CN110483432A - A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes - Google Patents

A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes Download PDF

Info

Publication number
CN110483432A
CN110483432A CN201810457963.2A CN201810457963A CN110483432A CN 110483432 A CN110483432 A CN 110483432A CN 201810457963 A CN201810457963 A CN 201810457963A CN 110483432 A CN110483432 A CN 110483432A
Authority
CN
China
Prior art keywords
unsubstituted
substituted
alkyl
group
base
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810457963.2A
Other languages
Chinese (zh)
Inventor
柳红
刘浥
王江
陈亚琼
王一冰
蒋华良
陈凯先
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Shanghai Institute of Materia Medica of CAS
Original Assignee
Fudan University
Shanghai Institute of Materia Medica of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Institute of Materia Medica of CAS filed Critical Fudan University
Priority to CN201810457963.2A priority Critical patent/CN110483432A/en
Priority to PCT/CN2019/086905 priority patent/WO2019219016A1/en
Priority to CN201980032898.1A priority patent/CN112204018B/en
Publication of CN110483432A publication Critical patent/CN110483432A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/15—Oximes (>C=N—O—); Hydrazines (>N—N<); Hydrazones (>N—N=) ; Imines (C—N=C)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/155—Amidines (), e.g. guanidine (H2N—C(=NH)—NH2), isourea (N=C(OH)—NH2), isothiourea (—N=C(SH)—NH2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/18—Sulfonamides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/194—Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/421—1,3-Oxazoles, e.g. pemoline, trimethadione
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/422—Oxazoles not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/423—Oxazoles condensed with carbocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/426—1,3-Thiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/427—Thiazoles not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/428—Thiazoles condensed with carbocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C15/00—Cyclic hydrocarbons containing only six-membered aromatic rings as cyclic parts
    • C07C15/12—Polycyclic non-condensed hydrocarbons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C15/00—Cyclic hydrocarbons containing only six-membered aromatic rings as cyclic parts
    • C07C15/12—Polycyclic non-condensed hydrocarbons
    • C07C15/14—Polycyclic non-condensed hydrocarbons all phenyl groups being directly linked
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C07C233/01—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/02—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having nitrogen atoms of carboxamide groups bound to hydrogen atoms or to carbon atoms of unsubstituted hydrocarbon radicals
    • C07C233/11—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having nitrogen atoms of carboxamide groups bound to hydrogen atoms or to carbon atoms of unsubstituted hydrocarbon radicals with carbon atoms of carboxamide groups bound to carbon atoms of an unsaturated carbon skeleton containing six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C279/00—Derivatives of guanidine, i.e. compounds containing the group, the singly-bound nitrogen atoms not being part of nitro or nitroso groups
    • C07C279/20—Derivatives of guanidine, i.e. compounds containing the group, the singly-bound nitrogen atoms not being part of nitro or nitroso groups containing any of the groups, X being a hetero atom, Y being any atom, e.g. acylguanidines
    • C07C279/22—Y being a hydrogen or a carbon atom, e.g. benzoylguanidines
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C279/00—Derivatives of guanidine, i.e. compounds containing the group, the singly-bound nitrogen atoms not being part of nitro or nitroso groups
    • C07C279/20—Derivatives of guanidine, i.e. compounds containing the group, the singly-bound nitrogen atoms not being part of nitro or nitroso groups containing any of the groups, X being a hetero atom, Y being any atom, e.g. acylguanidines
    • C07C279/24—Y being a hetero atom
    • C07C279/26—X and Y being nitrogen atoms, i.e. biguanides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C311/00—Amides of sulfonic acids, i.e. compounds having singly-bound oxygen atoms of sulfo groups replaced by nitrogen atoms, not being part of nitro or nitroso groups
    • C07C311/50—Compounds containing any of the groups, X being a hetero atom, Y being any atom
    • C07C311/51—Y being a hydrogen or a carbon atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/612—Esters of carboxylic acids having a carboxyl group bound to an acyclic carbon atom and having a six-membered aromatic ring in the acid moiety
    • C07C69/618—Esters of carboxylic acids having a carboxyl group bound to an acyclic carbon atom and having a six-membered aromatic ring in the acid moiety having unsaturation outside the six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/02—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings
    • C07D241/04—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/08—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
    • C07D263/16—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D263/18—Oxygen atoms
    • C07D263/20—Oxygen atoms attached in position 2
    • C07D263/22—Oxygen atoms attached in position 2 with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to other ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/08—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
    • C07D263/16—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D263/18—Oxygen atoms
    • C07D263/20—Oxygen atoms attached in position 2
    • C07D263/26—Oxygen atoms attached in position 2 with hetero atoms or acyl radicals directly attached to the ring nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/52—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems
    • C07D263/54—Benzoxazoles; Hydrogenated benzoxazoles
    • C07D263/58—Benzoxazoles; Hydrogenated benzoxazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/52—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems
    • C07D263/62—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems having two or more ring systems containing condensed 1,3-oxazole rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D265/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom and one oxygen atom as the only ring hetero atoms
    • C07D265/28—1,4-Oxazines; Hydrogenated 1,4-oxazines
    • C07D265/30—1,4-Oxazines; Hydrogenated 1,4-oxazines not condensed with other rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/08—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
    • C07D277/12—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D277/14—Oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/08—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
    • C07D277/12—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D277/18—Nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62—Benzothiazoles
    • C07D277/68—Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
    • C07D295/10—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by doubly bound oxygen or sulphur atoms
    • C07D295/104—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by doubly bound oxygen or sulphur atoms with the ring nitrogen atoms and the doubly bound oxygen or sulfur atoms attached to the same carbon chain, which is not interrupted by carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/10—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a carbon chain containing aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/10—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/10—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing aromatic rings
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Abstract

The present invention provides a kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes, and specifically, the present invention provides a kind of such as following formula I compound represented, wherein the definition of each group is as noted in the discussion.The compound can be used as CREB/CRTC2 interaction inhibitor, be used to prepare the pharmaceutical composition of the diseases such as treatment diabetes.

Description

A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes
Technical field
The present invention relates to pharmaceutical chemistry and field of medicaments, and in particular to a kind of acrylic compounds, contain preparation method The pharmaceutical composition of such compound and as CREB/CRTC2 interaction inhibitor, especially prepares for treating the diseases such as diabetes The purposes of the drug of disease.
Background technique
CREB/CRTC2(cAMP-responsive element-binding protein/CREB-regulated Transcription co-activator 2) relevant to the blood glucose biological clock of transcription complex adjust it is associated.Hepatic gluconeogenic The Showed Very Brisk of effect is to lead to the higher one of the main reasons of type 2 diabetes patient's blood glucose till, and even more patient occurs The main arch-criminal of hyperglycemia.Domestic and international research institution confirms that the formation of CREB/CRTC2 transcription complex is to open in liver The key link of dynamic hepatic gluconeogenic effect.Under starvation, glucagon passes through 3,5- ring adenosine monophosphate (cAMP) signal CREB transcriptional activators in Pathway Activation liver cell, and then raise the key enzyme in two hepatic gluconeogenic approach: glucose- The expression of 6- phosphatase (G6Pase) and phosphoenolpyruvate carboxykinase (PEPCK).In recent years, research shows that CRTC family (CRTC1, CRTC 2 and CRTC 3) is potent CREB transcriptional coactivator, and wherein CRTC2 expresses highest in liver.In liver In cell, the CRTC2 of unactivated state, which is in, to be continued to be combined by the state of kinases SIK2 phosphorylation with 14-3-3 albumen.When After glucagon is in conjunction with the glucagon receptor on liver plasma membrane, inhibit SIK2 living by cAMP-PKA cascade reaction Property, make CRTC2 that dephosphorylation occur and be detached from 14-3-3 albumen, the CRTC2 after dephosphorylation is transferred to nucleus and CREB is tied It closes, the CREB/CRTC2 transcription complex of formation can effectively raise the gene expression of CREB control.In type-2 diabetes mellitus mould In type mouse, the abnormal up-regulation of the activity of CREB/CRTC2 transcription complex, this is one of the main reason for leading to hyperglycemia. Therefore, the formation for interfering CREB/CRTC2 transcription complex is that the potential prevention and treatment type-2 diabetes mellitus of tool especially has The new target drone of the type-2 diabetes mellitus of hyperglycemia phenotype.
Summary of the invention
It is an object of the present invention to provide acrylic acid derivative class compound shown in a kind of general formula I and general formula II or Its pharmaceutically acceptable salt, racemic modification, R- isomers or S- isomers or their mixture.
It is another object of the present invention to provide acrylic acid derivative classes shown in a kind of above-mentioned general formula I and general formula II Close the preparation method of object.
It is yet a further object of the present invention to provide a kind of pharmaceutical compositions, and it includes therapeutically effective amounts selected from above-mentioned logical Acrylic acid derivative class compound, its pharmaceutical salt, racemic modification, R- isomers, S- isomers shown in Formulas I and general formula II Or one of their mixture or a variety of.
Yet another object of the invention is that providing a kind of CREB/CRTC2 interaction inhibitor, it includes be selected from above-mentioned Formulas I And acrylic acid derivative class compound or its pharmaceutically acceptable salt shown in general formula II, racemic modification, R- isomers, S- are different One of structure body or their mixture are a variety of.
Yet another object of the invention is that providing acrylic acid derivative class chemical combination shown in above-mentioned general formula I and general formula II Object, its pharmaceutical salt, racemic modification, R- isomers, S- isomers or their mixture are in preparation for treatment and CREB/ Purposes in the drugs of diseases such as the relevant diabetes of CRTC2 interaction inhibitor.
Yet another object of the invention is that providing a kind for the treatment of relevant to CREB/CRTC2 interaction inhibitor diabetes The method of equal disease medicaments comprising be selected from propylene shown in above-mentioned general formula I and general formula II to needing the patient of the treatment to be administered One in acid derivative class compound, its pharmaceutical salt, racemic modification, R- isomers, S- isomers or their mixture Kind is a variety of.
Based on above-mentioned purpose, the present invention provides one kind to have acrylic acid derivative shown in following general formula I and general formula II Class compound or its pharmaceutically acceptable salt, racemic modification, R- isomers or S- isomers or their mixture:
The first aspect of the present invention provides a kind of acrylic acid derivative class chemical combination with structure shown in following general formula I Object or its racemic modification, R- isomers, S- isomers, pharmaceutically acceptable salt or their mixture:
Wherein:
A is selected from the group: 3~12 yuan of saturated carbon rings, contain 1~8 heteroatomic 3~12 yuan at 3~12 yuan of unsaturated carbocyclics Heterocycle, C6~C10 aromatic ring or the heteroatomic 5-12 member hetero-aromatic ring containing 1~4 in oxygen, sulphur and nitrogen；
R1It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, substitution or not Substituted C1~C6 alkyl, substituted or unsubstituted C1~C6 alkoxy, substituted or unsubstituted C6~C10 aryl, replace or Heterocycle, the substituted or unsubstituted C1~C6 alkane of the unsubstituted heteroatomic 5-7 member containing 1~3 in oxygen, sulphur and nitrogen Base-phenyl, substituted or unsubstituted C1~C6 alkyl-(contain 1~3 heteroatomic 5-7 member heteroaryl selected from oxygen, sulphur and nitrogen Base), substituted or unsubstituted C3~C12 naphthenic base, substituted or unsubstituted C2~C10 acyl group, substituted or unsubstituted C2~ C10 ester group, substituted or unsubstituted C6~C10 aryloxy group, substituted or unsubstituted C1~C6 amide groups ,-OSO2R5、- OCOR5、-COR5、-SO2R5；
A is 1,2,3,4,5,6,7,8,9,10 or 11；
X is N (CH2)cR3, O or S；
B is 0,1,2,3,4,5；
C is 0,1,2,3,4,5；
R2And R3Be each independently selected from the following group: nothing, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, takes hydrogen Generation or unsubstituted amidino groups (- C (=NH) NH2), substituted or unsubstituted guanidine radicals (- NH-C (=NH) NH2), it is substituted or unsubstituted C1~C6 alkyl, containing 1-7 fluorine atom replace C1~C3 alkyl, substituted or unsubstituted C1~C6 alkoxy, replace Or unsubstituted C6~C10 aryl, the substituted or unsubstituted heteroatomic 5-12 member containing 1~3 in oxygen, sulphur and nitrogen Heterocycle, substituted or unsubstituted C1~C6 alkyl phenyl, substituted or unsubstituted C1~C6 alkyl-(5-7 unit's heteroaryl), take Generation or unsubstituted C3~C12 naphthenic base, substituted or unsubstituted C2~C10 acyl group, substituted or unsubstituted C2~C10 ester Base, substituted or unsubstituted C1~C6 amide groups ,-SO2R5、-COR5；
Or-(CH2)b-R2、-(CH2)c-R3Ring selected from the group below is collectively formed with the X atom being connected: substituted or unsubstituted Containing 1~8 heteroatomic 3~12 circle heterocyclic ring (including monocycle or bicyclic), it is substituted or unsubstituted containing 1~4 selected from oxygen, Heteroatomic 5-12 member hetero-aromatic ring (including monocycle or bicyclic) in sulphur and nitrogen；
The substitution refers to that one or more hydrogen atoms on group are replaced by substituent group selected from the group below: deuterium, tritium, halogen Element, cyano, amino, hydroxyl, nitro, aldehyde radical, oxygen atom (=O), C1~C6 alkyl, the C1 containing the substitution of 1-7 fluorine atom~ C3 alkyl, C6~C10 aryl, contains the miscellaneous of 1~3 heteroatomic 5-12 member in oxygen, sulphur and nitrogen at C1~C6 alkoxy Ring, C1~C6 alkyl-phenyl, C1~C6 alkyl diphenyl base, C1~C6 alkyl-(5-7 unit's heteroaryl), C3~C12 naphthenic base, C2 ~C10 acyl group, C2~C10 ester group, C6~C10 aryloxy group, C1~C6 amide groups ,-C (=NH) N (R5)2,-NH-C (=NH) N (R5)2、-COR5、-OSO2R5、-OCOR5、-SO2R5；
R5It is selected from the group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, oxygen atom (=O), C1~C6 Alkyl, C1~C6 alkoxy, C6~C10 aryl, is selected from containing 1~3 the C1~C3 alkyl replaced containing 1-7 fluorine atom The heterocycle of heteroatomic 5-7 member in oxygen, sulphur and nitrogen, C1~C6 alkyl phenyl, C1~C6 alkyl 5-7 unit's heteroaryl, C3~C12 Naphthenic base, C2~C10 acyl group, C2~C10 ester group, C2~C10 aryloxy group, C1~C6 amide groups.
In another preferred example, the compound has the structure as shown in Formula Il:
Wherein,
X is N；
Y is CH2、CO、NH、O、S、SO2；
Z is CH2、CO、NH、O、S、SO2；
D is 0,1,2,3；
E is 0,1,2,3；
B is selected from the group: nothing, 3~12 yuan of saturated carbon rings, 3~12 yuan of unsaturated carbocyclics, containing 1~8 heteroatomic 3~ The hetero-aromatic ring of 12 circle heterocyclic rings, C6~C10 aromatic ring or the heteroatomic 5-12 member containing 1~4 in oxygen, sulphur and nitrogen；
R4It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, C1~C6 alkane Base, containing 1-7 fluorine atom replace C1~C3 alkyl, C1~C6 alkoxy, C6~C10 aryl, containing 1~3 selected from oxygen, The heterocycle of heteroatomic 5-7 member in sulphur and nitrogen, C1~C6 alkyl-phenyl, C1~C6 alkyl-(5-7 unit's heteroaryl), C3~ C12 naphthenic base, C2~C10 acyl group, C2~C10 ester group, C2~C10 aryloxy group, C1~C6 amide groups ,-OSO2R5、-OCOR5、- SO2R5；
F is 1,2,3,4,5,6,7,8.
In another preferred example, in the general formula I and general formula II:
A is selected from the group: C3~C8 carbocyclic ring, containing 1~3 heteroatomic 3~8 circle heterocyclic ring, naphthalene nucleus, phenyl ring or containing 1~ The aromatic heterocycle of 4 heteroatomic 5-10 members in oxygen, sulphur and nitrogen；
R1It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, substitution or not Substituted C1~C3 alkyl, substituted or unsubstituted C6~C10 aryl, replaces~substituted or unsubstituted C1~C3 alkoxy Or heterocycle, the substituted or unsubstituted C1~C3 alkane of the unsubstituted hetero atom 5-7 member containing 1~3 in oxygen, sulphur and nitrogen Base-phenyl, substituted or unsubstituted C3~C8 naphthenic base, takes substituted or unsubstituted C1~C3 alkyl-(5-7 unit's heteroaryl) Generation or unsubstituted C2~C6 acyl group, substituted or unsubstituted C2~C6 ester group, substituted or unsubstituted C6~C10 aryloxy group, Substituted or unsubstituted C1~C6 amide groups ,-OSO2R5、-OCOR5、-COR5、-SO2R5；
R2And R3Be each independently selected from the following group: hydrogen, deuterium, tritium, cyano, amino, hydroxyl, nitro, aldehyde radical, substitution do not take The amidino groups in generation, substituted or unsubstituted guanidine radicals, substituted or unsubstituted C1~C6 alkyl, substituted or unsubstituted C1~C6 alcoxyl Base, substituted or unsubstituted contains 1~3 hetero atom in oxygen, sulphur and nitrogen at substituted or unsubstituted C6~C10 aryl The heterocycle of 5-7 member, substituted or unsubstituted C1~C3 alkyl phenyl, substituted or unsubstituted C1~C3 alkyl-(5-7 member heteroaryl Base), substituted or unsubstituted C3~C8 naphthenic base, substituted or unsubstituted C2~C6 acyl group, substituted or unsubstituted C2~C6 Ester group, substituted or unsubstituted C1~C6 amide groups ,-SO2R5、-COR5。
In another preferred example,
A is selected from the group: C3~C8 carbocyclic ring, phenyl ring, contains 1~4 heteroatomic 5- in oxygen, sulphur and nitrogen at naphthalene nucleus 12 yuan of hetero-aromatic ring；
A is 1,2,3 or 4；
R2And R3Be each independently selected from the following group: hydrogen, deuterium, tritium, amino, hydroxyl, substituted or unsubstituted amidino groups, substitution or Unsubstituted guanidine radicals, substituted or unsubstituted C1~C6 alkyl, containing 1-7 fluorine atom replace C1~C3 alkyl, replace or Unsubstituted phenyl, the heterocycle of the substituted or unsubstituted hetero atom 5-7 member containing 1~3 in oxygen, sulphur and nitrogen, substitution Or unsubstituted C1~C3 alkyl phenyl, substituted or unsubstituted C1~C3 alkyl 5-7 unit's heteroaryl, substituted or unsubstituted C3 ~C8 naphthenic base ,-SO2R5、-COR5。
In another preferred example, B is selected from the group: nothing or substituted or unsubstituted phenyl ring, wherein the substituted benzene It include 1~4 substituent group on ring；
Y is CO, SO2；
Z is CH2,NH,O,S；
D is 0,1；
E is 0,1；
R4It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, C1~C6 alkyl, C1 ~C3 alkoxy, C6~C10 aryl, the heterocycle of 5-7 member, C1~C3 alkyl phenyl, C1~C3 alkyl 5-7 unit's heteroaryl, C3~ C8 naphthenic base, C2~C6 acyl group, C2~C6 ester group, C2~C10 aryloxy group, C1~C6 amide groups ,-OSO2R5、-OCOR5、- SO2R5。
In another preferred example, in general formula I, R1Be each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, Hydroxyl, aldehyde radical, substituted or unsubstituted C1~C3 alkyl ,~substituted or unsubstituted C1~C3 alkoxy, replaces or not nitro The heterocycle of substituted C6~C10 aryl, the substituted or unsubstituted hetero atom 5-7 member containing 1~3 in oxygen, sulphur and nitrogen, Substituted or unsubstituted C1~C3 alkyl-phenyl, substituted or unsubstituted C1~C3 alkyl-(5-7 unit's heteroaryl), replace or not Substituted C2~C6 acyl group, substituted or unsubstituted phenoxy group, substituted or unsubstituted C1~C3 amide groups ,-OSO2R5、- OCOR5、-SO2R5；
A is 1,2,3,4；
R2And R3Be each independently selected from the following group: hydrogen, deuterium, tritium, amino, hydroxyl, substituted or unsubstituted amidino groups, substitution or Unsubstituted guanidine radicals, substituted or unsubstituted C1~C6 alkyl ,~substituted or unsubstituted phenyl, it is substituted or unsubstituted containing The heterocycle of 1~3 hetero atom 5-7 member in oxygen, sulphur and nitrogen, substituted or unsubstituted C1~C3 alkyl phenyl, replace or Unsubstituted C1~C3 alkyl-(5-7 unit's heteroaryl), substituted or unsubstituted C3~C8 naphthenic base ,-SO2R5、-COR5；
B is 0,1,2,3；
C is 0,1,2,3.
In another preferred example, in general formula II, Y CO, SO2；
Z is CH2,NH,O,S；
D is 0,1；
E is 0,1；
R4 is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, C1~C3 alkyl, C1 ~C6 alkoxy, C6~C10 aryl, C1~C3 alkyl phenyl ,-OSO2R5、-OCOR5、-SO2R5；
F is 1,2,3,4.
In another preferred example, substituted or unsubstituted C1~C6 alkyl is to replace containing 1-7 fluorine atom C1~C3 alkyl.
In another preferred example, the acrylic compounds are selected from compound A1-A104.
In another preferred example, the pharmaceutically acceptable salt is the acyclic compound and inorganic acid or organic acid Reaction is made.Wherein, the inorganic acid is hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, amidosulfonic acid or phosphoric acid；The organic acid is lemon Lemon acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, benzene sulfonic acid, p-methyl benzenesulfonic acid, methanesulfonic acid, naphthalene sulfonic acids, ethanesulfonic acid, naphthalenedisulfonic acid, Maleic acid, malic acid, malonic acid, fumaric acid, succinic acid, propionic acid, oxalic acid, trifluoroacetic acid, stearic acid, flutter acid, hydroxymaleic acid, Phenylacetic acid, benzoic acid, salicylic acid, glutamic acid, ascorbic acid, para-anilinesulfonic acid, Aspirin or isethionic acid.
In another preferred example, the pharmaceutically acceptable salt is that the acrylic compounds and inorganic base are formed Sodium salt, sylvite, calcium salt, aluminium salt or ammonium salt；Or the acrylic compounds and organic base formed methylamine salt, ethylamine salt or Ethanolamine salt.
The second aspect of the present invention provides a kind of preparation of acrylic compounds as described in the first aspect of the invention Method, which is characterized in that the preparation method is selected from following steps 1 and step 2:
Step 1:
What the compound of logical formula (I) can be convenient is prepared by method shown in scheme one, and compound (III) is in alkaline item (such as triethylamine) is by carboxyl group activating reagents (such as 1- ethyl-(3- dimethylaminopropyl) phosphinylidyne diimmonium salt hydrochlorate) under part Activation and formula (IV) compound are condensed to yield formula (I) compound in room temperature reaction；
Step 2:
What the compound of logical formula (II) can be convenient is prepared by method shown in scheme one, and compound (III) is in alkalinity Under the conditions of (such as triethylamine) by carboxyl group activating reagents (such as pivaloyl chloride) activation and formula (V) compound in room temperature reaction, contracting Conjunction obtains formula (II) compound.
The third aspect of the present invention provides a kind of pharmaceutical composition, containing therapeutically effective amount selected from the present invention the One of compound of formula I described in one side, its pharmaceutical salt, racemic modification, R- isomers and S- isomers are a variety of, And optionally, one or more pharmaceutical carriers, excipient, adjuvant, auxiliary material and/or diluent.
It in another preferred example, further include anti-type-2 diabetes mellitus drug in the pharmaceutical composition.
The fourth aspect of the present invention provides a kind of CREB/CRTC interaction inhibitor, being selected from containing therapeutically effective amount Acrylic compounds described in first aspect present invention, its pharmaceutical salt, racemic modification, R- isomers and S- isomers, Or combinations thereof.
In another preferred example, the inhibitor is for treating or preventing diabetes.
In another preferred example, the inhibitor is used to treat or prevent sugar with anti-type-2 diabetes mellitus combination therapies Urine disease.
The fifth aspect of the present invention provides a kind of compound of formula I, its racemic as described in the first aspect of the invention Body, R- isomers, S- isomers or officinal salt treat or prevent the drug of metabolic disease relevant to diabetes in preparation In purposes；Preferably, the disease is selected from the group: diabetes, obesity, liver fibrosis, metabolic disease.
In another preferred example, the drug further includes anti-type-2 diabetes mellitus drug；Preferably, anti-II type sugar Urine medicine is selected from the group: melbine, sitagliptin, Egelieting, vildagliptin, Rosiglitazone, troglitazone, Da Gelie Only, ipragliflozin, canagliflozin, En Gelie are net, tofogliflozin, Ai Gelie are net, glug column are net, or combinations thereof.
The present invention also provides a kind of method for treating diabetes, the method includes the steps: to the object application of needs Acrylic compounds described in the first aspect present invention of therapeutically effective amount or its pharmaceutically acceptable salt, racemic modification, R- isomers or S- isomers or their mixture.
It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, In This no longer tires out one by one states.
Detailed description of the invention
Fig. 1 shows the result of each experiment in pharmacological activity embodiment 1-2.
Specific embodiment
The present inventor is surprised to find that a kind of structure novel, is had excellent performance for the first time by extensive and in-depth research CREB/CRTC2 interaction inhibitor.The present invention is completed on this basis.
Term
In the present invention, the halogen is F, Cl, Br or I.
In the present invention, unless otherwise indicated, term used is with well known to a person skilled in the art general senses.
In the present invention, term " C1-C6 alkyl " refers to the linear or branched alkyl group with 1 to 6 carbon atom, unrestricted Property include methyl, ethyl, propyl, isopropyl, butyl, isobutyl group, sec-butyl, tert-butyl, amyl and base etc.；It is preferred that second Base, propyl, isopropyl, butyl, isobutyl group, sec-butyl and tert-butyl.
In the present invention, term " C1-C6 alkoxy " refers to the straight or branched alkoxyl with 1 to 6 carbon atom, non- It restrictively include methoxyl group, ethyoxyl, propoxyl group, isopropoxy and butoxy etc..
In the present invention, term " C2-C6 alkenyl " refer to the straight chain containing double bond with 2 to 6 carbon atoms or Branched-chain alkenyl includes vinyl, acrylic, cyclobutenyl, isobutenyl, pentenyl and hexenyl etc. without limitation.
In the present invention, term " C2-C6 alkynyl " refer to the straight chain containing three key with 2 to 6 carbon atoms or Branch alkynyl includes acetenyl, propinyl, butynyl, butynyl, pentynyl and hexin base etc. without limitation.
In the present invention, term " C3-C10 naphthenic base " refers to the cyclic alkyl on ring with 3 to 10 carbon atoms, non- It restrictively include cyclopropyl, cyclobutyl, cyclopenta, cyclohexyl, suberyl, cyclooctyl and cyclodecyl etc..Term " C3-C8 ring Alkyl ", " C3-C7 naphthenic base " have similar meaning with " C3-C6 naphthenic base ".
In the present invention, term " C3-C10 cycloalkenyl " refers to the cyclic alkenyl radical on ring with 3 to 10 carbon atoms, non- It restrictively include cyclopropanyl, cyclobutane base, cyclopentenyl, cyclohexenyl group, cycloheptenyl, cyclo-octene base and cyclodecyl alkene Deng.Term " C3-C7 cycloalkenyl " has similar meaning.
In the present invention, term " aromatic ring " or " aryl " have the same meaning, and preferably " aryl " is " C6-C12 virtue Base " or " C6-C10 aryl ".Term " C6-C12 aryl " refers on ring without the heteroatomic virtue with 6 to 12 carbon atoms Fragrant race's ring group, such as phenyl, naphthalene.Term " C6-C10 aryl " has similar meaning.
In the present invention, term " aromatic heterocycle " or " heteroaryl " have the same meaning, and refer to comprising one to multiple miscellaneous The heteroaromatic group of atom.Hetero atom referred herein includes oxygen, sulphur and nitrogen.Such as furyl, thienyl, pyridyl group, pyrazoles Base, pyrrole radicals, N- alkyl pyrrole radicals, pyrimidine radicals, pyrazinyl, imidazole radicals, tetrazole radical etc..The heteroaryl ring can be condensed in virtue On base, heterocycle or cycloalkyl ring, wherein being heteroaryl ring with the ring that precursor structure links together.Heteroaryl can be optionally It is substituted or unsubstituted.
In the present invention, term " 3-12 circle heterocyclic ring base " refers to miscellaneous in oxygen, sulphur and nitrogen containing 1~3 on ring The saturated or unsaturated 3-12 member ring group of atom, such as dioxolyl etc..Term " 3-7 circle heterocyclic ring base " has similar Meaning.
In the present invention, term " substitution " refers to one or more hydrogen atoms on specific group by specific substituent group institute Replace.Specific substituent group is substituent group appeared in the substituent group accordingly described above or each embodiment.Unless special Do not mentionlet alone it is bright, some replace group can on any substitutive site of the group with one be selected from specific group substitution Base, the substituent group at various locations on can be it is identical or different.Cyclic substituents, such as Heterocyclylalkyl, Ke Yiyu Another ring is connected, such as naphthenic base, so that spiral shell second cycle line is formed, for example, two rings have a shared carbon atom.This field It should be understood to the one skilled in the art that the combination of substituent group desired by the present invention is those stable or chemically achievable combinations.Institute It states substituent group such as (but being not limited to): C1-8 alkyl, C2-8 alkenyl, C2-8 alkynyl, C3-8 naphthenic base, 3- to 12- circle heterocyclic ring Base, aryl, heteroaryl, halogen, hydroxyl, carboxyl (- COOH), C1-8 aldehyde radical, C2-10 acyl group, C2-10 ester group, amino, alcoxyl Base, C1-10 sulfonyl etc..
Acrylic compounds as CREB/CRTC2 interaction inhibitor
In the present invention, a kind of acrylic acid derivative class compound with structure shown in following general formula I, Huo Zheqi are provided Racemic modification, R- isomers, S- isomers, pharmaceutically acceptable salt or their mixture:
Wherein:
A is selected from the group: 3~12 yuan of saturated carbon rings, contain 1~8 heteroatomic 3~12 yuan at 3~12 yuan of unsaturated carbocyclics Heterocycle, C6~C10 aromatic ring or the heteroatomic 5-12 member hetero-aromatic ring containing 1~4 in oxygen, sulphur and nitrogen；
R1It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, substitution or not Substituted C1~C6 alkyl, substituted or unsubstituted C1~C6 alkoxy, substituted or unsubstituted C6~C10 aryl, replace or Heterocycle, the substituted or unsubstituted C1~C6 alkane of the unsubstituted heteroatomic 5-7 member containing 1~3 in oxygen, sulphur and nitrogen Base-phenyl, substituted or unsubstituted C1~C6 alkyl-(contain 1~3 heteroatomic 5-7 member heteroaryl selected from oxygen, sulphur and nitrogen Base), substituted or unsubstituted C3~C12 naphthenic base, substituted or unsubstituted C2~C10 acyl group, substituted or unsubstituted C2~ C10 ester group, substituted or unsubstituted C6~C10 aryloxy group, substituted or unsubstituted C1~C6 amide groups ,-OSO2R5、- OCOR5、-COR5、-SO2R5；
A is 1,2,3,4,5,6,7,8,9,10 or 11；
X is N (CH2)cR3, O or S；
B is 0,1,2,3,4,5；
C is 0,1,2,3,4,5；
R2And R3Be each independently selected from the following group: nothing, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, takes hydrogen Generation or unsubstituted amidino groups (- C (=NH) NH2), substituted or unsubstituted guanidine radicals (- NH-C (=NH) NH2), it is substituted or unsubstituted C1~C6 alkyl, containing 1-7 fluorine atom replace C1~C3 alkyl, substituted or unsubstituted C1~C6 alkoxy, replace Or unsubstituted C6~C10 aryl, the substituted or unsubstituted heteroatomic 5-12 member containing 1~3 in oxygen, sulphur and nitrogen Heterocycle, substituted or unsubstituted C1~C6 alkyl phenyl, substituted or unsubstituted C1~C6 alkyl-(5-7 unit's heteroaryl), take Generation or unsubstituted C3~C12 naphthenic base, substituted or unsubstituted C2~C10 acyl group, substituted or unsubstituted C2~C10 ester Base, substituted or unsubstituted C1~C6 amide groups ,-SO2R5、-COR5；
Or-(CH2)b-R2、-(CH2)c-R3Ring selected from the group below is collectively formed with the X atom being connected: substituted or unsubstituted Containing 1~8 heteroatomic 3~12 circle heterocyclic ring (including monocycle or bicyclic), it is substituted or unsubstituted containing 1~4 selected from oxygen, Heteroatomic 5-12 member hetero-aromatic ring (including monocycle or bicyclic) in sulphur and nitrogen；
The substitution refers to that one or more hydrogen atoms on group are replaced by substituent group selected from the group below: deuterium, tritium, halogen Element, cyano, amino, hydroxyl, nitro, aldehyde radical, oxygen atom (=O), C1~C6 alkyl, the C1 containing the substitution of 1-7 fluorine atom~ C3 alkyl, C6~C10 aryl, contains the miscellaneous of 1~3 heteroatomic 5-12 member in oxygen, sulphur and nitrogen at C1~C6 alkoxy Ring, C1~C6 alkyl-phenyl, C1~C6 alkyl diphenyl base, C1~C6 alkyl-(5-7 unit's heteroaryl), C3~C12 naphthenic base, C2 ~C10 acyl group, C2~C10 ester group, C6~C10 aryloxy group, C1~C6 amide groups ,-C (=NH) N (R5)2,-NH-C (=NH) N (R5)2、-COR5、-OSO2R5、-OCOR5、-SO2R5；
R5It is selected from the group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, oxygen atom (=O), C1~C6 Alkyl, C1~C6 alkoxy, C6~C10 aryl, is selected from containing 1~3 the C1~C3 alkyl replaced containing 1-7 fluorine atom The heterocycle of heteroatomic 5-7 member in oxygen, sulphur and nitrogen, C1~C6 alkyl phenyl, C1~C6 alkyl 5-7 unit's heteroaryl, C3~C12 Naphthenic base, C2~C10 acyl group, C2~C10 ester group, C2~C10 aryloxy group, C1~C6 amide groups.
In further preferred embodiment of the present invention, general formula I of the invention and the preferably following tool of compounds of formula II Body compound:
Active constituent
The compounds of this invention can be structure shown in following general formula I and general formula II acrylic acid derivative class compound or Its racemic modification, R- isomers, S- isomers, pharmaceutically acceptable salt or their mixture:
General formula I
General formula II
Each group is as defined above.
The compound of the present invention has asymmetric center, chiral axis and chiral planes, and can be different with racemic modification, R- The form of structure body or S- isomers exists.Those skilled in the art can be split by racemic modification using conventional technical means and be obtained R- isomers and/or S- isomers.
The present invention provides general formula I and the pharmaceutical salt of Compounds of formula II, in particular general formula I and general formula II chemical combination Object and inorganic acid or organic acid reaction form conventional officinal salt.For example, conventional officinal salt can pass through general formula I and general formula II compound and inorganic acid or organic acid reaction are made, and the inorganic acid includes hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, amidosulfonic acid With phosphoric acid etc. and the organic acid include citric acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, benzene sulfonic acid, p-methyl benzenesulfonic acid, Methanesulfonic acid, naphthalene sulfonic acids, ethanesulfonic acid, naphthalenedisulfonic acid, maleic acid, malic acid, malonic acid, fumaric acid, succinic acid, propionic acid, oxalic acid, three Fluoroacetic acid, stearic acid, flutter acid, hydroxymaleic acid, phenylacetic acid, benzoic acid, salicylic acid, glutamic acid, ascorbic acid, to amido benzene sulphur Acid, Aspirin and isethionic acid etc.；Or sodium salt, potassium that general formula I and Compounds of formula II and inorganic base are formed Salt, calcium salt, aluminium salt or ammonium salt；Or methylamine salt, ethylamine salt or ethanol amine that general formula I and Compounds of formula II and organic base are formed Salt.
Preparation method
Another aspect of the present invention provides a kind of preparation method of compound that general formula I and general formula II is indicated, the preparation side Method is carried out according to following scheme 1 and scheme 2.
Formula (I) compound can be prepared by method shown in following scheme 1
Structural formula used in following scheme and R group label are only used in this part.Formula (III) compound, formula (IV) Compound and formula (V) compound can obtain in the market or the ordinary skill in the art can be used to synthesize.
Scheme one:
What the compound of logical formula (I) can be convenient is prepared by method shown in scheme one, and compound (III) is in alkaline item (such as triethylamine) is by carboxyl group activating reagents (such as 1- ethyl-(3- dimethylaminopropyl) phosphinylidyne diimmonium salt hydrochlorate) under part Activation and formula (IV) compound are condensed to yield formula (I) compound in room temperature reaction.
Scheme two:
What the compound of logical formula (II) can be convenient is prepared by method shown in scheme one, and compound (III) is in alkalinity Under the conditions of (such as triethylamine) by carboxyl group activating reagents (such as pivaloyl chloride) activation and formula (V) compound in room temperature reaction, contracting Conjunction obtains formula (II) compound.
Pharmaceutical composition
Another aspect provides a kind of pharmaceutical compositions, are selected from above-mentioned general formula I containing therapeutically effective amount And one of compounds of formula II, its pharmaceutical salt, enantiomter, diastereoisomer or racemic modification or more Kind, and optionally, one or more pharmaceutical carriers, excipient, adjuvant, auxiliary material and/or diluent.The auxiliary material is for example For odorant agent, flavouring agent, sweetener etc..
Pharmaceutical composition provided by the present invention preferably comprises the active ingredient that weight ratio is 1-99%, preferred ratio It is that general formula I and Compounds of formula II account for 65wt%~99wt% of total weight as active constituent, rest part is that pharmacy can connect Carrier, dilution or the solution or salting liquid received.
Compound provided by the present invention and pharmaceutical composition can be diversified forms, as tablet, capsule, pulvis, syrup, Solution shape, suspension and aerosol etc., and can reside in the carrier or dilution of suitable solid or liquid and be suitable for In disinfector for injecting or instiling.
The various dosage forms of pharmaceutical composition of the invention can be prepared according to the customary preparation methods of pharmaceutical field.Its preparation is matched It include 1mg-700mg general formula I and Compounds of formula II in the unit dosage of side, it is preferable that wrapped in the unit dosage of pharmaceutical formulation The I of general formula containing 25mg-300mg and Compounds of formula II.
The compound of the present invention and pharmaceutical composition can pass through mammal clinical use, including humans and animals The administration route of mouth, nose, skin, lung or gastrointestinal tract etc..It is most preferably oral.Most preferably daily dose is 50-1400mg/kg body Weight, disposably takes or 25-700mg/kg weight part vic.Which kind of ineffective instructions of taking, personal optimal dose Ying Yi Depending on specific treatment.It is to gradually increase dosage until finding most suitable dosage since low dose under normal conditions.
It is yet another aspect of the present invention to provide a kind of CREB/CRTC2 interaction inhibitor, it includes selected from above-mentioned general formula I and In general formula II compound represented, its pharmaceutical salt, racemic modification, R- isomers, S- isomers or their mixture It is one or more, and optionally one or more pharmaceutical carriers, excipient, adjuvant, auxiliary material and/or diluent.
The compound of the present invention and composition are for treating and preventing glycosuria relevant to CREB/CRTC2 interaction inhibitor The diseases such as disease, the disease include, but are not limited to the diseases such as each patients with type Ⅰ DM, hyperlipidemia.
Therefore, it is yet another aspect of the present invention to provide above-mentioned general formula I and general formula II compound represented, its is pharmaceutical Salt, racemic modification, R- isomers, S- isomers or their mixture inhibit for treating with CREB/CRTC2 interaction in preparation Purposes in the drugs of diseases such as the diseases, such as diabetes such as the relevant diabetes of agent.
An additional aspect of the present invention provides a kind of diseases such as treatment diabetes relevant to the diseases such as diabetes, such as The method of the diseases such as type-II diabetes comprising be selected from shown in above-mentioned general formula I and general formula II to needing the patient of the treatment to be administered One of compound, its pharmaceutical salt, racemic modification, R- isomers, S- isomers or their mixture or a variety of.
Main advantages of the present invention include the following:
The present invention provides acrylic acid derivative class compound shown in a kind of general formula I and general formula II or its can pharmaceutically connect Salt, racemic modification, R- isomers or the S- isomers received or their mixture.
The present invention also provides the preparation methods of above compound.
The present invention also provides a kind of pharmaceutical compositions, are selected from above-mentioned acrylic acid derivative class it includes therapeutically effective amount Compound or its pharmaceutically acceptable salt, racemic modification, R- isomers or one of S- isomers or their mixture Or it is a variety of.
The present invention also provides a kind of CREB/CRTC2 interaction inhibitor, and it includes be selected from above-mentioned acrylic acid derivative class Close object or its pharmaceutically acceptable salt, racemic modification, R- isomers or one of S- isomers or their mixture or It is a variety of.
The present invention also provides above-mentioned acrylic acid derivative class compound or its pharmaceutically acceptable salt, racemic modification, R- isomers or S- isomers or their mixture are related for treating or preventing CREB/CRTC2 interaction inhibitor in preparation Purposes in the drug of disease (such as the diseases such as diabetes, hyperlipidemia).
The present invention also provides a kind of methods for treating or preventing CREB/CRTC2 interaction inhibitor related disease.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are weight percent and weight Number.
Experimental material used in following embodiment and reagent can obtain unless otherwise instructed from commercially available channel.
Preparation method:
The preparation method of acrylic acid derivative class compound according to the present invention as active constituent can be selected as follows Scheme 1 or scheme 2:
Scheme one:
What the compound of logical formula (I) can be convenient is prepared by method shown in scheme one, and compound (III) is in alkaline item (such as triethylamine) is by carboxyl group activating reagents (such as 1- ethyl-(3- dimethylaminopropyl) phosphinylidyne diimmonium salt hydrochlorate) under part Activation and formula (IV) compound are condensed to yield formula (I) compound in room temperature reaction.
Scheme two:
What the compound of logical formula (II) can be convenient is prepared by method shown in scheme one, and compound (III) is in alkalinity Under the conditions of (such as triethylamine) by carboxyl group activating reagents (such as pivaloyl chloride) activation and formula (V) compound in room temperature reaction, contracting Conjunction obtains formula (II) compound.
The present invention will be further illustrated below in an example.These embodiments are merely to illustrate the present invention, but It does not limit the invention in any way.
Embodiment 1 (E) -3- (3- (o-tolyl) acryloyl) oxazolidine -2- ketone
(E) -3- (3- (o-tolyl) acryloyl) oxazolidine -2- ketone A1
By compound (E) -3- (o-tolyl) acrylic acid 1a (400.0mg, 2.47mmol) and triethylamine (685.6 μ L, 4.93mmol) be dissolved in super dry dichloromethane, argon gas protection, under the conditions of -78 DEG C be added pivaloyl chloride (364.5 μ L, 2.96mmol), it moves to and is stirred at room temperature 1 hour, oxazolidine -2- ketone (214.8mg, 2.47mmol) is added under the conditions of -78 DEG C It with lithium chloride (104.5mg, 2.47mmol), is stirred at room temperature 12 hours, after TLC monitors fully reacting, adds water quenching to go out, methylene chloride Extraction merges organic layer, is washed with saturated sodium chloride solution, and organic layer is dry with anhydrous sodium sulfate, and concentration, crude product is through column layer Analyse to obtain target product A1 (490mg, white solid), yield 85.9%.1H NMR(400MHz,DMSO-d6) δ 7.96 (d, J= 15.7Hz, 1H), 7.73 (d, J=15.7Hz, 1H), 7.61 (d, J=8.7Hz, 1H), 7.38-7.31 (m, 1H), 7.30 (d, J =3.9Hz, 2H), 4.47-4.37 (m, 2H), 4.06-3.97 (m, 2H), 2.41 (s, 3H) .LRMS (ESI): 232.09 [M+H] +。
Embodiment 2 (E) -3- (3- (tolyl) acryloyl) oxazolidine -2- ketone A2
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (tolyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (tolyl) acryloyl) oxazolidine -2- ketone A2 (yield 82.1%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=16.0Hz, 1H), 7.72 (d, J=16.0Hz, 1H), 7.51- 7.44 (m, 2H), 7.36 (dt, J=10.2,5.1Hz, 1H), 7.28 (d, J=7.8Hz, 1H), 4.42 (td, J=8.1, 2.4Hz, 2H), 4.00 (td, J=8.1,2.6Hz, 2H), 2.34 (s, 3H) .LRMS (ESI): 232.09 [M+H]+.
Embodiment 3 (E) -3- (3- (p-methylphenyl) acryloyl) oxazolidine -2- ketone A3
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (p-methylphenyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (p-methylphenyl) acryloyl) oxazolidine -2- ketone A3 (yield 85.2%).1H NMR(400MHz,DMSO-d6) δ 7.77 (d, J=15.8Hz, 1H), 7.70 (d, J=15.9Hz, 1H), 7.55 (d, J=8.2Hz, 2H), 7.26 (d, J=7.9Hz, 2H), 4.39 (dd, J=8.6,7.4Hz, 2H), 3.97 (dd, J=8.6, 7.4Hz,2H),2.32(s,3H).LRMS(ESI):232.09[M+H]+。
Embodiment 4 (E) -3- (3- (2- methoxyphenyl) acryloyl) oxazolidine -2- ketone A4
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- methoxyphenyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1 obtain (E) -3- (3- (2- methoxyphenyl) acryloyl) oxazolidine -2- ketone A4 and (produce Rate 87.2%).1H NMR(400MHz,DMSO-d6) δ 7.97 (d, J=16.0Hz, 1H), 7.88 (d, J=15.9Hz, 1H), 7.61 (dd, J=7.7,1.6Hz, 1H), 7.45 (ddd, J=8.5,7.3,1.6Hz, 1H), 7.12 (d, J=8.4Hz, 1H), 7.03 (t, J=7.5Hz, 1H), 4.41 (t, J=8.0Hz, 2H), 3.99 (dd, J=8.5,7.4Hz, 2H), 3.88 (s, 3H) .LRMS(ESI):248.08[M+H]+。
Embodiment 5 (E) -3- (3- (3- methoxyphenyl) acryloyl) oxazolidine -2- ketone A5
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3- methoxyphenyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1 obtain (E) -3- (3- (3- methoxyphenyl) acryloyl) oxazolidine -2- ketone A5 and (produce Rate 87.6%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.8Hz, 1H), 7.73 (d, J=15.8Hz, 1H), 7.39 (t, J=7.9Hz, 1H), 7.31-7.24 (m, 1H), 7.21 (t, J=2.0Hz, 1H), 7.08-7.02 (m, 1H), 4.42 (dd, J=8.5,7.4Hz, 2H), 4.00 (dd, J=8.6,7.3Hz, 2H), 3.80 (s, 3H) .LRMS (ESI): 248.08 [M+ H]+。
Embodiment 6 (E) -3- (3- (4- methoxyphenyl) acryloyl) oxazolidine -2- ketone A6
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- methoxyphenyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1 obtain (E) -3- (3- (4- methoxyphenyl) acryloyl) oxazolidine -2- ketone A6 and (produce Rate 82.7%).1H NMR(400MHz,DMSO-d6) δ 7.77-7.66 (m, 2H), 7.64 (d, J=8.7Hz, 2H), 7.03 (d, J =8.8Hz, 2H), 4.41 (dd, J=8.5,7.4Hz, 2H), 3.99 (dd, J=8.5,7.4Hz, 2H), 3.81 (s, 3H) .LRMS (ESI):248.08[M+H]+。
Embodiment 7 (E) -3- (3- (2- (trifluoromethyl) acryloyl) oxazolidine -2- ketone A7
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- (2- (trifluoromethyl) acryloyl) oxazolidine -2- ketone A7 (yield 81.5%).1H NMR(400MHz,DMSO-d6) δ 7.98-7.78 (m, 5H), 7.68 (t, J=7.6Hz, 1H), 4.43 (dd, J=8.5,7.4Hz, 2H), 4.02 (dd, J=8.5,7.4Hz, 2H) .LRMS (ESI): 286.06 [M+H]+.
Embodiment 8 (E) -3- (3- (3- (trifluoromethyl) acryloyl) oxazolidine -2- ketone A8
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3- trifluoromethyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- (3- (trifluoromethyl) acryloyl) oxazolidine -2- ketone A8 (yield 80.3%).1H NMR(400MHz,DMSO-d6) δ 8.05-7.97 (m, 2H), 7.94-7.83 (m, 2H), 7.82 (d, J= 7.1Hz, 1H), 7.71 (t, J=7.8Hz, 1H), 4.43 (dd, J=8.5,7.4Hz, 2H), 4.02 (dd, J=8.5,7.4Hz, 2H).LRMS(ESI):286.06[M+H]+。
Embodiment 9 (E) -3- (3- (4- (trifluoromethyl) acryloyl) oxazolidine -2- ketone A9
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- trifluoromethyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- (4- (trifluoromethyl) acryloyl) oxazolidine -2- ketone A9 (yield 85.6%).1H NMR(400MHz,DMSO-d6)δ7.95–7.87(m,3H),7.85–7.79(m,3H),4.43(dd,J =8.5,7.4Hz, 2H), 4.01 (dd, J=8.6,7.4Hz, 2H) .LRMS (ESI): 286.06 [M+H]+.
Embodiment 10 (E) -3- (3- (4- fluorophenyl) acryloyl) oxazolidine -2- ketone A10
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- fluorophenyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (4- fluorophenyl) acryloyl) oxazolidine -2- ketone A10 (yield 89.0%).1H NMR(400MHz,DMSO-d6)δ7.77(s,2H),7.77–7.73(m,2H),7.37–7.25(m,2H),4.42 (dd, J=8.6,7.3Hz, 2H), 4.00 (dd, J=8.5,7.4Hz, 2H) .LRMS (ESI): 236.06 [M+H]+.
Embodiment 11 (E) -3- (3- (4- chlorphenyl) acryloyl) oxazolidine -2- ketone A11
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- chlorphenyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (4- chlorphenyl) acryloyl) oxazolidine -2- ketone A11 (yield 91.1%).1H NMR(400MHz,DMSO-d6) δ 7.82 (d, J=15.9Hz, 1H), 7.75 (d, J=15.9Hz, 1H), 7.73- 7.68 (m, 2H), 7.53 (dd, J=8.4,1.2Hz, 2H), 4.42 (t, J=8.0Hz, 2H), 4.00 (t, J=8.0Hz, 2H) .LRMS(ESI):252.03[M+H]+。
Embodiment 12 (E) -3- (3- (4- bromophenyl) acryloyl) oxazolidine -2- ketone A12
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- bromophenyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (4- bromophenyl) acryloyl) oxazolidine -2- ketone A12 (yield 91.1%).1H NMR(400MHz,DMSO-d6) δ 7.83 (d, J=15.9Hz, 1H), 7.73 (d, J=15.9Hz, 1H), 7.67 (d, J=8.7Hz, 2H), 7.63 (d, J=8.7Hz, 2H), 4.42 (dd, J=8.6,7.4Hz, 2H), 4.00 (dd, J=8.5, 7.4Hz,2H).LRMS(ESI):295.98,297.98[M+H]+。
Embodiment 13 (E) -3- (3- (naphthalene -1- base) acryloyl) oxazolidine -2- ketone A13
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (naphthalene -1- base) acrylic acid, remaining required raw material, reagent And the preparation method is the same as that of Example 1, obtains (E) -3- (3- (naphthalene -1- base) acryloyl) oxazolidine -2- ketone A13 (yield 87.1%).1H NMR(400MHz,DMSO-d6) δ 8.52 (d, J=15.6Hz, 1H), 8.25 (d, J=8.3Hz, 1H), 8.09-8.00 (m, 2H), 7.95-7.86 (m, 2H), 7.69-7.58 (m, 3H), 4.45 (dd, J=8.6,7.3Hz, 2H), 4.05 (dd, J=8.6, 7.3Hz,2H).LRMS(ESI):268.09[M+H]+。
Embodiment 14 (E) -3- ([1,1 '-xenyl] -2- base) methyl acrylate A14
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -2- base) acrylic acid, remaining institute It needs raw material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- ([1,1 '-xenyl] -2- base) methyl acrylate A14 and (produce Rate 95.2%).1H NMR(400MHz,DMSO-d6) δ 7.79 (d, J=15.0Hz, 1H), 7.67-7.60 (m, 1H), 7.50- 7.41 (m, 2H), 7.40 (s, 4H), 7.38-7.29 (m, 1H), 6.41 (d, J=15.2Hz, 1H), 3.77 (s, 3H) .LRMS (ESI):239.10[M+H]+。
Embodiment 15 (E) -3- (3- (thiophene -2- base) acryloyl) oxazolidine -2- ketone A15
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (thiophene -2- base) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (thiophene -2- base) acryloyl) oxazolidine -2- ketone A15 (yield 87.4%).1H NMR(400MHz,DMSO-d6) δ 8.03 (dd, J=2.8,1.2Hz, 1H), 7.77 (d, J=15.8Hz, 1H), 7.66 (ddd, J=5.0,2.9,0.7Hz, 1H), 7.61 (d, J=15.7Hz, 1H), 7.42 (dd, J=5.1,1.2Hz, 1H), 4.41 (dd, J=8.5,7.4Hz, 2H), 3.99 (dd, J=8.5,7.4Hz, 2H) .LRMS (ESI): 224.03 [M+H]+.
Embodiment 16 (E) -3- (3- (3- methoxyl group -4- pivaloyl oxygroup) phenyl) acryloyl) oxazolidine -2- ketone A16
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ((3- methoxyl group -4- pivaloyl oxygroup) phenyl) propylene Acid, remaining required raw material, reagent and the preparation method is the same as that of Example 1 obtain (E) -3- (3- (3- methoxyl group -4- pivaloyl oxygroup) Phenyl) acryloyl) oxazolidine -2- ketone A16 (yield 73.8%).1H NMR (400MHz, Chloroform-d) δ 7.83 (d, J= 2.5Hz, 2H), 7.21 (dd, J=8.2,1.9Hz, 1H), 7.16 (d, J=1.9Hz, 1H), 7.02 (d, J=8.1Hz, 1H), 4.45 (t, J=8.0Hz, 2H), 4.13 (dd, J=8.6,7.4Hz, 2H), 3.85 (s, 3H), 1.36 (s, 9H) .LRMS (ESI): 348.14[M+H]+。
Embodiment 17 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) benzo [d] (3H) -one of oxazolidine -2 A17
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) phenyl) acrylic acid, Oxazolidine -2- ketone is replaced with into benzo [d] oxazolidine -2 (3H) -one, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) benzo [d] oxazolidine -2 (3H) -one A17 (yield 80.0%).1H NMR(400MHz,DMSO-d6) δ 8.06 (dd, J=7.5,1.5Hz, 1H), 7.99 (d, J=15.2Hz, 1H), 7.81 (d, J=2.1Hz, 1H), 7.77-7.64 (m, 3H), 7.66-7.44 (m, 7H), 7.44-7.34 (m, 1H), 7.28-7.18 (m,1H).LRMS(ESI):342.11[M+H]+。
Embodiment 18 (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- benzyl oxazolidine -2- ketone A18
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) phenyl) acrylic acid, Oxazolidine -2- ketone is replaced with into (R) -4- benzyl oxazolidine -2- ketone, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- benzyl oxazolidine -2- ketone A18 (yield 80.0%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.0Hz, 1H), 7.72 (ddd, J=7.8,4.7,2.2Hz, 3H), 7.64 (ddt, J=11.8,7.4,2.2Hz, 2H), 7.59-7.44 (m, 4H), 7.44-7.34 (m, 1H), 7.33-7.23 (m, 2H), 7.25-7.14 (m, 3H), 4.62-4.49 (m, 2H), 4.41-4.29 (m, 1H), 3.18 (dd, J=12.3,6.5Hz, 1H),3.00–2.89(m,1H).LRMS(ESI):384.15[M+H]+。
Embodiment 19 (E) -3- ([1,1 '-xenyl] -3- base)-N- (mesyl)-N phenyl acrylamide A19
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) phenyl) acrylic acid, Oxazolidine -2- ketone is replaced with into N- phenyl methanesulfonamide amide, remaining required raw material, reagent and the preparation method is the same as that of Example 1 obtain (E) -3- ([1,1 '-xenyl] -3- base)-N- (mesyl)-N phenyl acrylamide A19 (yield 80.0%).1H NMR (400MHz,DMSO-d6) δ 7.77-7.69 (m, 2H), 7.63 (s, 3H), 7.69-7.57 (m, 2H), 7.55 (d, J=2.2Hz, 1H), 7.57-7.34 (m, 8H), 7.21 (tt, J=7.2,2.0Hz, 1H), 6.89 (d, J=15.0Hz, 1H), 3.48 (s, 3H) .LRMS(ESI):378.11[M+H]+。
Embodiment 20 (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- benzyl -5,5- dimethyl oxazoline Alkane -2- ketone A20
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) phenyl) acrylic acid, Oxazolidine -2- ketone is replaced with into (R) -4- benzyl -5,5- dimethyl oxazolidine -2- ketone, remaining required raw material, reagent and preparation side Method obtains (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- benzyl -5,5- dimethyl oxazoline with embodiment 1 Alkane -2- ketone A20 (yield 85.3%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.2Hz, 1H), 7.77-7.69 (m, 2H), 7.67-7.58 (m, 4H), 7.57-7.44 (m, 3H), 7.39 (ddt, J=8.0,6.7,2.0Hz, 1H), 7.33- 7.23 (m, 4H), 7.19 (ddt, J=9.4,6.2,3.4Hz, 1H), 4.25 (t, J=6.9Hz, 1H), 3.12 (dd, J=12.4, 7.0Hz, 1H), 2.88 (dd, J=12.3,7.0Hz, 1H), 1.45 (d, J=19.9Hz, 6H) .LRMS (ESI): 412.18 [M+ H]+。
Embodiment 21 (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- benzhydryl oxazolidine -2- ketone A21
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) phenyl) acrylic acid, Oxazolidine -2- ketone is replaced with into (R) -4- benzhydryl oxazolidine -2- ketone, remaining required raw material, reagent and preparation method are the same as real Example 1 is applied, (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- benzhydryl oxazolidine -2- ketone A21 is obtained and (produces Rate 89.7%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.2Hz, 1H), 7.73 (dd, J=7.5,2.0Hz, 2H), 7.69-7.57 (m, 3H), 7.55-7.34 (m, 10H), 7.32 (t, J=7.4Hz, 4H), 7.24-7.14 (m, 2H), 5.24 (d, J=7.0Hz, 1H), 4.80 (q, J=6.9Hz, 1H), 4.65 (dd, J=11.5,7.0Hz, 1H), 4.46 (dd, J= 11.5,7.0Hz,1H).LRMS(ESI):460.18[M+H]+。
Embodiment 22 (S, E) -4- phenyl -3- (3- (5- tolylthiophene -2- base) acryloyl) oxazolidine -2- ketone A22
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (5- tolylthiophene -2- base) acrylic acid, by oxazolidine - 2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (S, E) -4- phenyl -3- (3- (5- tolylthiophene -2- base) acryloyl) oxazolidine -2- ketone A22 (yield 91.3%).1H NMR (400MHz,DMSO-d6) δ 7.89 (d, J=7.6Hz, 1H), 7.87-7.77 (m, 3H), 7.71 (d, J=7.4Hz, 1H), 7.55 (d, J=15.1Hz, 1H), 7.52-7.44 (m, 3H), 7.47-7.38 (m, 2H), 7.31 (t, J=7.3Hz, 2H), 7.29- 7.19 (m, 1H), 5.29 (t, J=7.0Hz, 1H), 5.07 (dd, J=11.5,7.0Hz, 1H), 4.81 (dd, J=11.4, 6.9Hz,1H).LRMS(ESI):376.09[M+H]+。
Embodiment 23 (S, E) -4- phenyl -3- (3- (4- tolylthiophene -2- base) acryloyl) oxazolidine -2- ketone A23
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- tolylthiophene -2- base) acrylic acid, by oxazolidine - 2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (S, E) -4- phenyl -3- (3- (4- tolylthiophene -2- base) acryloyl) oxazolidine -2- ketone A23 (yield 92.1%).1H NMR (400MHz,DMSO-d6) δ 7.86-7.77 (m, 3H), 7.63-7.53 (m, 3H), 7.42 (dtdd, J=9.3,7.1,4.5, 3.0Hz, 5H), 7.31 (t, J=7.3Hz, 2H), 7.29-7.19 (m, 1H), 5.31 (t, J=6.9Hz, 1H), 5.08 (dd, J= 11.4,6.9Hz, 1H), 4.81 (dd, J=11.5,7.0Hz, 1H) .LRMS (ESI): 376.09 [M+H]+.
Embodiment 24 (S, E) -4- phenyl -3- (3- (3- tolylthiophene -2- base) acryloyl) oxazolidine -2- ketone A24
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3- tolylthiophene -2- base) acrylic acid, by oxazolidine - 2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (S, E) -4- phenyl -3- (3- (3- tolylthiophene -2- base) acryloyl) oxazolidine -2- ketone A24 (yield 90.8%).1H NMR (400MHz,DMSO-d6) δ 7.90-7.77 (m, 2H), 7.73 (d, J=15.0Hz, 1H), 7.54 (ddt, J=20.0,8.0, 1.8Hz, 4H), 7.48-7.33 (m, 4H), 7.31 (t, J=7.3Hz, 2H), 7.29-7.19 (m, 1H), 5.48 (dd, J=7.5, 6.2Hz, 1H), 5.06 (dd, J=11.5,7.0Hz, 1H), 4.83 (dd, J=11.5,7.0Hz, 1H) .LRMS (ESI): 376.09[M+H]+。
Embodiment 25 (S, E) -4- phenyl -3- (3- (3- (thiophene -2- base) phenyl) acryloyl) oxazolidine -2- ketone A25
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3- (thiophene -2- base) phenyl) acrylic acid, by oxazole Alkane -2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (S, E) -4- phenyl -3- (3- (3- (thiophene -2- base) phenyl) acryloyl) oxazolidine -2- ketone A25 (yield 87.8%).1H NMR (400MHz,DMSO-d6) δ 7.81 (d, J=15.0Hz, 1H), 7.78-7.66 (m, 2H), 7.62 (q, J=1.7Hz, 1H), 7.55 (d, J=15.2Hz, 1H), 7.55-7.43 (m, 2H), 7.45-7.35 (m, 3H), 7.36-7.26 (m, 2H), 7.29- 7.19 (m, 1H), 7.13 (t, J=7.5Hz, 1H), 5.29 (t, J=7.0Hz, 1H), 5.08 (dd, J=11.5,7.0Hz, 1H), 4.80 (dd, J=11.5,7.0Hz, 1H) .LRMS (ESI): 376.09 [M+H]+.
Embodiment 26 (S, E) -3- (3- (3- (5- chlorothiophene -2- base) phenyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A26
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3- (5- chlorothiophene -2- base) phenyl) acrylic acid, it will Oxazolidine -2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, Obtain (S, E) -3- (3- (3- (5- chlorothiophene -2- base) phenyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A26 (yield 81.4%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.0Hz, 1H), 7.76-7.47 (m, 7H), 7.31 (dd, J =8.2,6.6Hz, 2H), 7.29-7.19 (m, 2H), 7.05 (d, J=7.6Hz, 1H), 5.57 (t, J=7.0Hz, 1H), 5.10 (dd, J=11.4,6.9Hz, 1H), 4.86 (dd, J=11.5,7.0Hz, 1H) .LRMS (ESI): 410.05 [M+H]+.
Embodiment 27 (E)-N- mesyl -3- (2- Phenoxyphenyl)-N phenyl acrylamide A27
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with N- phenyl methanesulfonamide amide, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- methylsulfonyl Base -3- (2- Phenoxyphenyl)-N phenyl acrylamide A27 (yield 85.3%).1H NMR(400MHz,DMSO-d6)δ7.97 (dd, J=15.0,0.9Hz, 1H), 7.60-7.34 (m, 8H), 7.21 (dtt, J=7.6,3.9,2.0Hz, 2H), 7.14 (tt, J =7.5,2.0Hz, 1H), 7.12-7.01 (m, 3H), 6.72 (d, J=15.2Hz, 1H), 3.48 (s, 3H) .LRMS (ESI): 394.10[M+H]+。
Embodiment 28 (E) -3- (3- (2- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A28
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- (2- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A28 (yield 89.3%).1H NMR(400MHz,DMSO-d6)δ7.99–7.88(m,2H),7.83–7.76(m,1H),7.50–7.44 (m, 1H), 7.41 (tq, J=7.4,1.2Hz, 2H), 7.27 (td, J=7.6,1.5Hz, 1H), 7.17 (tt, J=7.4, 1.2Hz, 1H), 7.05-6.98 (m, 2H), 6.96 (dt, J=8.2,1.3Hz, 1H), 4.40 (td, J=8.0,1.4Hz, 2H), 4.01–3.91(m,2H).LRMS(ESI):310.10[M+H]+。
Embodiment 29 (E) -3- (3- (3- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A29
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3- Phenoxyphenyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- (3- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A29 (yield 82.7%).1H NMR(400MHz,DMSO-d6)δ7.80–7.70(m,2H),7.49–7.39(m,4H),7.31(dd,J =2.9,1.4Hz, 1H), 7.22-7.15 (m, 1H), 7.10-7.00 (m, 3H), 4.45-4.36 (m, 2H), 4.03-3.94 (m, 2H).LRMS(ESI):310.10[M+H]+。
Embodiment 30 (E) -3- (3- (4- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A30
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4- Phenoxyphenyl) acrylic acid, original needed for remaining Material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- (4- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A30 (yield 88.1%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.1Hz, 1H), 7.61-7.52 (m, 1H), 7.54- 7.45 (m, 2H), 7.39 (t, J=7.5Hz, 2H), 7.19-7.10 (m, 1H), 7.06 (ddd, J=7.8,5.7,1.9Hz, 4H), 4.40 (t, J=6.3Hz, 2H), 4.05 (t, J=6.4Hz, 2H) .LRMS (ESI): 310.10 [M+H]+.
Embodiment 31 (E) -3- (3- ([1,1 '-xenyl] -2- base) acryloyl) oxazolidine -2- ketone A31
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -2- base) acrylic acid, remaining institute It needs raw material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- ([1,1 '-xenyl] -2- base) acryloyl) oxazole Alkane -2- ketone A31 (yield 86.7%).1H NMR(400MHz,DMSO-d6) δ 7.90-7.78 (m, 2H), 7.64 (dd, J=15.8, 1.4Hz, 1H), 7.60-7.39 (m, 6H), 7.33 (dt, J=7.8,1.5Hz, 2H), 4.47-4.36 (m, 2H), 3.95 (m, 2H).LRMS(ESI):294.11[M+H]+。
Embodiment 32 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) oxazolidine -2- ketone A32
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, remaining institute It needs raw material, reagent and the preparation method is the same as that of Example 1, obtain (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) oxazole Alkane -2- ketone A32 (yield 88.3%).1H NMR(400MHz,DMSO-d6) δ 7.94 (s, 1H), 7.88 (d, J=5.9Hz, 2H), 7.78-7.68 (m, 4H), 7.57 (t, J=7.7Hz, 1H), 7.51 (t, J=7.6Hz, 2H), 7.42 (t, J=7.3Hz, 1H), 4.43 (t, J=8.0Hz, 2H), 4.02 (t, J=7.9Hz, 2H) .LRMS (ESI): 294.11 [M+H]+.
Embodiment 33 (E) -3- (3- cyclohexyl acryloyl) oxazolidine -2- ketone A33
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- cyclohexylacrylic, remaining required raw material, reagent and The preparation method is the same as that of Example 1, obtains (E) -3- (3- cyclohexyl acryloyl) oxazolidine -2- ketone A33 (yield 85.1%).1H NMR (400MHz,DMSO-d6) δ 7.12 (dd, J=15.6,1.3Hz, 1H), 6.95 (dd, J=15.6,6.6Hz, 1H), 4.37 (dd, J=8.5,7.5Hz, 2H), 3.92 (dd, J=8.6,7.4Hz, 2H), 2.21 (qd, J=8.0,7.3,4.5Hz, 1H), 1.77- 1.68 (m, 4H), 1.63 (d, J=12.5Hz, 1H), 1.36-1.23 (m, 2H), 1.14 (pd, J=13.3,12.7,3.7Hz, 3H).LRMS(ESI):224.12[M+H]+。
Embodiment 34 (E) -3- (3- (2- fluorophenyl) acryloyl) oxazolidine -2- ketone A34
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- fluorophenyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (2- fluorophenyl) acryloyl) oxazolidine -2- ketone A34 (yield 92.1%).1H NMR(400MHz,DMSO-d6) δ 7.93 (d, J=16.0Hz, 1H), 7.77 (d, J=16.0Hz, 1H), 7.79- 7.72(m,1H),7.58–7.47(m,1H),7.42–7.26(m,2H),4.50–4.37(m,2H),4.01(m,2H).LRMS (ESI):236.06[M+H]+。
Embodiment 35 (E) -3- (3- (2- bromophenyl) acryloyl) oxazolidine -2- ketone A35
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- bromophenyl) acrylic acid, remaining required raw material, examination Agent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (2- bromophenyl) acryloyl) oxazolidine -2- ketone A35 (yield 93.4%).1H NMR(400MHz,DMSO-d6) δ 7.96 (dd, J=15.9,1.7Hz, 1H), 7.84-7.73 (m, 3H), 7.50 (td, J=7.5,1.4Hz, 1H), 7.39 (td, J=7.7,1.8Hz, 1H), 4.43 (td, J=7.9,1.7Hz, 2H), 4.01 (ddd, J=8.7,7.2,1.7Hz, 2H) .LRMS (ESI): 295.98,297.98 [M+H]+.
Embodiment 36 (E)-N, N- diethyl -3- (2- (trifluoromethyl) phenyl) acrylamide A36
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with diethylamide, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N, N- diethyl -3- (2- (trifluoromethyl) phenyl) acrylamide A36 (yield 76.4%).1H NMR(400MHz,DMSO-d6) δ 8.11 (d, J= 7.8Hz, 1H), 7.84-7.76 (m, 2H), 7.73 (t, J=7.6Hz, 1H), 7.59 (t, J=7.6Hz, 1H), 7.19 (d, J= 15.1Hz, 1H), 3.54 (q, J=7.1Hz, 2H), 3.43-3.36 (m, 2H), 1.15 (t, J=7.0Hz, 3H), 1.08 (t, J= 7.0Hz,3H).LRMS(ESI):272.12[M+H]+。
Embodiment 37 (E)-3- (3- ([1,1 '-xenyl]-3- base) acryloyl) thiazolidine -2 -one A37
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane-2- ketone replaces with thiazolidine -2 -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-3- (3- ([1,1 '-xenyl]-3- base) acryloyl) thiazolidine -2 -one A37 (yield 89.0%).1H NMR(400MHz,DMSO-d6)δ 7.81 (d, J=15.0Hz, 1H), 7.73 (dd, J=7.5,2.0Hz, 2H), 7.66-7.44 (m, 7H), 7.44-7.34 (m, 1H), 3.70 (t, J=6.1Hz, 2H), 3.55 (t, J=6.0Hz, 2H) .LRMS (ESI): 310.08 [M+H]+.
Embodiment 38 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) benzo [d] thiazolidine -2 (3H) -one A38
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) benzo [d] thiazolidine -2 (3H) -one A38 (yield 79.9%).1H NMR(400MHz,DMSO-d6) δ 8.11-8.02 (m, 1H), 7.80-7.66 (m, 5H), 7.67 (dd, J=6.0,3.6Hz, 1H), 7.66-7.56 (m, 2H), 7.51 (dt, J=12.9,7.4Hz, 3H), 7.44-7.32 (m, 3H) .LRMS (ESI): 358.08 [M+ H]+。
Embodiment 39 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- fluorobenzene simultaneously [d] thiazolidine -2 (3H) - Ketone A39
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 6- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, Obtain (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one A39 (yield 75.9%).1H NMR(400MHz,DMSO-d6) δ 8.10 (dd, J=7.5,5.8Hz, 1H), 7.81-7.68 (m, 5H), 7.67- 7.58 (m, 2H), 7.56 (t, J=7.6Hz, 1H), 7.49 (t, J=7.5Hz, 2H), 7.44-7.34 (m, 1H), 7.25 (dd, J =8.8,1.9Hz, 1H), 7.04 (ddd, J=9.1,7.4,2.0Hz, 1H) .LRMS (ESI): 376.07 [M+H]+.
Embodiment 40 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- fluorobenzene simultaneously [d] thiazolidine -2 (3H) - Ketone A40
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 4- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, Obtain (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one A40 (yield 73.3%).1H NMR(400MHz,DMSO-d6) δ 7.73 (dt, J=8.7,2.4Hz, 2H), 7.68 (dt, J=6.2,1.9Hz, 4H), 7.62 (dt, J=7.4,2.1Hz, 1H), 7.56-7.43 (m, 4H), 7.42-7.36 (m, 1H), 7.15-7.06 (m, 2H) .LRMS(ESI):376.07[M+H]+。
41 benzo of embodiment [d] thiazolidine -2-base, (E)-3- ([1,1 '-xenyl]-3- base) acrylate A41
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains Benzo [d] thiazolidine -2-base, (E)-3- ([1,1 '-xenyl]-3- base) acrylate A41 (yield 51.4%).1H NMR (400MHz,DMSO-d6) δ 8.03 (dd, J=6.9,2.0Hz, 1H), 7.94 (dd, J=6.7,2.0Hz, 1H), 7.83 (dtd, J =6.2,4.4,3.8,2.3Hz, 1H), 7.79-7.65 (m, 4H), 7.70-7.56 (m, 2H), 7.54-7.42 (m, 3H), 7.47- 7.34 (m, 2H), 6.42 (d, J=15.1Hz, 1H) .LRMS (ESI): 358.08 [M+H]+.
Embodiment 42 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- chlorobenzene simultaneously [d] thiazolidine -2 (3H) - (E) -3- (o-tolyl) acrylic acid is replaced with (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid by ketone A42, by oxazolidine - 2- ketone replaces with 6- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains To (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one A42 (yield 82.1%).1H NMR(400MHz,DMSO-d6) δ 8.05-7.91 (m, 2H), 7.86 (d, J=7.5Hz, 1H), 7.78-7.69 (m, 3H), 7.62 (dd, J=6.7,2.0Hz, 2H), 7.55 (t, J=7.4Hz, 1H), 7.49 (t, J=7.5Hz, 2H), 7.49- 7.34 (m, 2H), 7.29 (dd, J=7.4,2.0Hz, 1H) .LRMS (ESI): 392.04 [M+H]+.
Embodiment 43 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -5- chlorobenzene simultaneously [d] thiazolidine -2 (3H) - Ketone A43
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 5- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, Obtain (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -5- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one A43 (yield 79.0%).1H NMR(400MHz,DMSO-d6) δ 8.19 (d, J=2.1Hz, 1H), 7.81-7.71 (m, 3H), 7.70-7.66 (m,3H),7.66–7.59(m,2H),7.56–7.45(m,4H),7.43–7.36(m,1H).LRMS(ESI):392.04[M+H] +。
Embodiment 44 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- trifluoromethyl benzo [d] thiazolidine - 2 (3H) -one A44
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 6- trifluoromethyl benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and preparation method are the same as real Example 1 is applied, (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- trifluoromethyl benzo [d] thiazolidine -2 (3H)-is obtained Ketone A44 (yield 85.5%).1H NMR(400MHz,DMSO-d6) δ 8.13 (d, J=7.5Hz, 1H), 7.80-7.66 (m, 6H), 7.66–7.55(m,2H),7.59–7.44(m,4H),7.44–7.34(m,1H).LRMS(ESI):426.07[M+H]+。
Embodiment 45 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- methoxyl group benzo [d] thiazolidine -2 (3H) -one A45
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 6- methoxyl group benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and preparation method are the same as implementation Example 1 obtains (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- methoxyl group benzo [d] thiazolidine -2 (3H) -one A45 (yield 82.6%).1H NMR(400MHz,DMSO-d6) δ 8.08 (d, J=7.5Hz, 1H), 7.83-7.69 (m, 5H), 7.66-7.53 (m, 3H), 7.49 (dd, J=8.2,6.8Hz, 2H), 7.39 (ddt, J=8.0,6.6,2.0Hz, 1H), 7.07 (d, J=1.9Hz, 1H), 6.81 (dd, J=7.6,1.9Hz, 1H), 3.81 (s, 3H) .LRMS (ESI): 388.09 [M+H]+.
Embodiment 46 (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- nitro benzo [d] thiazolidine -2 (3H) -one A46
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 6- nitro benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the same embodiment of preparation method 1, it obtains (E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -6- nitro benzo [d] thiazolidine -2 (3H) -one A46 and (produces Rate 70.6%).1H NMR(400MHz,DMSO-d6) δ 8.44 (d, J=1.9Hz, 1H), 8.30 (d, J=7.5Hz, 1H), 8.13 (dd, J=7.6,2.0Hz, 1H), 7.79-7.66 (m, 5H), 7.66-7.56 (m, 2H), 7.51 (dt, J=18.8,7.4Hz, 3H),7.44–7.34(m,1H).LRMS(ESI):403.07[M+H]+。
Embodiment 47 (R, E) -4- benzyl -3- (3- (2- Phenoxyphenyl) acryloyl)-oxazolidine -2- ketone A47
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with (R) -4- benzyl oxazolidine -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (R, E) - 4- benzyl -3- (3- (2- Phenoxyphenyl) acryloyl)-oxazolidine -2- ketone A47 (yield 83.5%).1H NMR(400MHz, DMSO-d6) δ 7.81-7.72 (m, 1H), 7.64 (d, J=15.0Hz, 1H), 7.57-7.50 (m, 1H), 7.46 (td, J=7.4, 2.0Hz, 1H), 7.44-7.32 (m, 3H), 7.33-7.23 (m, 2H), 7.24-7.01 (m, 7H), 4.56 (dd, J=11.2, 6.9Hz, 1H), 4.47 (p, J=6.8Hz, 1H), 4.30 (dd, J=11.1,6.7Hz, 1H), 2.70 (dd, J=12.4, 6.9Hz, 1H), 2.42 (dd, J=12.4,6.9Hz, 1H) .LRMS (ESI): 400.15 [M+H]+.
(R, the E) -4- of embodiment 48 benzyl -5,5 '-dimethyl -3- (3- (2- Phenoxyphenyl) acryloyl)-oxazolidine -2- Ketone A48
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with (R) -4- benzyl -5,5- dimethyl oxazolidine -2- ketone, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain benzyl -5 (R, E) -4-, 5 '-dimethyl -3- (3- (2- Phenoxyphenyl) acryloyl)-oxazolidine -2- ketone A48 (yield 86.2%).1H NMR(400MHz,DMSO-d6) δ 7.64 (d, J=15.0Hz, 1H), 7.54 (ddd, J=7.5,2.0,1.0Hz, 1H), 7.52-7.41 (m, 2H), 7.39 (dd, J=8.3,6.5Hz, 2H), 7.33-7.23 (m, 5H), 7.25-7.16 (m, 1H), 7.20-7.10 (m, 1H), 7.14-7.01 (m, 3H), 4.14 (t, J=7.0Hz, 1H), 3.08 (dd, J=12.3,7.0Hz, 1H), 2.81 (dd, J=12.3,7.0Hz, 1H), 1.44 (s, 3H), 1.39 (s, 3H) .LRMS (ESI): 428.18 [M+H]+.
Embodiment 49 (E)-N- cyclopropyl methyl -3- (2- trifluoromethyl) acrylamide A49
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with cyclopropyl-methylamine, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- cyclopropyl methyl- 3- (2- trifluoromethyl) acrylamide A49 (yield 87.7%).1H NMR(400MHz,DMSO-d6)δ8.41(s,1H), 7.94-7.83 (m, 2H), 7.76 (td, J=7.4,2.0Hz, 1H), 7.46 (td, J=7.5,2.0Hz, 1H), 7.26 (ddd, J =7.4,1.9,0.9Hz, 1H), 6.29 (d, J=15.0Hz, 1H), 3.11 (d, J=6.9Hz, 2H), 1.01 (hept, J= 7.0Hz,1H),0.52–0.38(m,2H),0.31–0.17(m,2H).LRMS(ESI):270.10[M+H]+。
Embodiment 50 (E)-N- cyclohexyl -3- (2- trifluoromethyl) acrylamide A50
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with cyclo-hexylamine, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- cyclohexyl -3- (2- trifluoromethyl) acrylamide A50 (yield 76.1%).1H NMR(400MHz,DMSO-d6)δ7.98(s,1H), 7.93-7.83 (m, 2H), 7.76 (t, J=7.5Hz, 1H), 7.46 (t, J=7.4Hz, 1H), 7.27 (d, J=7.4Hz, 1H), 6.29 (d, J=15.0Hz, 1H), 3.97 (s, 1H), 2.14 (dt, J=13.1,6.8Hz, 2H), 1.90-1.73 (m, 3H), 1.72–1.44(m,5H).LRMS(ESI):298.13[M+H]+。
Embodiment 51 (E)-N- (2,4- Dimethoxyphenyl) -3- (2- trifluoromethyl) acrylamide A51
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 2,4- Dimethoxyphenyl methylamine, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)- N- (2,4- Dimethoxyphenyl) -3- (2- trifluoromethyl) acrylamide A51 (yield 77.6%).1H NMR(400MHz, DMSO-d6) δ 8.45 (d, J=6.6Hz, 1H), 7.80 (q, J=10.2,9.1Hz, 2H), 7.76-7.66 (m, 2H), 7.60 (t, J=7.7Hz, 1H), 7.19-7.07 (m, 1H), 6.80 (d, J=15.6Hz, 1H), 6.58 (t, J=2.7Hz, 1H), 6.53- 6.42 (m, 1H), 4.30 (d, J=6.5Hz, 2H), 3.82 (s, 3H), 3.76 (s, 3H) .LRMS (ESI): 366.12 [M+H]+.
Bis- (3- (2- trifluoromethyl) the propyl- 2- alkene -1- of embodiment 52 (2E, 2 ' E) -1,1 '-(piperazine -1,4- diyl) Ketone A52
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with piperazine chloride, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (2E, 2 ' E) -1,1 '-(piperazine Piperazine -1,4- diyl) bis- (3- (2- trifluoromethyl) propyl- 2- alkene -1- ketone A52 (yield 97.2%).1H NMR(400MHz, DMSO-d6) δ 8.17 (d, J=8.1Hz, 2H), 7.87-7.71 (m, 6H), 7.63 (d, J=11.5Hz, 2H), 7.42 (d, J= 14.6Hz,2H),3.81(s,4H),3.66(s,4H).LRMS(ESI):483.14[M+H]+。
Embodiment 53 (E) -1- morpholine -3- (2- trifluoromethyl) propyl- 2- alkene -1- ketone A53
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with morpholine, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) -1- morpholine -3- (2- tri- Trifluoromethylphenyl) propyl- 2- alkene -1- ketone A53 (yield 90.9%).1H NMR(400MHz,DMSO-d6) δ 8.14 (d, J=7.9Hz, 1H), 7.84-7.68 (m, 3H), 7.59 (q, J=10.0,8.7Hz, 1H), 7.36 (d, J=15.1Hz, 1H), 3.79-3.67 (m,2H),3.64–3.54(m,6H).LRMS(ESI):286.10[M+H]+。
Embodiment 54 (E)-N- mesyl -3- (2- trifluoromethyl) acrylamide A54
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with Methanesulfomide, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- mesyl -3- (2- trifluoromethyl) acrylamide A54 (yield 88.9%).1H NMR(400MHz,DMSO-d6)δ12.12(s,1H), 7.95-7.74 (m, 5H), 7.71-7.63 (m, 1H), 6.73 (d, J=15.6Hz, 1H), 3.36 (s, 3H) .LRMS (ESI): 294.03[M+H]+。
Embodiment 55 (E) -3- ([1,1 '-xenyl] -3- base)-N- (N- benzyl carbonamidine base) acrylamide A55
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with 1- benzyl guanidine, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) -3- ([1,1 ' - Xenyl] -3- base)-N- (N- benzyl carbonamidine base) acrylamide A55 (yield 40.5%).1H NMR(400MHz,DMSO-d6)δ 10.21 (s, 1H), 8.12 (s, 1H), 7.96 (s, 1H), 7.73 (dd, J=7.5,2.0Hz, 2H), 7.66-7.53 (m, 4H), 7.48 (td, J=7.4,6.1Hz, 3H), 7.47-7.34 (m, 3H), 7.39-7.22 (m, 3H), 6.89 (d, J=15.2Hz, 1H),4.60(s,2H).LRMS(ESI):356.17[M+H]+。
Embodiment 56 (E)-N- (N- (N, N- dimethylformamidinyl) carbonamidine base) -3- (2- trifluoromethyl) acrylamide A56
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with N, N- melbine, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (E)-N- (N- (N, N- dimethylformamidinyl) carbonamidine base) -3- (2- trifluoromethyl) acrylamide A56 (yield 75.9%).1H NMR (400MHz,DMSO-d6) δ 8.18 (dq, J=15.6,2.5Hz, 1H), 8.07 (d, J=7.9Hz, 1H), 7.82-7.77 (m, 1H), 7.72 (t, J=7.6Hz, 1H), 7.58 (t, J=7.6Hz, 1H), 6.86 (d, J=16.0Hz, 1H), 6.87-6.79 (m, 2H),3.18–3.02(m,6H).LRMS(ESI):328.13[M+H]+。
Embodiment 57 (S, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A57
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (S, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A57 (yield 89.6%).1H NMR(400MHz,DMSO-d6) δ 8.00-7.88 (m, 2H), 7.81-7.66 (m, 5H), 7.56 (t, J=7.7Hz, 1H), 7.53- 7.47 (m, 2H), 7.45-7.33 (m, 6H), 5.61 (dd, J=8.6,3.9Hz, 1H), 4.87-4.78 (m, 1H), 4.27-4.20 (m,1H).LRMS(ESI):370.14[M+H]+。
Embodiment 58 (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A58
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with (R) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (R, E) -3- (3- ([1,1 '-xenyl] -3- base) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A58 (yield 88.9%).1H NMR(400MHz,DMSO-d6) δ 8.00-7.88 (m, 2H), 7.81-7.66 (m, 5H), 7.56 (t, J=7.7Hz, 1H), 7.53- 7.47 (m, 2H), 7.45-7.33 (m, 6H), 5.61 (dd, J=8.6,3.9Hz, 1H), 4.87-4.78 (m, 1H), 4.27-4.20 (m,1H).LRMS(ESI):370.14[M+H]+。
Embodiment 59 (S, E) -3- (3- (2- Phenoxyphenyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A59
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (S, E) - 3- (3- (2- Phenoxyphenyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A59 (yield 90.1%).1H NMR(400MHz, DMSO-d6) δ 7.98 (d, J=15.9Hz, 1H), 7.84 (d, J=16.0Hz, 1H), 7.80 (dd, J=7.9,1.7Hz, 1H), 7.47 (ddd, J=8.3,7.3,1.7Hz, 1H), 7.43-7.36 (m, 4H), 7.35-7.25 (m, 4H), 7.18-7.13 (m, 1H), 7.03-6.97 (m, 2H), 6.94 (dd, J=8.2,1.1Hz, 1H), 5.55 (dd, J=8.6,3.9Hz, 1H), 4.79 (t, J=8.7Hz, 1H), 4.20 (dd, J=8.7,3.9Hz, 1H) .LRMS (ESI): 386.13 [M+H]+.
Embodiment 60 (R, E) -3- (3- (2- Phenoxyphenyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A60
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with (R) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (R, E) - 3- (3- (2- Phenoxyphenyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A60 (yield 90.5%).1H NMR(400MHz, DMSO-d6) δ 7.98 (d, J=15.9Hz, 1H), 7.84 (d, J=16.0Hz, 1H), 7.80 (dd, J=7.9,1.7Hz, 1H), 7.47 (ddd, J=8.3,7.3,1.7Hz, 1H), 7.43-7.36 (m, 4H), 7.35-7.25 (m, 4H), 7.18-7.13 (m, 1H), 7.03-6.97 (m, 2H), 6.94 (dd, J=8.2,1.1Hz, 1H), 5.55 (dd, J=8.6,3.9Hz, 1H), 4.79 (t, J=8.7Hz, 1H), 4.20 (dd, J=8.7,3.9Hz, 1H) .LRMS (ESI): 386.13 [M+H]+.
Embodiment 61 (S, E) -3- (3- (2 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- base) acryloyl) -4- Oxazolyl phenyl alkane -2- ketone A61
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and The preparation method is the same as that of Example 1, obtains (S, E) -3- (3- (2 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) propylene Acyl) -4- oxazolyl phenyl alkane -2- ketone A61 (yield 86.1%).1H NMR(400MHz,DMSO-d6) δ 7.81 (d, J=15.0Hz, 1H), 7.72 (dd, J=7.2,2.3Hz, 1H), 7.68-7.19 (m, 15H), 5.27 (t, J=7.0Hz, 1H), 5.06 (dd, J= 11.4,6.9Hz, 1H), 4.80 (dd, J=11.5,7.0Hz, 1H), 4.03-3.92 (m, 2H), 3.55-3.34 (m, 4H), 2.92 (dtd, J=12.1,6.2,3.3Hz, 2H) .LRMS (ESI): 483.18 [M+H]+.
Embodiment 62 (S, E) -3- (3- (3 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- base) acryloyl) -4- Oxazolyl phenyl alkane -2- ketone A62
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and The preparation method is the same as that of Example 1, obtains (S, E) -3- (3- (3 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) propylene Acyl) -4- oxazolyl phenyl alkane -2- ketone A62 (yield 87.2%).1H NMR(400MHz,DMSO-d6)δ8.09–7.95(m,2H), 7.88-7.77 (m, 2H), 7.70-7.43 (m, 6H), 7.43-7.35 (m, 2H), 7.39-7.19 (m, 3H), 5.29 (t, J= 7.0Hz, 1H), 5.08 (dd, J=11.5,7.0Hz, 1H), 4.80 (dd, J=11.5,7.0Hz, 1H), 4.14-4.02 (m, 2H), 3.89 (dddd, J=11.6,6.1,5.2,2.9Hz, 2H), 3.52 (dddd, J=12.2,6.8,5.7,3.4Hz, 2H), 3.11–2.99(m,2H).LRMS(ESI):483.18[M+H]+。
Embodiment 63 (S, E) -3- (3- (4 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- base) acryloyl) -4- Oxazolyl phenyl alkane -2- ketone A63
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and The preparation method is the same as that of Example 1, obtains (S, E) -3- (3- (4 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) propylene Acyl) -4- oxazolyl phenyl alkane -2- ketone A63 (yield 85.9%).1H NMR(400MHz,DMSO-d6)δ7.86–7.75(m,2H), 7.73 (d, J=1.0Hz, 4H), 7.68-7.58 (m, 2H), 7.59-7.47 (m, 4H), 7.36-7.19 (m, 3H), 5.57 (t, J =7.0Hz, 1H), 5.10 (dd, J=11.4,6.9Hz, 1H), 4.86 (dd, J=11.5,7.0Hz, 1H), 4.05-3.94 (m, 2H), 3.82 (dddd, J=11.6,6.1,5.1,2.5Hz, 2H), 3.60-3.49 (m, 2H), 3.05 (dddd, J=12.1, 6.8,5.7,3.1Hz,2H).LRMS(ESI):483.18[M+H]+。
Embodiment 64 (E)-N- carbonamidine base -3- (2 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- base) acryloyl Amine A64
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into guanidine hydrochloride, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain (E)-N- carbonamidine base -3- (2 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) acrylamide A64 (yield 46.7%).1H NMR(400MHz,DMSO-d6)δ9.33(s,1H),8.09(s,1H),7.68–7.49(m,6H),7.53–7.39 (m, 3H), 7.38 (d, J=7.1Hz, 3H), 6.89 (d, J=15.1Hz, 1H), 3.61 (t, J=4.7Hz, 4H), 3.50 (t, J =4.7Hz, 4H) .LRMS (ESI): 379.17 [M+H]+.
Embodiment 65 (E)-N- carbonamidine base -3- (3 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- base) acryloyl Amine A65
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into guanidine hydrochloride, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain (E)-N- carbonamidine base -3- (3 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) acrylamide A65 (yield 49.1%).1H NMR(400MHz,DMSO-d6) δ 10.17 (s, 1H), 8.11-7.91 (m, 5H), 7.86 (dt, J=7.4, 2.0Hz, 1H), 7.66-7.52 (m, 5H), 7.48 (t, J=7.4Hz, 1H), 6.89 (d, J=15.2Hz, 1H), 3.61 (t, J= 4.5Hz, 4H), 3.50 (t, J=4.5Hz, 4H) .LRMS (ESI): 379.17 [M+H]+.
Embodiment 66 (E)-N- carbonamidine base -3- (4 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- base) acryloyl Amine A66
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into guanidine hydrochloride, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain (E)-N- carbonamidine base -3- (4 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) acrylamide A66 (yield 51.0%).1H NMR(400MHz,DMSO-d6)δ10.15(s,1H),8.09(s,1H),7.78–7.70(m,4H),7.69– 7.53 (m, 6H), 7.48 (t, J=7.6Hz, 1H), 6.89 (d, J=15.1Hz, 1H), 3.61 (t, J=4.4Hz, 4H), 3.50 (t, J=4.4Hz, 4H) .LRMS (ESI): 379.17 [M+H]+.
Embodiment 67 (E)-N- (N- benzyl carbonamidine base) -3- (2 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- Base) acrylamide A67
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into 1- benzyl guanidine, remaining required raw material, reagent and preparation method are the same as implementation Example 1 obtains (E)-N- (N- benzyl carbonamidine base) -3- (2 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) acryloyl Amine A67 (yield 75.3%).1H NMR(400MHz,DMSO-d6)δ9.17(s,1H),7.96(s,1H),7.68–7.50(m, 7H), 7.54-7.36 (m, 4H), 7.36-7.22 (m, 3H), 6.89 (d, J=15.1Hz, 1H), 6.00 (s, 1H), 4.60 (s, 2H), 3.61 (t, J=4.4Hz, 4H), 3.50 (t, J=4.3Hz, 4H) .LRMS (ESI): 469.22 [M+H]+.
Embodiment 68 (E)-N- (N- benzyl carbonamidine base) -3- (3 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- Base) acrylamide A68
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (3 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into 1- benzyl guanidine, remaining required raw material, reagent and preparation method are the same as implementation Example 1 obtains (E)-N- (N- benzyl carbonamidine base) -3- (3 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) acryloyl Amine A68 (yield 71.3%).1H NMR(400MHz,DMSO-d6)δ10.25(s,1H),8.57(s,1H),8.04–7.93(m, 3H), 7.80 (dt, J=7.6,2.1Hz, 1H), 7.66-7.57 (m, 3H), 7.61-7.47 (m, 3H), 7.50-7.36 (m, 3H), 7.36-7.22 (m, 3H), 6.89 (d, J=15.1Hz, 1H), 4.60 (s, 2H), 3.61 (t, J=4.6Hz, 4H), 3.50 (t, J =4.7Hz, 4H) .LRMS (ESI): 469.22 [M+H]+.
Embodiment 69 (E)-N- (N- benzyl carbonamidine base) -3- (4 '-(morpholine -4- carbonyl)-[1,1 '-xenyl] -3- Base) acrylamide A69
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (4 '-(morpholine -4- carbonyl)-[1,1 '-biphenyl Base] -3- base) acrylic acid, oxazolidine -2- ketone is replaced with into 1- benzyl guanidine, remaining required raw material, reagent and preparation method are the same as implementation Example 1 obtains (E)-N- (N- benzyl carbonamidine base) -3- (4 '-(morpholine -4- carbonyls)-[1,1 '-xenyl] -3- base) acryloyl Amine A69 (yield 78.0%).1H NMR(400MHz,DMSO-d6)δ10.23(s,1H),8.57(s,1H),7.96(s,1H), 7.74 (d, J=7.5Hz, 2H), 7.67-7.52 (m, 6H), 7.51-7.36 (m, 3H), 7.36-7.22 (m, 3H), 6.89 (d, J =15.0Hz, 1H), 4.60 (s, 2H), 3.61 (t, J=4.6Hz, 4H), 3.50 (t, J=4.7Hz, 4H) .LRMS (ESI): 469.22[M+H]+。
Embodiment 70 (E)-N- carbonamidine base -3- (2- Phenoxyphenyl) acrylamide A70
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with guanidine hydrochloride, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- carbonamidine base -3- (2- benzene Phenyl) acrylamide A70 (yield 51.6%).1H NMR(400MHz,DMSO-d6)δ10.20(s,1H),8.09(s, 1H), 7.92 (dd, J=15.0,0.9Hz, 1H), 7.68 (s, 2H), 7.52-7.41 (m, 2H), 7.44-7.34 (m, 2H), 7.14 (ddp, J=7.7,4.3,1.9Hz, 2H), 7.12-7.01 (m, 3H), 6.72 (d, J=15.2Hz, 1H) .LRMS (ESI): 282.12[M+H]+。
Embodiment 71 (S, E) -3- (3- (2- trifluoromethyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A71
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with (S) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (S, E) -3- (3- (2- trifluoromethyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A71 (yield 90.9%).1H NMR (400MHz,DMSO-d6) δ 7.95 (d, J=7.8Hz, 1H), 7.91-7.77 (m, 4H), 7.68 (t, J=7.7Hz, 1H), 7.46-7.33 (m, 5H), 5.59 (dd, J=8.6,4.1Hz, 1H), 4.82 (t, J=8.7Hz, 1H), 4.24 (dd, J=8.7, 4.1Hz,1H).LRMS(ESI):362.09[M+H]+。
Embodiment 72 (R, E) -3- (3- (2- trifluoromethyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A72
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with (R) -4- oxazolyl phenyl alkane -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (R, E) -3- (3- (2- trifluoromethyl) acryloyl) -4- oxazolyl phenyl alkane -2- ketone A72 (yield 90.4%).1H NMR (400MHz,DMSO-d6) δ 7.95 (d, J=7.8Hz, 1H), 7.91-7.77 (m, 4H), 7.68 (t, J=7.7Hz, 1H), 7.46-7.33 (m, 5H), 5.59 (dd, J=8.6,4.1Hz, 1H), 4.82 (t, J=8.7Hz, 1H), 4.24 (dd, J=8.7, 4.1Hz,1H).LRMS(ESI):362.09[M+H]+。
Embodiment 73 (E)-N- carbonamidine base -3- (2- trifluoromethyl) acrylamide A73
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with guanidine hydrochloride, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- carbonamidine base -3- (2- Trifluoromethyl) acrylamide A73 (yield 55.1%).1H NMR(400MHz,DMSO-d6)δ9.79(s,1H),8.09(s, 1H), 7.82-7.71 (m, 2H), 7.65 (dd, J=15.0,1.0Hz, 1H), 7.43 (td, J=7.2,2.6Hz, 1H), 7.24 (dt, J=7.7,1.2Hz, 1H), 7.03 (s, 2H), 6.72 (d, J=15.0Hz, 1H) .LRMS (ESI): 258.08 [M+H]+.
Embodiment 74 (E) -3- ([1,1 '-xenyl] -3- base)-N- carbonamidine base acrylamide A74
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- ([1,1 '-xenyl] -3- base) acrylic acid, by oxazole Alkane -2- ketone replaces with guanidine hydrochloride, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) -3- ([1,1 '-connection Phenyl] -3- base)-N- carbonamidine base acrylamide A74 (yield 52.2%).1H NMR(400MHz,DMSO-d6)δ10.20(s, 1H),8.09(s,1H),7.77–7.69(m,2H),7.68(s,2H),7.66–7.53(m,4H),7.58–7.44(m,2H), 7.44-7.34 (m, 2H), 6.89 (d, J=15.1Hz, 1H) .LRMS (ESI): 266.12 [M+H]+.
Embodiment 75 (E)-3- (3- (2- Phenoxyphenyl) acryloyl) thiazolidine -2 -one A75
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with thiazolidine -2 -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-3- (3- (2- benzene oxygen Base phenyl) acryloyl) thiazolidine -2 -one A75 (yield 89.6%).1H NMR(400MHz,DMSO-d6) δ 7.94 (dd, J= 15.0,0.9Hz, 1H), 7.68-7.60 (m, 2H), 7.46 (td, J=7.5,2.0Hz, 1H), 7.44-7.34 (m, 2H), 7.23- 7.09 (m, 2H), 7.12-7.01 (m, 3H), 3.70 (t, J=6.1Hz, 2H), 3.55 (t, J=6.0Hz, 2H) .LRMS (ESI): 326.08[M+H]+。
Embodiment 76 (E) -3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A76
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)- 3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A76 (yield 79.5%).1H NMR (400MHz,DMSO-d6) δ 8.10-8.00 (m, 1H), 7.96 (d, J=15.0Hz, 1H), 7.75-7.63 (m, 2H), 7.61 (d, J=15.1Hz, 1H), 7.46 (td, J=7.5,2.0Hz, 1H), 7.44-7.32 (m, 4H), 7.23-7.09 (m, 2H), 7.12- 7.01(m,3H).LRMS(ESI):374.08[M+H]+。
The fluoro- 3- of embodiment 77 (E) -6- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A77
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 6- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) the fluoro- 3- of -6- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A77 (yield 80.9%).1H NMR(400MHz,DMSO-d6) δ 8.09 (dd, J=7.5,5.7Hz, 1H), 7.90 (dd, J=15.0,0.9Hz, 1H), 7.66- 7.52 (m, 2H), 7.46 (td, J=7.5,2.1Hz, 1H), 7.44-7.34 (m, 2H), 7.27-7.19 (m, 2H), 7.14 (tt, J =7.5,2.0Hz, 1H), 7.12-6.99 (m, 4H) .LRMS (ESI): 392.07 [M+H]+.
The fluoro- 3- of embodiment 78 (E) -4- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A78
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 4- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) the fluoro- 3- of -4- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A78 (yield 76.3%).1H NMR(400MHz,DMSO-d6) δ 7.99 (d, J=15.0Hz, 1H), 7.69-7.63 (m, 1H), 7.53 (d, J=15.0Hz, 1H), 7.45 (dt, J=7.5,2.7Hz, 2H), 7.42-7.36 (m, 2H), 7.20 (dd, J=7.4,2.0Hz, 1H), 7.17- 7.03(m,6H).LRMS(ESI):392.07[M+H]+。
The chloro- 3- of embodiment 79 (E) -6- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A79
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 6- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) the chloro- 3- of -6- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A79 (yield 85.1%).1H NMR(400MHz,DMSO-d6) δ 8.08 (d, J=15.0Hz, 1H), 7.83 (d, J=7.5Hz, 1H), 7.74 (d, J=1.9Hz, 1H), 7.59 (dd, J=15.2,0.9Hz, 1H), 7.52-7.41 (m, 2H), 7.44-7.31 (m, 3H), 7.27 (dd, J=7.5, 2.1Hz, 1H), 7.14 (tt, J=7.5,2.0Hz, 1H), 7.12-7.01 (m, 3H) .LRMS (ESI): 408.04 [M+H]+.
The chloro- 3- of embodiment 80 (E) -5- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A80
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 5- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) the chloro- 3- of -5- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A80 (yield 79.1%).1H NMR(400MHz,DMSO-d6) δ 8.17 (d, J=2.0Hz, 1H), 7.74 (s, 1H), 7.68 (dd, J=11.2,3.8Hz, 2H), 7.54 (dd, J=7.6,2.1Hz, 1H), 7.47 (ddd, J=15.2,7.6,2.1Hz, 2H), 7.44-7.30 (m, 3H), 7.14 (tt, J=7.5,2.0Hz, 1H), 7.12-7.01 (m, 3H) .LRMS (ESI): 408.04 [M+H]+.
Embodiment 81 (E) -3- (3- (2- Phenoxyphenyl) acryloyl) -6- (trifluoromethyl) benzo [d] thiazolidine -2 (3H) -one A81
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 6- trifluoromethyl benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the same embodiment of preparation method 1, it obtains (E) -3- (3- (2- Phenoxyphenyl) acryloyl) -6- (trifluoromethyl) benzo [d] thiazolidine -2 (3H) -one A81 and (produces Rate 81.5%).1H NMR(400MHz,DMSO-d6) δ 7.95 (d, J=15.0Hz, 1H), 7.77 (s, 1H), 7.46 (s, 4H), 7.51–7.32(m,6H),7.22–7.09(m,3H),7.12–7.01(m,4H).LRMS(ESI):442.06[M+H]+。
Embodiment 82 (E) -6- methoxyl group -3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A82
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 6- methoxyl group benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, Obtain (E) -6- methoxyl group -3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A82 (yield 82.7%).1H NMR(400MHz,DMSO-d6) δ 7.95 (d, J=7.4Hz, 1H), 7.69 (ddd, J=7.4,2.0,1.0Hz, 1H), 7.46 (td, J=7.5,2.0Hz, 1H), 7.45-7.34 (m, 3H), 7.25-7.15 (m, 2H), 7.14 (ddd, J=7.5, 4.7,1.9Hz, 1H), 7.14-7.01 (m, 4H), 6.79 (dd, J=7.6,1.9Hz, 1H), 3.81 (s, 3H) .LRMS (ESI): 404.09[M+H]+。
Embodiment 83 (E) -6- nitro -3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A83
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with 6- nitro benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains To (E) -6- nitro -3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A83 (yield 72.3%) 。1H NMR(400MHz,DMSO-d6) δ 8.45 (d, J=2.0Hz, 1H), 8.23 (d, J=7.4Hz, 1H), 8.13 (dd, J= 7.4,2.0Hz, 1H), 7.77 (dd, J=15.0,0.9Hz, 1H), 7.51-7.34 (m, 5H), 7.29 (dd, J=7.5,2.0Hz, 1H), 7.14 (tt, J=7.5,2.0Hz, 1H), 7.12-7.01 (m, 3H) .LRMS (ESI): 419.06 [M+H]+.
Embodiment 84 (E) -3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] (3H) -one of oxazolidine -2 A84
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with benzo [d] oxazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) - 3- (3- (2- Phenoxyphenyl) acryloyl) benzo [d] (3H) -one A84 of oxazolidine -2 (yield 76.3%).1H NMR (400MHz,DMSO-d6) δ 8.14-8.06 (m, 1H), 7.95 (s, 2H), 7.64-7.52 (m, 3H), 7.46 (td, J=7.5, 2.1Hz,1H),7.44–7.34(m,2H),7.29–7.01(m,6H).LRMS(ESI):358.10[M+H]+。
Embodiment 85 (R, E) -4- benzyl -5,5- dimethyl -3- (3- (thiophene -2- base) acryloyl) oxazolidine -2- ketone A85
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (thiophene -2- base) acrylic acid, oxazolidine -2- ketone is replaced It is changed to (R) -4- benzyl -5,5- dimethyl oxazolidine -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1 obtain To (R, E) -4- benzyl -5,5- dimethyl -3- (3- (thiophene -2- base) acryloyl) oxazolidine -2- ketone A85 (yield 77.5%).1H NMR(400MHz,DMSO-d6) δ 7.86-7.75 (m, 2H), 7.70 (dd, J=7.4,1.6Hz, 1H), 7.49 (d, J= 15.0Hz, 1H), 7.33-7.23 (m, 4H), 7.24-7.14 (m, 2H), 4.27 (t, J=7.0Hz, 1H), 3.39 (dd, J= 12.4,6.9Hz, 1H), 2.94 (dd, J=12.4,7.0Hz, 1H), 1.57 (d, J=19.9Hz, 6H) .LRMS (ESI): 342.11[M+H]+。
Embodiment 86 (R, E) -4- benzyl -3- (3- (thiophene -2- base) acryloyl) oxazolidine -2- ketone A86
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (thiophene -2- base) acrylic acid, oxazolidine -2- ketone is replaced It is changed to (R) -4- benzyl-oxazolidine -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1 obtain (R, E) -4- Benzyl -3- (3- (thiophene -2- base) acryloyl) oxazolidine -2- ketone A86 (yield 77.7%).1H NMR(400MHz,DMSO-d6)δ 7.86-7.75 (m, 2H), 7.70 (dd, J=7.4,1.6Hz, 1H), 7.46 (d, J=15.0Hz, 1H), 7.33-7.23 (m, 2H), 7.25-7.14 (m, 4H), 4.68 (dq, J=9.8,6.9Hz, 2H), 4.46-4.35 (m, 1H), 3.11-3.00 (m, 1H), 2.84 (dd, J=12.5,6.6Hz, 1H) .LRMS (ESI): 314.08 [M+H]+.
87 benzo of embodiment [d] thiazol-2-yl, (E) -3- (2- Phenoxyphenyl) acrylate A87
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains benzo [d] thiazol-2-yl, (E) -3- (2- Phenoxyphenyl) acrylate A87 (yield 53.4%).1H NMR(400MHz,DMSO- d6) δ 8.06-7.90 (m, 3H), 7.72 (dt, J=7.3,1.5Hz, 1H), 7.51-7.34 (m, 5H), 7.26 (dd, J=7.5, 2.0Hz, 1H), 7.14 (tt, J=7.5,2.0Hz, 1H), 7.12-7.01 (m, 3H), 6.31 (d, J=15.0Hz, 1H) .LRMS (ESI):374.08[M+H]+。
Embodiment 88 (R, E) -4- benzhydryl -3- (3- (2- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A88
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- Phenoxyphenyl) acrylic acid, by oxazolidine -2- Ketone replaces with (R) -4- benzhydryl oxazolidine -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (R, E) -4- benzhydryl -3- (3- (2- Phenoxyphenyl) acryloyl) oxazolidine -2- ketone A88 (yield 76.9%).1H NMR (400MHz,DMSO-d6) δ 7.64 (d, J=15.0Hz, 1H), 7.45 (dt, J=5.2,2.3Hz, 3H), 7.46-7.27 (m, 11H), 7.25-7.01 (m, 7H), 5.27-5.20 (m, 1H), 4.79 (q, J=6.9Hz, 1H), 4.68 (dd, J=11.4, 7.0Hz, 1H), 4.42 (dd, J=11.4,6.9Hz, 1H) .LRMS (ESI): 476.18 [M+H]+.
Embodiment 89 (E)-3- (3- (2- trifluoromethyl) acryloyl) thiazolidine -2 -one A89
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with thiazolidine -2 -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-3- (3- (2- tri- Trifluoromethylphenyl) acryloyl) thiazolidine -2 -one A89 (yield 90.6%).1H NMR(400MHz,DMSO-d6)δ7.86–7.79 (m, 1H), 7.76 (td, J=7.5,2.0Hz, 1H), 7.69-7.55 (m, 2H), 7.47 (td, J=7.4,2.1Hz, 1H), 7.30-7.23 (m, 1H), 3.70 (t, J=6.2Hz, 2H), 3.55 (t, J=6.2Hz, 2H) .LRMS (ESI): 302.04 [M+H] +。
Embodiment 90 (E) -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A90
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A90 (yield 88.5%).1H NMR (400MHz,DMSO-d6) δ 8.15-8.04 (m, 1H), 7.96 (dd, J=15.0,0.9Hz, 1H), 7.88-7.81 (m, 1H), 7.81-7.65 (m, 2H), 7.60 (d, J=15.2Hz, 1H), 7.48 (td, J=7.5,2.0Hz, 1H), 7.37 (tt, J=5.7, 4.6Hz, 2H), 7.27 (dt, J=7.3,1.5Hz, 1H) .LRMS (ESI): 350.04 [M+H]+.
The fluoro- 3- of embodiment 91 (E) -6- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A91
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 6- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains To the fluoro- 3- of (E) -6- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A91 (yield 85.9%) 。1H NMR(400MHz,DMSO-d6) δ 8.08 (dd, J=7.5,5.7Hz, 1H), 7.97 (dd, J=15.1,1.0Hz, 1H), 7.88 (dd, J=7.4,1.9Hz, 1H), 7.76 (td, J=7.5,2.1Hz, 1H), 7.60-7.50 (m, 2H), 7.41 (dt, J= 7.2,1.6Hz, 1H), 7.24 (dd, J=8.9,1.9Hz, 1H), 7.04 (ddd, J=9.2,7.4,2.0Hz, 1H) .LRMS (ESI):368.03[M+H]+。
The fluoro- 3- of embodiment 92 (E) -4- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A92
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 4- fluorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains To the fluoro- 3- of (E) -4- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A92 (yield 86.3%) 。1H NMR(400MHz,DMSO-d6) δ 8.02 (dd, J=15.0,0.9Hz, 1H), 7.88-7.81 (m, 1H), 7.76 (td, J= 7.4,2.0Hz, 1H), 7.56-7.44 (m, 2H), 7.49-7.42 (m, 1H), 7.27 (dt, J=7.2,1.6Hz, 1H), 7.16- 7.04(m,2H).LRMS(ESI):368.03[M+H]+。
The chloro- 3- of embodiment 93 (E) -6- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A93
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 6- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains To the chloro- 3- of (E) -6- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A93 (yield 85.1%) 。1H NMR(400MHz,DMSO-d6) δ 7.91-7.80 (m, 2H), 7.85 (s, 2H), 7.83-7.71 (m, 3H), 7.50 (td, J= 7.4,2.0Hz, 1H), 7.45-7.37 (m, 1H), 7.28 (dd, J=7.5,2.0Hz, 1H) .LRMS (ESI): 384.00 [M+H] +。
The chloro- 3- of embodiment 94 (E) -5- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A94
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 5- chlorobenzene simultaneously [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains To the chloro- 3- of (E) -5- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A94 (yield 82.1%) 。1H NMR(400MHz,DMSO-d6) δ 8.24 (d, J=2.1Hz, 1H), 7.96 (dd, J=15.0,0.9Hz, 1H), 7.88- 7.81 (m, 1H), 7.76 (td, J=7.4,2.0Hz, 1H), 7.68 (d, J=7.5Hz, 1H), 7.60 (d, J=15.2Hz, 1H), 7.48 (td, J=7.5,2.0Hz, 2H), 7.26 (ddd, J=7.4,2.0,0.9Hz, 1H) .LRMS (ESI): 384.00 [M+H] +。
Embodiment 95 (E) -6- trifluoromethyl -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A95
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 6- trifluoromethyl benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and preparation method are the same as implementation Example 1 obtains (E) -6- trifluoromethyl -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A95 (yield 82.0%).1H NMR(400MHz,DMSO-d6) δ 8.03 (d, J=7.5Hz, 1H), 7.83 (dd, J=7.6,1.9Hz, 1H), 7.81-7.71 (m, 2H), 7.51 (td, J=7.4,2.1Hz, 2H), 7.45-7.36 (m, 2H), 7.13 (d, J= 15.1Hz,1H).LRMS(ESI):418.03[M+H]+。
Embodiment 96 (E) -6- methoxyl group -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) - Ketone A96
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 6- methoxyl group benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the same embodiment of preparation method 1, obtain (E) -6- methoxyl group -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A96 (yield 81.7%).1H NMR(400MHz,DMSO-d6) δ 8.11 (d, J=7.5Hz, 1H), 7.96 (dd, J=15.1,1.0Hz, 1H), 7.92-7.84 (m, 1H), 7.76 (td, J=7.5,2.1Hz, 1H), 7.61 (d, J=15.0Hz, 1H), 7.52 (td, J=7.5, 2.1Hz, 1H), 7.30 (ddd, J=7.4,2.0,1.0Hz, 1H), 7.06 (d, J=2.0Hz, 1H), 6.81 (dd, J=7.5, 2.1Hz,1H),3.81(s,3H).LRMS(ESI):380.05[M+H]+。
Embodiment 97 (E) -6- nitro -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A97
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with 6- nitro benzo [d] thiazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, Obtain (E) -6- nitro -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] thiazolidine -2 (3H) -one A97 (yield 72.2%).1H NMR(400MHz,DMSO-d6) δ 8.44 (d, J=2.0Hz, 1H), 8.34 (d, J=7.5Hz, 1H), 8.13 (dd, J=7.5,2.0Hz, 1H), 7.96 (dd, J=15.0,1.0Hz, 1H), 7.88-7.81 (m, 1H), 7.76 (td, J= 7.4,2.0Hz, 1H), 7.61 (d, J=15.0Hz, 1H), 7.48 (td, J=7.4,2.0Hz, 1H), 7.26 (ddd, J=7.4, 1.9,0.9Hz,1H).LRMS(ESI):395.02[M+H]+。
Embodiment 98 (E) -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] (3H) -one of oxazolidine -2 A98
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with benzo [d] oxazolidine -2 (3H) -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E) -3- (3- (2- trifluoromethyl) acryloyl) benzo [d] (3H) -one A98 of oxazolidine -2 (yield 78.3%).1H NMR (400MHz,DMSO-d6) δ 7.95 (dd, J=15.1,1.0Hz, 1H), 7.83 (dd, J=7.6,1.9Hz, 1H), 7.76 (td, J =7.5,2.1Hz, 1H), 7.63-7.52 (m, 2H), 7.54-7.42 (m, 3H), 7.30-7.18 (m, 2H) .LRMS (ESI): 334.06[M+H]+。
Embodiment 99 (R, E) -4- benzyl -3- (3- (2- trifluoromethyl) acryloyl) oxazolidine -2- ketone A99
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with (R) -4- benzyl oxazolidine -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtain (R, E) -4- benzyl -3- (3- (2- trifluoromethyl) acryloyl) oxazolidine -2- ketone A99 (yield 86.4%).1H NMR (400MHz,DMSO-d6) δ 7.91-7.82 (m, 2H), 7.76 (td, J=7.4,2.0Hz, 1H), 7.64 (d, J=15.0Hz, 1H), 7.49 (td, J=7.5,2.1Hz, 1H), 7.33-7.23 (m, 3H), 7.24-7.14 (m, 3H), 4.64 (p, J=7.0Hz, 1H), 4.56 (dd, J=11.3,7.0Hz, 1H), 4.33 (dd, J=11.3,6.8Hz, 1H), 3.17 (dd, J=12.4, 6.9Hz, 1H), 2.91 (dd, J=12.4,6.9Hz, 1H) .LRMS (ESI): 376.11 [M+H]+.
Embodiment 100 (R, E) -4- benzyl -5,5- dimethyl -3- (3- (2- trifluoromethyl) acryloyl) oxazolidine - 2- ketone A100
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with (R) -4- benzyl -5,5- dimethyl oxazolidine -2- ketone, remaining required raw material, reagent and preparation method are the same as implementation Example 1 obtains (R, E) -4- benzyl -5,5- dimethyl -3- (3- (2- trifluoromethyl) acryloyl) oxazolidine -2- ketone A100 (yield 75.4%).1H NMR(400MHz,DMSO-d6) δ 8.00 (dd, J=15.0,1.0Hz, 1H), 7.88-7.81 (m, 1H), 7.76 (td, J=7.4,2.0Hz, 1H), 7.64 (d, J=15.0Hz, 1H), 7.47 (td, J=7.5,2.1Hz, 1H), 7.33- 7.20 (m, 5H), 7.19 (ddt, J=9.4,6.2,3.4Hz, 1H), 4.25 (t, J=7.0Hz, 1H), 3.10 (dd, J=12.3, 7.0Hz, 1H), 2.85 (dd, J=12.4,6.9Hz, 1H), 1.43 (d, J=19.9Hz, 6H) .LRMS (ESI): 404.14 [M+ H]+。
Embodiment 101 (R, E) -4- benzhydryl -3- (3- (2- trifluoromethyl) acryloyl) oxazolidine -2- ketone A101
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with (R) -4- benzhydryl oxazolidine -2- ketone, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (R, E) -4- benzhydryl -3- (3- (2- trifluoromethyl) acryloyl) oxazolidine -2- ketone A101 (yield 78.8%).1H NMR(400MHz,DMSO-d6) δ 7.93 (dd, J=15.1,1.0Hz, 1H), 7.83 (dd, J=7.6,1.9Hz, 1H), 7.76 (td, J=7.5,2.0Hz, 1H), 7.64 (d, J=15.0Hz, 1H), 7.52-7.40 (m, 5H), 7.32 (t, J=7.4Hz, 4H), 7.28-7.14 (m, 3H), 5.28-5.20 (m, 1H), 4.95 (q, J=7.0Hz, 1H), 4.72 (dd, J=11.5, 7.0Hz, 1H), 4.50 (dd, J=11.4,7.0Hz, 1H) .LRMS (ESI): 452.14 [M+H]+.
Embodiment 102 (E)-N- mesyl-N- phenyl -3- (2- trifluoromethyl) acrylamide A102
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with N- phenyl methanesulfonamide amide, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains (E)-N- methylsulphur Acyl group-N- phenyl -3- (2- trifluoromethyl) acrylamide A102 (yield 91.2%).1H NMR(400MHz,DMSO-d6)δ 7.99 (dd, J=15.0,1.0Hz, 1H), 7.91-7.83 (m, 1H), 7.84-7.71 (m, 3H), 7.47 (td, J=7.5, 2.1Hz, 1H), 7.46-7.36 (m, 2H), 7.29 (ddd, J=7.4,1.9,0.9Hz, 1H), 7.21 (tt, J=7.2,1.9Hz, 1H), 6.72 (d, J=15.2Hz, 1H), 3.48 (s, 3H) .LRMS (ESI): 370.06 [M+H]+.
103 benzo of embodiment [d] thiazolidine -2-base, (E)-3- (2- trifluoromethyl) acrylate A103
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (2- trifluoromethyl) acrylic acid, by oxazolidine - 2- ketone replaces with benzo [d] thiazolidine -2 -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1, obtains benzo [d] Thiazolidine -2-base, (E)-3- (2- trifluoromethyl) acrylate A103 (yield 55.2%).1H NMR(400MHz, DMSO-d6) δ 8.09-8.00 (m, 2H), 7.92 (td, J=6.8,1.8Hz, 2H), 7.82-7.70 (m, 1H), 7.63-7.53 (m, 2H), 7.44 (pd, J=7.4,1.8Hz, 2H), 6.32 (d, J=15.2Hz, 1H) .LRMS (ESI): 350.04 [M+H]+.
Embodiment 104 (E)-3- (3- (thiophene-2- base) acryloyl) thiazolidine -2 -one A104
(E) -3- (o-tolyl) acrylic acid is replaced with into (E) -3- (thiophene -2- base) acrylic acid, oxazolidine -2- ketone is replaced It is changed to thiazolidine -2 -one, remaining required raw material, reagent and the preparation method is the same as that of Example 1 obtain (E)-3- (3- (thiophene-2- base) Acryloyl) thiazolidine -2 -one A104 (yield 85.1%).1H NMR(400MHz,DMSO-d6)δ7.86–7.75(m,2H),7.70 (dd, J=7.4,1.6Hz, 1H), 7.60 (d, J=15.0Hz, 1H), 7.20 (t, J=7.4Hz, 1H), 3.70 (t, J= 6.1Hz, 2H), 3.55 (t, J=6.0Hz, 2H) .LRMS (ESI): 240.01 [M+H]+.
Pharmacological activity test embodiment
The measurement of 1. the compounds of this invention external activity of embodiment
The inhibitory activity test that CREB/CRTC2 protein be combined with each other
The hepatic gluconeogenic activity that cAMP-PKA-CREB/CRTC2 signal path has mediated glucagon to induce, to maintain Be combineding with each other for blood glucose level when hungry, transcription co-activation factor CRTC2 and transcription factor CREB is the pass for opening transcription Key events.This research and utilization mammal double cross cell model: including source of people CREB and GAL4-BD (Gal4-Binding Domain), the fusion expression vector of source of people CRTC2 and VP16-AD (VP16-Active domain), zygotic induction report base Because of the double reporter gene expression carriers of Gal4-Luciferase and composition RSV- β-gal.In mammalian cell (HEK293 Cell) in co-express this two-hybrid system, detect influence of the test-compound to reporter gene luciferase enzymatic activity, comment The bioactivity of valence test-compound, the relative activity of reporter gene and the inhibitory activity of compound are negatively correlated after correction.
1. experimental material and instrument
HEK293 cell line, cell incubator, safety cabinet, chemiluminescence detector (Luminoskan Ascent, Thermo), luciferase substrate D-luciferin (Thermo), β-gal substrate ortho-Nitrophenyl-B- Galactoside (ONPG, Thermo), DMSO (traditional Chinese medicines), transfection reagent (Nano-enter, Xin Saimei), cell membrane matrix egg White (GelTrex, Gibco), 96 porocyte culture plates (Corning), 96 hole white fluorescent plates (Thermo), Forsklin (Sigma), DMEM culture medium (Gibco).
2. experimental procedure
HEK293 cell (8000, the 200 every holes μ L contain 1%Geltrex) is inoculated in 96 orifice plate overnight incubations.Second day Transfection, that is, every hole adds 50 μ L containing transfection reagent and two-hybrid system expression vector (CREB-BD 50ng, CRTC2-AD after changing liquid 50ng, Gal4-luciferase 10ng, RSV- β-gal 10ng) plasma-free DMEM medium.Every hole is added after 3 hours The diluted 50 μ L of compound of DMEM is to prescribed concentration.Compound solvent control is DMSO, final concentration of 1-2%.Exciting model makes With the DMEM diluted compounds for containing Forsklin (final concentration 10nM).Subsequent compound and cell co-culture overnight.It co-cultures After, the culture medium in cell plates is discarded, 100 μ L lysates are added with every hole, lysis at room temperature after ten minutes, takes 40 μ L cells White fluorescent plate is added in lysate, and 40 μ Lluciferin substrates are added before testing, and immediately detects the bioluminescence letter in every hole Value.It takes 40 μ L cell pyrolysis liquids to 96 orifice plate of clear flat bottom simultaneously, and 40 μ L β-Gal substrates is added, detect every hole lysate and exist The enzyme activity signal that light absorption value under 420nm is β-gal.The letter of inductivity uciferase activity after the light absorption value correction of β-gal Opposite Enzyme activity number as luciferase.
3. experimental result
It is be combined with each other with CREB/CRTC2 protein as target spot, it is each tested using mammal double cross excitement model measurement The activity of compound.Final concentration of 50 μM of compound primary dcreening operation, the results showed that there is the compounds of this invention (A57) significant inhibition to live Property, compared to solvent control group, (100%) DMSO, is set as, the compounds of this invention makes opposite reporter gene activity be reduced to 30% (figure A) below.Further detect the IC of test-compound50, the IC of the compounds of this invention A57 as the result is shown50About 4.9 × 10- 7M (figure B).
Two, the cytotoxicity test of the compounds of this invention
In order to further determine compound inhibitory activity whether from cytotoxicity, this research has detected of the present inventionization Object is closed to the toxicity of mammalian cell.
1. experimental material and instrument
HEK293 cell line, DMEM culture medium (Gibco), fetal calf serum (Hyclone), DMSO (traditional Chinese medicines), multifunctional enzyme It marks instrument EnSpire (PerkinElmer), the flat tissue culture plate in 96 holes, CCK-8KIT (the green skies, C008).
2. experimental procedure
HEK293 cell (8000, the 200 every holes μ l, 1%Geltrex) is inoculated in 96 hole flat bottom clear plates, overnight incubation After change plasma-free DMEM medium into, and untested compound is added to aimed concn (50-100 μM), co-cultures overnight, it is then every CCK8 working solution (20 μ L) is added in hole, co-cultures the absorbance of the every hole OD450 of spectrophotometer test cell plate after sixty minutes.Carefully The light absorption value positive correlation of cytoactive and CCK8 at wavelength 450nm.
3. experimental result
Cytotoxicity experiment is the result shows that (50 μM) of the A57 overnight cell viabilities of processing show A57 to thin close to 100% The activity of born of the same parents inhibits without obvious.The inhibitory activity and cytotoxicity of this compound of further Conjoint Analysis, 50 μM as the result is shown A57 restrained effectively the activity that be combined with each other of CREB and CRTC2, and this concentration treated cell viability is not by shadow (figure C) is rung, which also indicates that the inhibitory activity of A57 is unrelated with cytotoxicity.
Three, the compounds of this invention tests the inhibitory activity that primary hepatocyte hepatic gluconeogenic rate-limiting enzyme is transcribed
1. experimental material and instrument
Wild type C57 adult mice (Shrek experimental animal company), chloraldurate (traditional Chinese medicines), Collagenase V (Sigma), HBSS buffer (Hyclone), rat tail collagen protein, M199 culture medium (Hyclone), peristaltic pump, centrifuge, DMSO (state Medicine), Trizal (general to fly), cDNA reverse transcription reagent box (PrimeScriptRT Reagent KIT with gDNA Eraser, TAKARA), Real Time PCR kit (SYBR Premix Ex Taq, TAKARA), Real time PCR instrument (ABI 900), QPCR primer (Sani's synthesis)
List of primers
Gene.ID Forward Reverse
G6pc TCTGTCCCGGATCTACCTTG GTAGAATCCAAGCGCGAAAC
Pepck GTGCTGGAGTGGATGTTCGG CTGGCTGATTCTCTGTTTCAGG
Creb AAGGCTCCGCTGGACTTAGA CGAGAACATCCCGCGATACT
Crtc2 CACCAGAACTTGACCCACTGT CACAGGGGTCACTCAGCATAG
L32 TCTGGTGAAGCCCAAGATCG CTCTGGGTTTCCGCCAGTT
2. experimental procedure
Using vena portae hepatica perfusion in situ collagenase method, separation obtains mouse liver parenchyma cell, pastes to primary hepatocyte With serum-free M199 culture medium overnight starvation after wall, it is hungry after cell be added and trained in advance containing untested compound (20 μM, DMSO1%) It supports 1 hour, subsequent glucagon (100nM) stimulates 4 hours, and Trizal extracts primary hepatocyte total serum IgE and reverse transcription is cDNA.Real time PCR detects the Ct value of each target gene mRNA content, is corrected with ribosomes L32 gene as internal reference.
3. experimental result
Based on the cell activity that there is the compounds of this invention targeted inhibition CREB/CRTC2 protein to be combined with each other, this research The effect that this compound transcribes hepatic gluconeogenic key gene (target gene of CREB) is further had detected, these genes include G6pc, Pepck etc., they are both the target gene of CREB and the marker gene of hepatic gluconeogenic process starting.QPCR result of study The compounds of this invention and raw medicine APC for showing 20 μM significantly reduce G6pc the and Pepck base induced by glucagon The mRNA level in-site of cause.Compared to raw medicine APC, the inhibitory activity of this compound is stronger (figure D).QPCR experimental result illustrates primary In liver cell, test compound has remarkable inhibiting activity to the transcription of hepatic gluconeogenic key gene, while also illustrating to be measured The inhibitory activity (CREB/CRTC2 protein is inhibited to be combined with each other) of compound on a molecular scale can generate on cellular level It influences and (inhibits the transcription of hepatic gluconeogenic marker gene).
Four, the compounds of this invention does not make significant difference to the transduction of glucagon signal path
1. experimental procedure
Using primary hepatocyte or liver organization as experimental material, untested compound (20 μM) preculture 1 hour, pancreas hyperglycemia Plain (100nM) stimulation 30 minutes, subsequent lytic cell or tissue simultaneously measure total protein concentration, pass through western blot means Detect the phosphorylation (Ser133) of CREB and the dephosphorylation level of total CREB protein content and CRTC2.Gross protein Internal reference is TUBLIN or GAPDH.Antibody CREB, CREB-P (133), GAPDH are purchased from Cell signal technology Company, CRTC2 are purchased from Millipore, and TUBLIN antibody is purchased from JAKSON LAB.
2. experimental result
The hepatic gluconeogenic activity that signal path GCGR-cAMP-CREB/CRTC2 has mediated glucagon to stimulate, by pancreas height The cAMP level of blood glucose element receptor excitation increases, and stimulation CREB-S133 phosphorylation, CRTC2-S171 dephosphorylation are incorporated to core and phosphorus The CREB of acidification is combined, to greatly enhance the transcription factor transcriptional efficiency of CREB.This research further has detected this hair Phosphorylation and CRTC2 dephosphorylized work of the bright compound to glucagon signal path end transcription key factor CREB With.Western blot the result shows that the CREB that raw medicine APC and the compounds of this invention A57 stimulate glucagon phosphorylation Level does not have significant impact, therefore to this circuit upstream links such as cAMP level, sensibility of GCGR etc. without significant shadow It rings.Comprehensive each experimental result of cytology shows that the compounds of this invention passes through specific inhibition transcription factor activity factor together CREB/CRTC2 be combined with each other, and then inhibits the transcriptional level of hepatic gluconeogenic key gene, this compound has no effect on pancreas Hyperglycemia signal path is in extranuclear signal transduction.
The measurement of pharmacodynamic activity in embodiment 2, the compounds of this invention body
One, the compounds of this invention reduces the hungry blood glucose level of diabetes B model db/db mouse
1. experimental material
Diabetes B model db/db mouse (BKS background, N000180) be purchased from Nanjing University's model animal research institute, 7 weeks It reaches, adaptation is tested after a week.During adaptation, all animals once a day observe by cage side.It is all to be suitable for the dynamic of experiment Object is assigned randomly to each group.Test period 8-15 week old.According to animal feeding in SPF grades of animal houses.Zoopery receives Shanghai The supervision and guidance of the animal welfare committee, life science institute.
DEXTROSE ANHYDROUS (traditional Chinese medicines), blood sugar test paper (Roche vigor type) and blood glucose meter (Roche), insulin needle (DB), pancreas Island element (Novo Nordisk), hydroxypropyl methyl cellulose (HPMC, II type, viscosity 400mPa.S, Sigma).
Drug is prepared and administration
Weigh Compound is dissolved in DMSO (final concentration 5%), vortex 1min, ultrasonic 3min, and 0.5% hydroxypropyl first is added Base cellulose, vortex 1min, ultrasonic 2min are made into the white suspension (pH~6) of 10mg/mL, for being administered orally.It is oral to fill Stomach is administered once a day, and oral dose 50mg/kg, continuous oral started experiment made on the living after 2 weeks.
2. experimental result
In order to detect this compound in the intracorporal hypoglycemic activity of diabetes B model mice, this research is with db/db mouse For experimental subjects, compound once a day (50mg/kg), tests compound to the hungry blood glucose level of db/db mouse by oral administration Influence.After 3 weeks oral, although the compounds of this invention does not influence the food-intake (figure F) of db/db mouse, of the present inventionization Closing object significantly reduces the hungry blood glucose level of db/db mouse, and hypoglycemic effect is better than raw medicine APC (figure G), this as the result is shown this Invention compound has the function of significantly reducing diabetes B model mouse starvation blood glucose, while also indicating that untested compound small Hypoglycemic activity is consistent with progenitor cells inhibitory activity in mouse body.
Two, the compounds of this invention improves the glucose tolerance of diabetes B model mice db/db
1. experimental material and instrument
DEXTROSE ANHYDROUS (traditional Chinese medicines), blood sugar test paper and blood glucose meter (Roche).
2. experimental procedure
Db/db mouse continuous daily oral drugs after 3 weeks remove food after afternoon oral drugs and keep free water, make Experiment mice overnight starvation, the next morning carry out glucose tolerance test.Mouse oral compound is primary before testing, and 30 minutes Oral glucose (0.5mg/kg) again afterwards tests blood glucose level after 30,60,90 minutes after oral glucose respectively.Statistics The blood sugar concentration of each group each time point.2-way ANOVA statisticallys analyze the group difference of control group with tested group.
3. experimental result
After continuous oral compound 3 weeks, raw medicine APC and the compounds of this invention significantly reduce the postprandial 30- of db/db mouse 90 minutes blood glucose levels, statistical analysis (2-way ANOVA) the result shows that, compared to raw medicine APC, this research compound reduces famine The activity for starving blood glucose and postprandial blood sugar concentration is stronger.OGTT experimental result, which illustrates that oral the compounds of this invention has, improves 2 types The activity in vivo of diabetic mice hyperglycemia has the function of enhancing db/db mouse islets element sensibility.This researchization Closing object is a kind of novel blood sugar lowing drug that targeting CREB/CRTC2 be combined with each other.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.
Sequence table
<110>Shanghai Pharmaceutical Inst., Chinese Academy of Sciences
Fudan University
<120>a kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes
<130> P2018-0572
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 1
tctgtcccgg atctaccttg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 2
gtagaatcca agcgcgaaac 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
gtgctggagt ggatgttcgg 20
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 4
ctggctgatt ctctgtttca gg 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 5
aaggctccgc tggacttaga 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
cgagaacatc ccgcgatact 20
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 7
caccagaact tgacccactg t 21
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 8
cacaggggtc actcagcata g 21
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 9
tctggtgaag cccaagatcg 20
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 10
ctctgggttt ccgccagtt 19

Claims (10)

1. a kind of acrylic acid derivative class compound with structure shown in following general formula I or its racemic modification, R- isomery Body, S- isomers, pharmaceutically acceptable salt or their mixture:
Wherein:
A is selected from the group: 3~12 yuan of saturated carbon rings, 3~12 yuan of unsaturated carbocyclics, containing 1~8 heteroatomic 3~12 yuan it is miscellaneous Ring, C6~C10 aromatic ring or the heteroatomic 5-12 member hetero-aromatic ring containing 1~4 in oxygen, sulphur and nitrogen；
R1It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, substituted or unsubstituted It is C1~C6 alkyl, substituted or unsubstituted C1~C6 alkoxy, substituted or unsubstituted C6~C10 aryl, substituted or unsubstituted Heterocycle, the substituted or unsubstituted C1~C6 alkyl-benzene containing 1~3 heteroatomic 5-7 member in oxygen, sulphur and nitrogen Base, takes substituted or unsubstituted C1~C6 alkyl-(containing 1~3 heteroatomic 5-7 unit's heteroaryl selected from oxygen, sulphur and nitrogen) Generation or unsubstituted C3~C12 naphthenic base, substituted or unsubstituted C2~C10 acyl group, substituted or unsubstituted C2~C10 ester Base, substituted or unsubstituted C6~C10 aryloxy group, substituted or unsubstituted C1~C6 amide groups ,-OSO2R5、-OCOR5、- COR5、-SO2R5；
A is 1,2,3,4,5,6,7,8,9,10 or 11；
X is N (CH2)cR3, O or S；
B is 0,1,2,3,4,5；
C is 0,1,2,3,4,5；
R2And R3Be each independently selected from the following group: nothing, hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, substitution or Unsubstituted amidino groups (- C (=NH) NH2), substituted or unsubstituted guanidine radicals (- NH-C (=NH) NH2), substituted or unsubstituted C1 ~C6 alkyl, containing 1-7 fluorine atom replace C1~C3 alkyl, substituted or unsubstituted C1~C6 alkoxy, replace or not Substituted C6~C10 aryl, the substituted or unsubstituted heteroatomic 5-12 member containing 1~3 in oxygen, sulphur and nitrogen it is miscellaneous Ring, substituted or unsubstituted C1~C6 alkyl phenyl, substituted or unsubstituted C1~C6 alkyl-(5-7 unit's heteroaryl), replace or Unsubstituted C3~C12 naphthenic base, substituted or unsubstituted C2~C10 ester group, takes substituted or unsubstituted C2~C10 acyl group Generation or unsubstituted C1~C6 amide groups ,-SO2R5、-COR5；
Or-(CH2)b-R2、-(CH2)c-R3Collectively form ring selected from the group below with the X atom being connected: it is substituted or unsubstituted containing 1~8 heteroatomic 3~12 circle heterocyclic ring (including monocycle or bicyclic), it is substituted or unsubstituted containing 1~4 selected from oxygen, sulphur and Heteroatomic 5-12 member hetero-aromatic ring (including monocycle or bicyclic) in nitrogen；
The substitution refers to that one or more hydrogen atoms on group are replaced by substituent group selected from the group below: deuterium, tritium, halogen, cyanogen Base, amino, hydroxyl, nitro, aldehyde radical, oxygen atom (=O), C1~C6 alkyl, the C1~C3 alkane replaced containing 1-7 fluorine atom Base, C1~C6 alkoxy, C6~C10 aryl, the heterocycle containing 1~3 heteroatomic 5-12 member in oxygen, sulphur and nitrogen, C1~C6 alkyl-phenyl, C1~C6 alkyl diphenyl base, C1~C6 alkyl-(5-7 unit's heteroaryl), C3~C12 naphthenic base, C2~ C10 acyl group, C2~C10 ester group, C6~C10 aryloxy group, C1~C6 amide groups ,-C (=NH) N (R5)2,-NH-C (=NH) N (R5)2、-COR5、-OSO2R5、-OCOR5、-SO2R5；
R5Be selected from the group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, oxygen atom (=O), C1~C6 alkyl, C1~C3 alkyl, C1~C6 alkoxy, C6~C10 aryl containing the substitution of 1-7 fluorine atom are selected from oxygen, sulphur containing 1~3 With the heterocycle, C1~C6 alkyl phenyl, C1~C6 alkyl 5-7 unit's heteroaryl, C3~C12 cycloalkanes of the heteroatomic 5-7 member in nitrogen Base, C2~C10 acyl group, C2~C10 ester group, C2~C10 aryloxy group, C1~C6 amide groups.
2. acrylic compounds as described in claim 1, its enantiomter, diastereoisomer, racemic modification and its Mixture or its pharmaceutically acceptable salt, which is characterized in that the compound has the structure as shown in Formula Il:
Wherein,
X is N；
Y is CH2、CO、NH、O、S、SO2；
Z is CH2、CO、NH、O、S、SO2；
D is 0,1,2,3；
E is 0,1,2,3；
B is selected from the group: nothing, contains 1~8 heteroatomic 3~12 yuan at 3~12 yuan of saturated carbon rings, 3~12 yuan of unsaturated carbocyclics The hetero-aromatic ring of heterocycle, C6~C10 aromatic ring or the heteroatomic 5-12 member containing 1~4 in oxygen, sulphur and nitrogen；
R4Be each independently selected from the following group: hydrogen, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, C1~C6 alkyl, contains deuterium Have 1-7 fluorine atom replace C1~C3 alkyl, C1~C6 alkoxy, C6~C10 aryl, containing 1~3 selected from oxygen, sulphur and Heterocycle, C1~C6 alkyl-phenyl, the C1~C6 alkyl-(5-7 unit's heteroaryl), C3~C12 ring of heteroatomic 5-7 member in nitrogen Alkyl, C2~C10 acyl group, C2~C10 ester group, C2~C10 aryloxy group, C1~C6 amide groups ,-OSO2R5、-OCOR5、-SO2R5；
F is 1,2,3,4,5,6,7,8.
3. acrylic compounds according to claim 1 or 2, its enantiomter, diastereoisomer, racemic modification And its mixture or its pharmaceutically acceptable salt, which is characterized in that in general formula I and general formula II:
A is selected from the group: C3~C8 carbocyclic ring, containing 1~3 heteroatomic 3~8 circle heterocyclic ring, naphthalene nucleus, phenyl ring or contain 1~4 The aromatic heterocycle of heteroatomic 5-10 member in oxygen, sulphur and nitrogen；
R1It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, aldehyde radical, substituted or unsubstituted C1~C3 alkyl, substituted or unsubstituted C6~C10 aryl, replaces or does not take~substituted or unsubstituted C1~C3 alkoxy Heterocycle, substituted or unsubstituted C1~C3 alkyl-benzene containing 1~3 hetero atom 5-7 member in oxygen, sulphur and nitrogen in generation Base, substituted or unsubstituted C1~C3 alkyl-(5-7 unit's heteroaryl), substituted or unsubstituted C3~C8 naphthenic base, replace or not Substituted C2~C6 acyl group, substituted or unsubstituted C2~C6 ester group, substituted or unsubstituted C6~C10 aryloxy group, replace or Unsubstituted C1~C6 amide groups ,-OSO2R5、-OCOR5、-COR5、-SO2R5；
R2And R3It is each independently selected from the following group: hydrogen, deuterium, tritium, cyano, amino, hydroxyl, nitro, aldehyde radical, substituted or unsubstituted Amidino groups, substituted or unsubstituted guanidine radicals, substituted or unsubstituted C1~C6 alkyl, substituted or unsubstituted C1~C6 alkoxy, Substituted or unsubstituted C6~C10 aryl, the substituted or unsubstituted hetero atom 5-7 containing 1~3 in oxygen, sulphur and nitrogen Member heterocycle, substituted or unsubstituted C1~C3 alkyl phenyl, substituted or unsubstituted C1~C3 alkyl-(5-7 unit's heteroaryl), Substituted or unsubstituted C3~C8 naphthenic base, substituted or unsubstituted C2~C6 acyl group, substituted or unsubstituted C2~C6 ester group, Substituted or unsubstituted C1~C6 amide groups ,-SO2R5、-COR5。
4. acrylic compounds as described in claim 1, its enantiomter, diastereoisomer, racemic modification and its Mixture or its pharmaceutically acceptable salt, which is characterized in that
A is selected from the group: C3~C8 carbocyclic ring, phenyl ring, contains 1~4 heteroatomic 5-12 member in oxygen, sulphur and nitrogen at naphthalene nucleus Hetero-aromatic ring；
A is 1,2,3 or 4；
R2And R3Be each independently selected from the following group: hydrogen, deuterium, tritium, amino, hydroxyl, substituted or unsubstituted amidino groups, substitution do not take The guanidine radicals in generation, C1~C3 alkyl containing the substitution of 1-7 fluorine atom, replaces or does not take substituted or unsubstituted C1~C6 alkyl The phenyl in generation, the substituted or unsubstituted hetero atom 5-7 member containing 1~3 in oxygen, sulphur and nitrogen heterocycle, replace or not Substituted C1~C3 alkyl phenyl, substituted or unsubstituted C1~C3 alkyl 5-7 unit's heteroaryl, substituted or unsubstituted C3~C8 Naphthenic base ,-SO2R5、-COR5。
5. acrylic compounds as claimed in claim 2, its enantiomter, diastereoisomer, racemic modification and its Mixture or its pharmaceutically acceptable salt, which is characterized in that B is selected from the group: nothing or substituted or unsubstituted phenyl ring, wherein It include 1~4 substituent group on the substituted phenyl ring；
Y is CO, SO2；
Z is CH2,NH,O,S；
D is 0,1；
E is 0,1；
R4It is each independently selected from the following group: hydrogen, deuterium, tritium, halogen, cyano, amino, hydroxyl, nitro, C1~C6 alkyl, C1~C3 alkane Oxygroup, C6~C10 aryl, the heterocycle of 5-7 member, C1~C3 alkyl phenyl, C1~C3 alkyl 5-7 unit's heteroaryl, C3~C8 cycloalkanes Base, C2~C6 acyl group, C2~C6 ester group, C2~C10 aryloxy group, C1~C6 amide groups ,-OSO2R5、-OCOR5、-SO2R5。
6. acrylic compounds according to claim 1 or its racemic modification, R- isomers, S- isomers, can medicine With salt or their mixture, wherein the acrylic compounds are selected from following compound:
7. a kind of preparation method of acrylic compounds as described in claim 1, which is characterized in that the preparation method choosing From following steps 1 and step 2:
Step 1:
Compound (III) under alkaline condition (such as triethylamine) by carboxyl group activating reagents (such as 1- ethyl-(3- dimethylamino Base propyl) phosphinylidyne diimmonium salt hydrochlorate) activation and formula (IV) compound reacted, be condensed to yield formula (I) compound；
Step 2:
Compound (III) under alkaline condition (such as triethylamine) by carboxyl group activating reagents (such as pivaloyl chloride) activate and formula (V) compound is reacted, and is condensed to yield formula (II) compound.
8. a kind of pharmaceutical composition, containing therapeutically effective amount selected from compound of formula I described in claim 1, its is pharmaceutically acceptable One of salt, racemic modification, R- isomers and S- isomers or a variety of, it is and optionally, one or more pharmaceutical Carrier, excipient, adjuvant, auxiliary material and/or diluent.
9. a kind of CREB/CRTC interaction inhibitor is selected from acrylic compounds described in claim 1 containing therapeutically effective amount Object, its pharmaceutical salt, racemic modification, R- isomers and S- isomers are closed, or combinations thereof.
10. compound of formula I as described in claim 1, its racemic modification, R- isomers, S- isomers or officinal salt are being made Purposes in the standby drug for treating or preventing metabolic disease relevant to diabetes；Preferably, the disease is selected from the group: sugar Urinate disease, obesity, liver fibrosis, metabolic disease；Preferably, the drug further includes anti-type-2 diabetes mellitus drug；More preferably Ground, the anti-type-2 diabetes mellitus drug are selected from the group: melbine, sitagliptin, Egelieting, vildagliptin, Luo Gelie Ketone, troglitazone, Dapagliflozin, ipragliflozin, canagliflozin, En Gelie are net, tofogliflozin, Ai Gelie are net, glug column are net, or A combination thereof.
CN201810457963.2A 2018-05-14 2018-05-14 A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes Pending CN110483432A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201810457963.2A CN110483432A (en) 2018-05-14 2018-05-14 A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes
PCT/CN2019/086905 WO2019219016A1 (en) 2018-05-14 2019-05-14 Acrylic compound and preparation method therefor and pharmaceutical composition and application thereof
CN201980032898.1A CN112204018B (en) 2018-05-14 2019-05-14 Acrylic compound, preparation method, pharmaceutical composition and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810457963.2A CN110483432A (en) 2018-05-14 2018-05-14 A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes

Publications (1)

Publication Number Publication Date
CN110483432A true CN110483432A (en) 2019-11-22

Family

ID=68539512

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201810457963.2A Pending CN110483432A (en) 2018-05-14 2018-05-14 A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes
CN201980032898.1A Active CN112204018B (en) 2018-05-14 2019-05-14 Acrylic compound, preparation method, pharmaceutical composition and application thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201980032898.1A Active CN112204018B (en) 2018-05-14 2019-05-14 Acrylic compound, preparation method, pharmaceutical composition and application thereof

Country Status (2)

Country Link
CN (2) CN110483432A (en)
WO (1) WO2019219016A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117402123A (en) * 2022-07-06 2024-01-16 中国科学院上海药物研究所 Alpha, beta-unsaturated amide compounds, preparation method, pharmaceutical composition and application thereof

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3298917A (en) * 1964-09-15 1967-01-17 Merck & Co Inc Antidiabetic nu-acylaliphaticsulfonamides
CN100430386C (en) * 2002-11-07 2008-11-05 默克公司 Phenylalanine derivatives as depeptidyl peptidase inhibitors for the treatment or prevention of diabetes
AU2003297564A1 (en) * 2002-12-04 2004-06-23 Merck & Co., Inc. Phenylalanine derivatives as dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
AU2003903251A0 (en) * 2003-06-26 2003-07-10 Biotron Limited Antiviral compounds and methods
US20120088737A2 (en) * 2009-10-02 2012-04-12 Ajinomoto Co., Inc Novel acyl guanidine derivatives
SG10201501272SA (en) * 2009-10-22 2015-04-29 Fibrotech Therapeutics Pty Ltd Fused ring analogues of anti-fibrotic agents
CN101845025B (en) * 2010-06-30 2012-04-25 哈尔滨理工大学 Preparation method of 3-alpha,beta-unsaturated acyl-1,3-oxazolidine-2-ketone
CN102617501A (en) * 2011-01-31 2012-08-01 中国科学院上海药物研究所 Substituted valeramide compound, preparation method and application thereof

Also Published As

Publication number Publication date
WO2019219016A1 (en) 2019-11-21
CN112204018A (en) 2021-01-08
CN112204018B (en) 2023-08-29

Similar Documents

Publication Publication Date Title
US10881656B2 (en) HIF inhibitors and use thereof
US5721277A (en) Compounds and methods for inhibiting hyper-proliferative cell growth
RU2746323C9 (en) Fluorinated compound of cyclopropylamine, the method of preparation, the pharmaceutical composition and its use
Bhandari et al. Design, synthesis and pharmacological screening of novel antihypertensive agents using hybrid approach
EP2875010B1 (en) Thiophene derivatives useful for the treatment of diabetes
AU2017258781C1 (en) Di-substituted pyrazole compounds for the treatment of diseases
FR2967674A1 (en) HETEROARYLSULFONAMIDE DERIVATIVES, THEIR PREPARATION AND THEIR APPLICATION IN HUMAN THERAPEUTICS
TW202214584A (en) Shp2 inhibitor and composition and application thereof
US6908923B2 (en) Compositions and methods for treating heart failure
US8741905B2 (en) Compounds and methods for treating autoimmune diseases
US10927085B2 (en) 1,2-naphthoquinone based derivative and method of preparing the same
Gao et al. Discovery and anti-inflammatory evaluation of benzothiazepinones (BTZs) as novel non-ATP competitive inhibitors of glycogen synthase kinase-3β (GSK-3β)
CN110483432A (en) A kind of acrylic compounds and preparation method thereof, pharmaceutical composition and purposes
CN106810512B (en) IDH2 mutant inhibitor and application thereof
EP3613735B1 (en) Novel sirt 1 activator and medicinal use thereof
EP3120848B1 (en) Therapeutic/preventive agent containing coumarin derivative as active ingredient
US20150190384A1 (en) Small molecule inhibitors of viral protein interactions with human t-rna
US20230357165A1 (en) Quinazolinones derivatives for treatment of non-alcoholic fatty liver disease, preparation and use thereof
Yang et al. Synthesis of 2-(4-substituted benzyl-1, 4-diazepan-1-yl)-N-(3, 4-dihydro-3-oxo-2H-benzo [b][1, 4] oxazin-7-yl) acetamides and their positive inotropic evaluation
EP3027605B1 (en) Novel indazole compounds and a process for the preparation thereof
CN102718727B (en) The aryl urea derivative of GK and PPAR double excitation activity
US20060194971A1 (en) Anethole dithiolethione and other dithiolethiones for the treatment of conditions associated with dysfunction of monoamine neruotransmission
CN117886734A (en) Heterocyclic amide compound and preparation method, pharmaceutical composition and application thereof
CN117143040A (en) Cyclobutene-diketo-benzoxazole derivative as well as preparation method and application thereof
TW202128618A (en) Pyrrole amide compound and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20191122

WD01 Invention patent application deemed withdrawn after publication