of larch-tree germplasm are respectively LK030, LK048, LK062, LK073 and LK083.
The finger-print of 4 larch-tree kind quality sample of table
Sequence table
<110>Hubei Forestry Science Academy
<120>a kind of fingerprint map construction method and application of larch-tree germplasm
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ggctgaggtt gcgaaaga 18
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caattacata agtgggacga ga 22
<210> 3
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tctgaatcaa tgtatcatgt atcgaa 26
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ctgtcagtca tgctgcgttt 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tccatcttta tttggcaggc 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ccatcagaga tgggagtgct 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
agtggcagtc agcatctcct 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
agaagatttt gcagagggca 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
aggcgtctga gctaccaaaa 20
<210> 10
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cgacgacacc caataccttt 20
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
aaaccaatga aaatgcctgc 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
tccccagcca actctcatac 20
<210> 13
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
agcgtatgaa ttggtccagg 20
<210> 14
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
acgaagatag ctcgaacgga 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
taaatacgca caagcccaca 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
ggaggagcaa atggatcaaa 20
<210> 17
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
aattcgttgg ccttcagatg 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
cgatctcggg cattatgagt 20
Claims (7)
1. a kind of fingerprint map construction method of larch-tree germplasm, which is characterized in that method includes the following steps:
(1) the larch-tree standard items for choosing different germplasm origins, extract genomic DNA respectively；
(2) using each standard items genomic DNA as template, using (AGTCC)4+(GTCCA)6、(GA)9、(GA)13、(TC)6、
(CAG)5、(CTG)5、(ACTGGC)4、(AGGCGG)3(AGC)7One of or a variety of SSR molecular markers primer respectively into
Row PCR amplification；
(3) the identifiable number of computer is converted by the PCR amplification result of each standard items genomic DNA, obtains Japanese fallen leaves
The finger-print of loose germplasm.
2. the fingerprint map construction method of larch-tree germplasm according to claim 1, which is characterized in that step (2)
In each SSR molecular marker primer use different colours fluorochrome label, sequence specifically:
(AGTCC)4+(GTCCA)6Primer single-stranded primer as shown in SEQ ID NO:1 and SEQ ID NO:2 shown in it is single-stranded
Primer composition；
(GA)9Primer single-stranded primer shown in SEQ ID NO:3 and SEQ ID NO:4 shown in single-stranded primer form；
(GA)13Primer single-stranded primer shown in SEQ ID NO:5 and SEQ ID NO:6 shown in single-stranded primer form；
(TC)6Primer single-stranded primer shown in SEQ ID NO:7 and SEQ ID NO:8 shown in single-stranded primer form；
(CAG)5Primer single-stranded primer shown in SEQ ID NO:9 and SEQ ID NO:10 shown in single-stranded primer form；
(CTG)5Primer single-stranded primer shown in SEQ ID NO:11 and SEQ ID NO:12 shown in single-stranded primer form；
(ACTGGC)4Primer single-stranded primer as shown in SEQ ID NO:13 and SEQ ID NO:14 shown in single-stranded primer sets
At；
(AGGCGG)3Primer single-stranded primer as shown in SEQ ID NO:15 and SEQ ID NO:16 shown in single-stranded primer sets
At；
(AGC)7Primer single-stranded primer shown in SEQ ID NO:17 and SEQ ID NO:18 shown in single-stranded primer form.
3. the fingerprint map construction method of larch-tree germplasm according to claim 1, which is characterized in that step (2)
Described in the system that uses of PCR amplification, every 15 μ L, comprising: dNTP 1.5 μ L, Buffer 1.5 μ L, 0.2 μ L of Taq enzyme, upstream and downstream
Each 0.6 μ L of primer, 1 μ L of template DNA, 9.6 μ L of ultrapure water；The upstream primer or downstream primer concentration are respectively 10 μm of ol/L,
The concentration of genomic DNA template is 30ng/ μ L.
4. the fingerprint map construction method of larch-tree germplasm according to claim 1, which is characterized in that step (2)
Described in PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60~50 DEG C of annealing 30s, 72 DEG C extend
45s, 30 circulations；It is saved after 72 DEG C of extension 7min in 4 DEG C again；
The PCR amplification program uses Touch down PCR program, each cycle annealing temperature of preceding 20 circulations in 30 circulations
Degree reduces by 0.5 DEG C, and annealing temperature is maintained at remaining 10 circulations of 50 DEG C of completions.
5. the fingerprint map construction method of larch-tree germplasm according to claim 1, which is characterized in that step (3)
Middle to convert the identifiable number of computer for the PCR amplification result of each standard items and be: PCR product carries out in DNA sequencer
Automatic fluorescence detection analyzes initial data with GeneMarker software, by the position of each peak value and same swimming lane GL500
Endogenous control is compared, and obtains the length value of SSR amplified production, is lacked the SSR molecular marker amplified production and is counted as
" 000 " is converted into the matrix being arranged successively, and obtains the finger-print of the identifiable larch-tree germplasm of computer.
6. the fingerprint map construction method of larch-tree germplasm described in -5 any one, feature exist according to claim 1
In larch-tree standard items are LK001~LK092 in step (1).
7. a kind of side of the fingerprint identification larch-tree germplasm using the building of claim 1-5 any one the method
Method, which is characterized in that the genomic DNA for extracting larch-tree sample to be measured, using identical SSR in the step (2) points
The primer of son label carries out PCR amplification and judges the germplasm of sample to be tested according to position of the amplification in the finger-print
Source.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910835241.0A CN110484644B (en) | 2019-09-05 | 2019-09-05 | Fingerprint construction method and application of larch germplasm |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910835241.0A CN110484644B (en) | 2019-09-05 | 2019-09-05 | Fingerprint construction method and application of larch germplasm |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110484644A true CN110484644A (en) | 2019-11-22 |
| CN110484644B CN110484644B (en) | 2023-11-07 |
Family
ID=68556516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910835241.0A Active CN110484644B (en) | 2019-09-05 | 2019-09-05 | Fingerprint construction method and application of larch germplasm |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110484644B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110172525A (en) * | 2019-06-26 | 2019-08-27 | 广西壮族自治区林业科学研究院 | Forest difference expression gene SSR primer sets and polymorphism SSR marker development approach |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557362A (en) * | 2017-10-26 | 2018-01-09 | 南京林业大学 | A kind of authentication method of masson pine cpSSR polymorphism primers and its pine tree sibling species |
| CN109517920A (en) * | 2018-11-27 | 2019-03-26 | 江苏省中国科学院植物研究所 | A kind of construction method of the finger-print of eremochloa ophiuroides germplasm and application |
-
2019
- 2019-09-05 CN CN201910835241.0A patent/CN110484644B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557362A (en) * | 2017-10-26 | 2018-01-09 | 南京林业大学 | A kind of authentication method of masson pine cpSSR polymorphism primers and its pine tree sibling species |
| CN109517920A (en) * | 2018-11-27 | 2019-03-26 | 江苏省中国科学院植物研究所 | A kind of construction method of the finger-print of eremochloa ophiuroides germplasm and application |
Non-Patent Citations (3)
| Title |
|---|
| CHEN ET AL.: "Development and Characterization of Polymorphic Genic-SSR Markers in Larix kaempferi", 《MOLECULES》 * |
| JEAN-CHARLES BASTIEN ET AL.: "Molecular markers used for genetic studies in Japanese Larch (Larix kaempferi (Lamb.) Carr.)", 《SILVA SLOVENICA》 * |
| 杨秀艳等: "日本落叶松EST-SSR标记开发及二代优树遗传多样性分析", 《林业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110172525A (en) * | 2019-06-26 | 2019-08-27 | 广西壮族自治区林业科学研究院 | Forest difference expression gene SSR primer sets and polymorphism SSR marker development approach |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110484644B (en) | 2023-11-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102732973B (en) | Construction method for DNA fingerprint database of high flux cotton variety | |
| CN107326077A (en) | A kind of molecular labeling for differentiating spotted maigre genetic sex and its application | |
| CN107557369A (en) | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method | |
| CN113430300B (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| CN105349671B (en) | Microsatellite sequence and screening technique suitable for clean brook crow soft-shelled turtle population analysis | |
| CN104342434B (en) | The method for identifying molecules of cotton cells matter male sterile restoring line | |
| CN107586867A (en) | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method | |
| CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
| CN108753987A (en) | A kind of method of the general microsatellite Multiplex fluorescent PCR of silver carp flathead | |
| CN103436611A (en) | PCR-RFLP rapid detection method for common sturgeons | |
| CN106148526B (en) | One kind molecular labeling Hf1-Indel relevant to watermelon flesh hardness and its application | |
| CN106978504A (en) | A kind of preparation method and application of spinach SSR marker | |
| CN107475418A (en) | With molecular labeling, primer and the application of millet tiller character close linkage | |
| CN107881256A (en) | For identifying single nucleotide polymorphism site, primer pair, kit and the application of Peach fruits hardship benevolence/sweet tea benevolence character | |
| CN112029894B (en) | SSR-labeled fingerprint of sabina pterata as well as construction method and application thereof | |
| CN110484644A (en) | A kind of the fingerprint map construction method and application of larch-tree germplasm | |
| CN104046697B (en) | Based on the Fraxinus velutina transcript profile order-checking SSR primer sets of information development and the application in Idioplasm identification thereof | |
| Chaveerach et al. | Molecular identification and barcodes for the genus Nymphaea | |
| CN107760796A (en) | A kind of SSR molecular marker primer of Rapid identification locust tree polyploid | |
| CN102492773B (en) | Chip for screening 16SrI group phytoplasmas and application thereof | |
| CN106636327B (en) | A kind of bluish dogbean micro satellite DNA label finger-print and its application | |
| CN111733273A (en) | DNA barcode sequence and method for identifying lycium species by using same | |
| CN106755288B (en) | Molecular identification method of lotus leaf of tongshan | |
| CN110257551A (en) | A set of SSR primer, application and construction method for being used to construct peach DNA fingerprinting | |
| CN108707650A (en) | A kind of high-throughput cotton variety fingerprint base construction method based on the detection of four color fluorescence electrophoresis of capillary and multiple fluorescence PCR amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Sun Xiaomei Inventor after: Du Chaoqun Inventor after: Xie Yunhui Inventor after: Feng Jian Inventor after: Xu Yezhou Inventor after: Yuan Hui Inventor before: Du Chaoqun Inventor before: Xie Yunhui Inventor before: Sun Xiaomei Inventor before: Feng Jian Inventor before: Xu Yezhou Inventor before: Yuan Hui |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230808 Address after: No.2 dongxiaofu, Haidian District, Beijing Applicant after: INSTITUTE OF FORESTRY, CHINESE ACADEMY OF FORESTRY Applicant after: HUBEI ACADEMY OF FORESTRY Address before: 430075 No.1 shizifengte, Jiufeng, Donghu New Technology Development Zone, Wuhan City, Hubei Province Applicant before: HUBEI ACADEMY OF FORESTRY |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |