CN110468151B - Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid - Google Patents
Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid Download PDFInfo
- Publication number
- CN110468151B CN110468151B CN201910831986.XA CN201910831986A CN110468151B CN 110468151 B CN110468151 B CN 110468151B CN 201910831986 A CN201910831986 A CN 201910831986A CN 110468151 B CN110468151 B CN 110468151B
- Authority
- CN
- China
- Prior art keywords
- fusarium oxysporum
- potato
- vector
- dry rot
- salicylic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
- A01N37/36—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a singly bound oxygen or sulfur atom attached to the same carbon skeleton, this oxygen or sulfur atom not being a member of a carboxylic group or of a thio analogue, or of a derivative thereof, e.g. hydroxy-carboxylic acids
- A01N37/38—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a singly bound oxygen or sulfur atom attached to the same carbon skeleton, this oxygen or sulfur atom not being a member of a carboxylic group or of a thio analogue, or of a derivative thereof, e.g. hydroxy-carboxylic acids having at least one oxygen or sulfur atom attached to an aromatic ring system
- A01N37/40—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a singly bound oxygen or sulfur atom attached to the same carbon skeleton, this oxygen or sulfur atom not being a member of a carboxylic group or of a thio analogue, or of a derivative thereof, e.g. hydroxy-carboxylic acids having at least one oxygen or sulfur atom attached to an aromatic ring system having at least one carboxylic group or a thio analogue, or a derivative thereof, and one oxygen or sulfur atom attached to the same aromatic ring system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Abstract
The invention discloses a fusarium oxysporum TOR gene RNAi vector, which takes a plant expression vector pEarleyGate 303 as a skeleton vector, and Seq ID No: 3, and (b) is the sequence shown in the specification. Also disclosed is a microbial transformant containing the aforementioned RNAi vector. Also discloses application of the RNAi vector in preventing and treating potato dry rot and blight. Also discloses a method for jointly preventing and treating the dry rot and the wilt of the potatoes, which comprises the following steps: the RNAi vector is transferred into the potato to obtain transgenic potato, and the transgenic potato is treated by salicylic acid to prevent and control dry rot and blight. The invention successfully constructs the fusarium oxysporum RNAi interference vector, and the combined use of the plant hormone salicylic acid and the FoTOR12-RNAi transgene can remarkably weaken the pathogenicity of the fusarium oxysporum, and provides an effective method for preventing and treating plant blight and dry rot caused by the fusarium oxysporum.
Description
Technical Field
The invention relates to the technical field of molecular biology and plant disease control, in particular to a fusarium oxysporum TOR gene RNAi vector and a method for controlling potato dry rot and blight by combining the fusarium oxysporum TOR gene RNAi vector with salicylic acid.
Background
Potatoes belong to solanaceae herbaceous plants, tubers are edible, and are the fourth most important grain crops in the world after wheat, rice and corn. As an important potato producing country in the world in China, the potato planting area and the total yield always live at the top of the world, and the potato planting area in China is estimated to be enlarged to more than 1 hundred million acres in 2020, the average acre yield is improved to 1300 kilograms, and the total yield reaches about 1.3 hundred million tons, so that the development of the potato industry in China inevitably has important influence on the potato industry in the world. In 2015, the Ministry of agriculture proposes a staple potato food product and an industrial development strategy, and focuses on promoting the conversion of potato consumption from non-staple food to staple food and from raw material products to industrial series finished products, so that the potato becomes the fourth staple grain crop of China after rice, wheat and corn.
Potato wilt and dry rot are important fungal diseases suffered by potatoes during growth and storage. Potato wilt is reported in the united states, yerba mate, india, iran, italy, and other countries. The potato wilt also occurs very widely in China, for example: the disease is reported in Hebei, inner Mongolia, Gansu, Xinjiang, Guizhou and the like. With the continuous cropping phenomenon, the potato blight is increasingly serious and the loss of potato production is increased along with the continuous enlargement of potato planting area in China. The average incidence of potato blight in some growing areas in Guizhou is reported to be above 25%; in some growing areas of inner Mongolia, the incidence of severe plots is 78%. It was reported by Rakhimov and Khakimov that potato blight is caused by Fusarium solani (Fusarium solani), Fusarium moniliforme (Fusarium moniliforme), Fusarium oxysporum (Fusarium oxysporum), Fusarium sambucinum (Fusarium sambucinum), Fusarium nivale (Fusarium nivale), and Fusarium oxysporum was first found in Greek in 1979 to cause the occurrence of potato blight. The main pathogenic bacteria causing potato wilt in China are fusarium oxysporum (F.oxysporum). In addition, Fusarium oxysporum is also one of the pathogenic bacteria of potato dry rot in China, and researches show that the dry rot of potatoes in Hebei and inner Mongolia is caused by 4 kinds of Fusarium, namely Fusarium sambucinum (Fusarium sambucinum), Fusarium acuminatum (Fusarium acuminatum), Fusarium oxysporum (Fusarium oxysporum) and Fusarium fragrans (Fusarium redolens). The potato dry rot is a tuber disease which commonly occurs in fields and cellars, and the annual incidence rate of the potato dry rot reaches 20-50%. Due to nationwide allocation and transportation of potato seed resources, the dry rot of potatoes tends to develop from local regions to all over the country. Therefore, the control of fusarium oxysporum has important economic value for the potato industry.
In view of the severe and widespread virulence of Fusarium oxysporum, Fusarium oxysporum has been classified by researchers as the third most soil-borne pathogenic fungus in the world. The pathogenesis of fusarium oxysporum, the disease resistance and defense of plants and the interaction mechanism between the plants and the fusarium oxysporum, which are developed by taking the prevention and the treatment of fusarium oxysporum as the center, have become research hotspots in the plant pathology field. Tor (target of rapamycin) is an evolutionarily conserved serine, threonine protein kinase present in eukaryotes. In many eukaryotes, TOR is an important regulator of cell growth, metabolism, nutrition, energy, hormones, stress response, etc.; TOR is a conserved master regulator in yeast, plant, animal and human evolution, which integrates nutrient and energy signals to promote cell proliferation and growth. In eukaryotes such as plants, yeasts, and mammals, mutations in the TOR gene are all lethal mutations. At present, the function of the TOR protein of fusarium oxysporum in the aspects of hypha growth and pathogenicity is rarely reported.
The plant hormone Salicylic Acid (SA) plays a key role in resisting infection of various pathogenic bacteria, and research reports show that when the pathogenic bacteria infect plants, Salicylic acid resists infection of the pathogenic bacteria by activating expression of disease resistance related genes. However, it has not been reported that salicylic acid directly enters pathogenic bacteria to kill the pathogenic bacteria by inhibiting the activity of key target proteins.
Disclosure of Invention
The invention aims to solve the problems and provides a fusarium oxysporum TOR gene RNAi vector and a method for preventing and treating potato dry rot and blight by combining the fusarium oxysporum TOR gene RNAi vector with salicylic acid.
The technical scheme adopted by the invention for realizing the purpose is as follows:
a fusarium oxysporum TOR gene RNAi vector is characterized in that a plant expression vector pEarleyGate 303 is used as a skeleton vector, and Seq ID No: 3, and (b) is the sequence shown in the specification.
A microorganism transformant containing the above RNAi vector.
The RNAi vector is applied to prevention and control of potato dry rot and blight.
A method for preventing and treating the dry rot and the wilt of potato by combining a fusarium oxysporum RNAi vector and salicylic acid comprises the steps of transferring the RNAi vector into the potato to obtain a transgenic potato, and treating the transgenic potato by using the salicylic acid to prevent and treat the dry rot and the wilt of the potato.
In the method, the transgenic potatoes are sprayed with the salicylic acid solution to prevent dry rot and blight in the plant growth process.
The invention has the beneficial effects that: the gene RNAi interference vector of the fusarium oxysporum TOR is successfully constructed, and experiments prove that the pathogenicity of the fusarium oxysporum can be remarkably weakened by the combined use of the plant hormone salicylic acid and the gene FoTOR12-RNAi transgenes, so that an effective method is provided for preventing and treating plant blight and dry rot caused by the fusarium oxysporum. Salicylic acid is a natural disease-resistant compound produced by plants, can greatly reduce the use of chemical pesticides, can be used as a potential pollution-free biological bactericide, and has great practical significance and economic value for maintaining the balance and sustainable development of an ecosystem. But the effect of using salicylic acid alone to prevent and treat fusarium oxysporum is limited, and the combined application of the transgenic technology and the salicylic acid can obviously weaken the pathogenicity of the fusarium oxysporum and obviously reduce the occurrence of plant blight and dry rot.
Drawings
FIG. 1 is a graph showing the results of inhibiting the growth of Fusarium oxysporum hyphae by salicylic acid at different concentrations, wherein A is a graph of the shape of a PDA plate after 5 days of culture, B is a graph of the hyphae morphology under a scanning electron microscope, C is a result of the colony diameter, and D is a result of the relative spore number.
FIG. 2 is a graph showing that SA attenuates the pathogenicity of Fusarium oxysporum to potato leaves and potato pieces, wherein A is a graph showing that Fusarium oxysporum suspension is inoculated to the leaves and potato pieces and cultured for 4 days, B is a result showing the diameter of necrotic spots, and C is a result showing the weight of hyphae.
FIG. 3 is a graph of the results of experiments on FoTOR siRNAs for reducing the pathogenicity of Fusarium oxysporum to potato leaves and potato pieces, wherein A is a graph of the condition that Fusarium oxysporum suspension and siRNAs are uniformly mixed and inoculated to leaves and potato pieces for culturing for 4 days, NC is a negative control, B is a necrotic spot diameter result, and C is a hypha weight result.
FIG. 4 is a P35S construction result chart of FoTOR12-RI interference vector, wherein A is a schematic structural diagram of the vector, and B is a PCR identification result of transgenic potato plants.
FIG. 5 is a diagram of the pathogenicity result of FoTOR12-RI potato plants for inhibiting fusarium oxysporum, wherein A is a diagram of the situation that fusarium oxysporum suspension is inoculated on transgenic potato leaves and potato blocks and cultured for 4 days, B is a result of necrotic spot diameter, C is a result of hypha weight, D is a diagram of the growth situation of potato plants subjected to negative control of missed bacteria, and E is a diagram of the growth situation of potato plants subjected to normal culture for 1 month after inoculation.
FIG. 6 is a graph of the pathogenicity of Fusarium oxysporum of FoTOR12-RI potato plants treated with SA, wherein A is a graph of the mixed Fusarium oxysporum suspension and SA inoculated transgenic potato leaves and potato blocks cultured for 4 days, B is a graph of the diameter of necrotic spots, C is a graph of the hypha weight, D is a graph of the growth of a negative control group treated with 1mM SA only, and E is a graph of the mixed Fusarium oxysporum suspension and SA treated transgenic P35S, and FoTOR12-RI potato plants are cultured normally for 1 month.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Example 1 the phytohormone Salicylic Acid (SA) inhibits the mycelial growth and virulence of Fusarium oxysporum-Fusarium oxysporum treated on plates with different concentrations of SA
Respectively preparing PDA flat plates with different concentrations of SA of 0.5mmol/L, 1mmol/L, 5mmol/L, 10mmol/L and 15mmol/L under aseptic condition, and placing a piece of PDA culture medium containing fusarium oxysporum hyphae in the middle of the flat plate by a puncher after solidification. After sealing, the cells were incubated in a 25 ℃ fungal incubator with at least 3 replicates per treatment. After the fusarium oxysporum is cultured for 5 days, the diameter of fungal hyphae is observed and counted; meanwhile, the hypha morphology of fusarium oxysporum after 5 days of culture was observed under a scanning electron microscope, and the result is shown in fig. 1B. According to the experimental results, the inhibition of hyphal growth is more and more obvious along with the increase of the concentration of SA, which shows that SA inhibits the growth of fusarium oxysporum hyphae in a dose-dependent manner. From the statistical hyphal diameter (FIG. 1C), it was found that the treatment of Fusarium oxysporum with SA gave a drug concentration of IC50 (the drug concentration at which hyphal growth was inhibited by half) of 5 mmol/L; when the concentration of SA is 10mmol/L, the hyphae stop growing completely, and the scanning electron microscope result shows that the hyphae expand and twist and the compartment distance is shortened at the moment. Furthermore, the yield of fusarium oxysporum spores (fig. 1D) also decreased significantly with increasing concentration of SA.
Second, pathogenic experiment of SA inhibition fusarium oxysporum
In order to test whether SA inhibits pathogenicity of fusarium oxysporum, spore suspensions of SA and fusarium oxysporum with different concentrations are mixed uniformly and inoculated with potato leaves and potato blocks, each treatment comprises 10 leaves and potato blocks, and each experiment is repeated for 3 times. The culture was carried out at a temperature of about 25 ℃ and a humidity of more than 75% for 4 days, and then necrotic areas of the leaves and potato pieces were observed and recorded. The results show (figure 2) that SA inhibits the infection ability of fusarium oxysporum on potato leaves and potato blocks; the higher the concentration of SA, the smaller the necrotic spots caused by Fusarium oxysporum in potato leaves and potato pieces (statistical results in FIG. 2B and FIG. 2C are the average of 3 replicates). When the concentration of SA reaches 10mmol/L, fusarium oxysporum cannot effectively infect the potatoes, and the pathogenicity to the potatoes is lost.
Example 2 silencing of Fusarium oxysporum FoTOR genes by siRNAs study of the virulence of Fusarium oxysporum in Potato
First, design and synthesize siRNAs for FoTOR
The yeast TOR protein is used as a reference to search a fusarium oxysporum genome database, and the fusarium oxysporum is found to contain 2 TOR genes, wherein the full-length CDS sequences are FoTOR1:7329bp respectively; FoTOR2:5277 bp. The following siRNAs were designed and synthesized using siRNA design software against the CDS sequence of FoTOR. siRNA 1: CCTTACAAACACCAGGTAATT (Seq ID No: 6); siRNA 2: GCAAGATCCTGCTCAACATTT (Seq ID No: 7); siRNA 3: GAGGTGGCGATGAAGAGAGTT (Seq ID No: 8); negative control (Negative control, NC): TTCTCCGAACGTGTCACGTTT (Seq ID No: 9). siRNAs were synthesized by Biotechnology engineering (Shanghai) Inc.
Second, siRNAs inoculation experiment
The synthesized siRNAs are respectively mixed with fusarium oxysporum spore suspension and inoculated with potato leaves and potato blocks, each treatment comprises 10 leaves and potato blocks, and each experiment is repeated for 3 times. The culture was carried out at a temperature of about 25 ℃ and a humidity of more than 75% for 4 days, and then necrotic areas of the leaves and potato pieces were observed and recorded. The results are shown in fig. 3 (fig. 3B is the necrotic spot diameter result, fig. 3C is the hypha weight result, and the statistical result is the average value of 3 repeated experiments), and the results show that after the siRNAs and the fusarium oxysporum spore suspension are mixed uniformly, the necrotic spot area of potato leaves and potato blocks caused by fusarium oxysporum is reduced by silencing the FoTOR gene, so that the pathogenicity of fusarium oxysporum is reduced. The siRNAs are used for effectively inhibiting the pathogenicity of fusarium oxysporum after silencing the FoTOR genes, and on the basis of the result, the applicant further performs RNAi interference research on the FoTOR genes.
Example 3 construction of Fusarium oxysporum TOR Gene RNAi expression vector
The CDS sequences of FoTOR1 and FoTOR2 of Fusarium oxysporum are subjected to homologous alignment in NCBI, a section of most appropriate sequence is respectively found for constructing RNAi interference vectors, and the RNAi interference sequences of FoTOR1 and FoTOR2 are combined and named as FoTOR 12. The sequence of FoTOR12 is Seq ID No:1 (FoTOR 1, not underlined, FoTOR2, underlined):
CGATCCAGGAGAGACTACTTGATATGCTCAGCGTAGTTCTCTGCGGTGAGCCATTTAAACCCCTTGGCGCTCCACAACCAAATACTCTCAGCTCAGTCCCGATTATTCCCAAAGACGCAAAAGACCCCCACGCTTATGAGCACCGAAGGGCTGAGGTCAAGTTGGCGCTCAACACTCTCGGTAGTTTCGATTTCTCAGGACATGTTCTGAACGAGTTTGTTCGAGACGTCGCAATCAAGTACGTTGAAGACGAGGATCCAGAAATCCGTGAGGCAGCGGCCTTGACATGCTGCCAATTATCACCACGCGGCTGTGATTGAAGCTATTATGAACATCTTCCGCACCCTGGGCTTGGAGTGTGTTTCGTTCCTT GATAGAATCATACCGGCATTCCTCCAGGTGATACGATCGGCCACTTCCACGAGACCCGAGTCTTACTTCAACCAAC TGGCCACTCTCGTCAGCATCGTGCGGCAACATATAAGAAATTATCTTCCATTAATTGTCGAGATTTTGCAGGAGTA CTGGCACACCTCGCCATCACTACAGACCACCATCTTGTCGCTTGTAGAGGCCATTTCGAGGTCGCTTGAGGGTGAA。
corresponding enzyme cutting sites are added at both ends of the FoTOR12 sequence, Asc I-Not I enzyme cutting sites are added at the 5 'end of the fused sequence, and SbfI-BbvC I enzyme cutting sites are added at the 3' end. The sequence Seq ID No shown below was synthesized in Biotechnology engineering, Inc.: 2 (underlined letters represent the corresponding cleavage sites):GGCGCGCCGCGGCCGCCGATCCAGGAGAGACTACTTGATATGCTCAGCGTAGTTCTCTGCGGTGAGCCATTTAAACCCCTTGGCGCTCCACAACCAAATACTCTCAGCTCAGTCCCGATTATTCCCAAAGACGCAAAAGACCCCCACGCTTATGAGCACCGAAGGGCTGAGGTCAAGTTGGCGCTCAACACTCTCGGTAGTTTCGATTTCTCAGGACATGTTCTGAACGAGTTTGTTCGAGACGTCGCAATCAAGTACGTTGAAGACGAGGATCCAGAAATCCGTGAGGCAGCGGCCTTGACATGCTGCCAATTATCACCACGCGGCTGTGATTGAAGCTATTATGAACATCTTCCGCACCCTGGGCTTGGAGTGTGTTTCGTTCCTTGATAGAATCATACCGGCATTCCTCCAGGTGATACGATCGGCCACTTCCACGAGACCCGAGTCTTACTTCAACCAACTGGCCACTCTCGTCAGCATCGTGCGGCAACATATAAGAAATTATCTTCCATTAATTGTCGAGATTTTGCAGGAGTACTGGCACACCTCGCCATCACTACAGACCACCATCTTGTCGCTTGTAGAGGCCATTTCGAGGTCGCTTGAGGGTGAACCTGCAGGGCTGAGG. The backbone vector pCR8/GW/TOPO was made to form a "hairpin" structure containing the FoTOR12 sequence using the promoter of the cauliflower virus (P35S), the fourth intron of Arabidopsis thaliana ACTIN2 (In4) and the terminator of the cauliflower virus (T35S), and then formed dsRNA under the action of the enzyme.
The sequence ID No: 2 into a skeleton vector pCR8/GW/TOPO to obtain a recombinant vector, wherein a P35S promoter, a NotI enzyme cutting site, a sequence shown In SEQ ID NO:1, a SbfI enzyme cutting site, a fourth intron (In4) of ACTIN2, a BbvC I enzyme cutting site, a reverse complementary sequence shown In SEQ ID NO:1, an Asc I enzyme cutting site and a T35S terminator which are sequentially connected are inserted into a polyclonal enzyme cutting site, and the sequence of the connection of the fragments inserted into pCR8/GW/TOPO is shown as a sequence table SEQ ID No: 3, respectively. Seq ID No: 3 sequence is recombined on a plant expression vector pEarleyGate 303 to obtain an RNAi expression vector of the TOR gene of the fusarium oxysporum, which is named as P35S: FoTOR12-RI, the structure of which is shown in figure 4A, and the resistance of the interference vector in the plant is kanamycin resistance.
The specific process of constructing the RNAi expression vector of the TOR gene of Fusarium oxysporum refers to the procedure of 'example 1 construction of RNAi vector of TOR gene of Plutella xylostella' of Chinese patent ZL 201510742083.6.
After the sequencing verification is correct, the constructed RNAi interference vector of P35S, i.e. FoTOR12-RI, is transformed into Agrobacterium LBA4404 strain, and positive clone is screened and identified; the agrobacterium containing the positive clone is transferred into a wild type potato Desiree plant by an agrobacterium-mediated genetic transformation technology, and the transgenic plant is obtained by screening kanamycin resistance. And (3) extracting DNA of the kanamycin resistant plant by using a DNA extraction kit, and carrying out PCR detection on the screened resistant plant. The detection with the primers P35S F (sequence 5'-ATGACGCACAATCCCACTATCCTTC-3', Seq ID No: 4) and FoTOR 12R (sequence 5'-GCGGCCGCCGATCCAGGAGAGACTAC-3', Seq ID No: 5) gave the result shown in FIG. 4B, and the amplified fragment was about 1500bp in length.
Example 4P 35S FoTOR12-RI transgenic Potato inoculation experiment
A total of 13 transgenic potato lines containing the interference vector were identified by PCR. A transgenic potato (named as FoTOR12-RI) plant containing a P35S FoTOR12-RI vector is cultured and grown to carry out a fusarium oxysporum inoculation experiment. Phenotypic observations showed no significant differences between the transgenic potato plants and the wild-type plants. Inoculating the leaves and potato blocks of the transgenic potatoes into a spore suspension of fusarium oxysporum, culturing for 4 days at the temperature of about 25 ℃ and the humidity of more than 75%, observing and recording the necrotic areas of the leaves and the potato blocks, wherein each strain respectively comprises 10 leaves and potato blocks, and each experiment is repeated for 3 times. The results show that most transgenic potatoes have fusarium oxysporum resistance, expressed by reduced necrotic spot area and less hyphal weight; among them, the resistance is most pronouncedAre transgenic potato lines FoTOR12-RI-8 and FoTOR 12-RI-12. The results are shown in FIGS. 5A, 5B and 5C, in which WT is a wild-type potato Desiree. Wild type potato Desiree plants, transgenic potato lines FoTOR12-RI-8 and FoTOR12-RI-12 were further planted in the pots for about 1 month before carrying out Fusarium oxysporum inoculation experiments, and 10 pots were planted in each line. Will be about 107A/mL suspension of Fusarium oxysporum spores was inoculated into potato roots by root-infestation, and each experiment was repeated 3 times. And (4) observing the disease condition after the inoculated potatoes continue to normally grow in the flowerpot for 1 month. As shown in FIG. 5E, transgenic potato plants FoTOR12-RI-8 and FoTOR12-RI-12 significantly slowed the occurrence of potato wilt disease when compared to WT wild-type potato plants; the growth of the inoculated transgenic potato plants, FoTOR12-RI-8 and FoTOR12-RI-12, was reduced compared to the non-inoculated transgenic potato plants (as shown in FIG. 5D), indicating that the transgenic potato plants, FoTOR12-RI-8 and FoTOR12-RI-12, were only partially attenuated by Fusarium oxysporum.
Example 5 SA and Fusarium oxysporum spore suspension, mixing, inoculating to Fotor12-RI transgenic potato experiment
The pathogenicity of fusarium oxysporum is observed by infecting a FOTOR12-RI transgenic potato plant and a wild potato plant after uniformly mixing a low-concentration plant hormone SA and a fusarium oxysporum spore suspension. Leaves and tubers of wild-type potato Desiree, transgenic potato FoTOR12-RI-8 and FoTOR12-RI-12 plants were inoculated with a spore suspension of Fusarium oxysporum (about 10 mM) mixed with SA (1mM)7seed/mL), culturing for 4 days at a temperature of about 25 ℃ and a humidity of more than 75%, observing and recording necrotic areas of leaves and potato pieces, each line comprising 10 leaves and potato pieces, respectively, and repeating each experiment for 3 times. The results are shown in fig. 6A, 6B, 6C (the statistical results in fig. 6B and 6C are the average of 3 replicates), the transgenic potatoes have significant fusarium oxysporum resistance, and the phenotype is significantly reduced necrotic spot area and less hyphal weight. Wild type potato Desiree, transgenic potato FoTOR12-RI-8 and FoTOR12-RI-12 plants were further planted in pots 1In the fusarium oxysporum inoculation experiment after about one month, 10 flowerpots are respectively planted in each strain, and about 10 flowerpots are planted7Fusarium oxysporum spore suspension and 1mM SA per mL are mixed uniformly and inoculated into potato roots by a root infection method, and each experiment is repeated for 3 times. And (4) after the inoculated potatoes continue to grow in the flowerpot for 1 month, observing the disease condition. The results are shown in FIG. 6E (FIG. 6D is a negative control treated with 1mM SA without addition of Fusarium oxysporum), and transgenic potato plants FoTOR12-RI-8 and FoTOR12-RI-12 mixed with SA were able to very significantly slow down the onset of potato wilt. The combined use of the FoTOR12-RI transgenic potato plant and low-concentration salicylic acid can remarkably inhibit the pathogenicity of fusarium oxysporum, and the combined use of the plant hormone salicylic acid and the FoTOR12-RI transgenic potato plant can effectively prevent and treat the plant fusarium wilt and dry rot caused by the fusarium oxysporum.
Sequence listing
<110> institute of agriculture in China academy of agricultural sciences, institute of Cotton, China academy of agricultural sciences
Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid
<160> 9
<210> 1
<211> 600
<212> DNA
<213> Artificial sequence
<220>
<223> FoTOR12
<400> 1
cgatccagga gagactactt gatatgctca gcgtagttct ctgcggtgag ccatttaaac 60
cccttggcgc tccacaacca aatactctca gctcagtccc gattattccc aaagacgcaa 120
aagaccccca cgcttatgag caccgaaggg ctgaggtcaa gttggcgctc aacactctcg 180
gtagtttcga tttctcagga catgttctga acgagtttgt tcgagacgtc gcaatcaagt 240
acgttgaaga cgaggatcca gaaatccgtg aggcagcggc cttgacatgc tgccaattat 300
caccacgcgg ctgtgattga agctattatg aacatcttcc gcaccctggg cttggagtgt 360
gtttcgttcc ttgatagaat cataccggca ttcctccagg tgatacgatc ggccacttcc 420
acgagacccg agtcttactt caaccaactg gccactctcg tcagcatcgt gcggcaacat 480
ataagaaatt atcttccatt aattgtcgag attttgcagg agtactggca cacctcgcca 540
tcactacaga ccaccatctt gtcgcttgta gaggccattt cgaggtcgct tgagggtgaa 600
<210>2
<211> 631
<212> DNA
<213> Artificial sequence
<223> FoTOR12 with cleavage sites added at both ends
<400> 2
ggcgcgccgc ggccgccgat ccaggagaga ctacttgata tgctcagcgt agttctctgc 60
ggtgagccat ttaaacccct tggcgctcca caaccaaata ctctcagctc agtcccgatt 120
attcccaaag acgcaaaaga cccccacgct tatgagcacc gaagggctga ggtcaagttg 180
gcgctcaaca ctctcggtag tttcgatttc tcaggacatg ttctgaacga gtttgttcga 240
gacgtcgcaa tcaagtacgt tgaagacgag gatccagaaa tccgtgaggc agcggccttg 300
acatgctgcc aattatcacc acgcggctgt gattgaagct attatgaaca tcttccgcac 360
cctgggcttg gagtgtgttt cgttccttga tagaatcata ccggcattcc tccaggtgat 420
acgatcggcc acttccacga gacccgagtc ttacttcaac caactggcca ctctcgtcag 480
catcgtgcgg caacatataa gaaattatct tccattaatt gtcgagattt tgcaggagta 540
ctggcacacc tcgccatcac tacagaccac catcttgtcg cttgtagagg ccatttcgag 600
gtcgcttgag ggtgaacctg cagggctgag g 631
<210>3
<211> 2284
<212> DNA
<213> Artificial sequence
<223>
<400> 3
gaattcgcga tcgcgtttaa acttgctgcc agcaggtccg attgagactt ttcaacaaag 60
ggtaatatcc ggaaacctcc tcggattcca ttgcccagct atctgtcact ttattgtgaa 120
gatagtggaa aaggaaggtg gctcctacaa atgccatcat tgcgataaag gaaaggccat 180
cgttgaagat gcctctgccg acagtggtcc caaagatgga cccccaccca cgaggagcat 240
cgtggaaaaa gaagacgttc caaccacgtc ttcaaagcaa gtggattgat gtgatggtcc 300
gattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc attgcccagc 360
tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca aatgccatca 420
ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg 480
acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca 540
agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc actatccttc 600
gcaagaccct tcctctatat aaggaagttc atttcatttg gagaggggat ctttttattt 660
ttaattttct ttcaaatact tccaactagt gcggccgccg atccaggaga gactacttga 720
tatgctcagc gtagttctct gcggtgagcc atttaaaccc cttggcgctc cacaaccaaa 780
tactctcagc tcagtcccga ttattcccaa agacgcaaaa gacccccacg cttatgagca 840
ccgaagggct gaggtcaagt tggcgctcaa cactctcggt agtttcgatt tctcaggaca 900
tgttctgaac gagtttgttc gagacgtcgc aatcaagtac gttgaagacg aggatccaga 960
aatccgtgag gcagcggcct tgacatgctg ccaattatca ccacgcggct gtgattgaag 1020
ctattatgaa catcttccgc accctgggct tggagtgtgt ttcgttcctt gatagaatca 1080
taccggcatt cctccaggtg atacgatcgg ccacttccac gagacccgag tcttacttca 1140
accaactggc cactctcgtc agcatcgtgc ggcaacatat aagaaattat cttccattaa 1200
ttgtcgagat tttgcaggag tactggcaca cctcgccatc actacagacc accatcttgt 1260
cgcttgtaga ggccatttcg aggtcgcttg agggtgaacc tgcaggagca ggtaaaattg 1320
gactgtcatt tctaagtttt tgcttcttgt ggttgattaa atgtagacaa ctcctctaat 1380
ggtttacatt ttctgtgtgt gtgtgtgtgt gtaatcagat gtgcctcagc cctgcaggtt 1440
caccctcaag cgacctcgaa atggcctcta caagcgacaa gatggtggtc tgtagtgatg 1500
gcgaggtgtg ccagtactcc tgcaaaatct cgacaattaa tggaagataa tttcttatat 1560
gttgccgcac gatgctgacg agagtggcca gttggttgaa gtaagactcg ggtctcgtgg 1620
aagtggccga tcgtatcacc tggaggaatg ccggtatgat tctatcaagg aacgaaacac 1680
actccaagcc cagggtgcgg aagatgttca taatagcttc aatcacagcc gcgtggtgat 1740
aattggcagc atgtcaaggc cgctgcctca cggatttctg gatcctcgtc ttcaacgtac 1800
ttgattgcga cgtctcgaac aaactcgttc agaacatgtc ctgagaaatc gaaactaccg 1860
agagtgttga gcgccaactt gacctcagcc cttcggtgct cataagcgtg ggggtctttt 1920
gcgtctttgg gaataatcgg gactgagctg agagtatttg gttgtggagc gccaaggggt 1980
ttaaatggct caccgcagag aactacgctg agcatatcaa gtagtctctc ctggatcggc 2040
ggccgcggcg cgcccggcca tgctagagtc cgcaaaaatc accagtctct ctctacaaat 2100
ctatctctct ctatttttct ccagaataat gtgtgagtag ttcccagata agggaattag 2160
ggttcttata gggtttcgct catgtgttga gcatataaga aacccttagt atgtatttgt 2220
atttgtaaaa tacttctatc aataaaattt ctaattccta aaaccaaaat ccagtgacga 2280
attc 2284
<210>4
<211> 25
<212> DNA
<213> Artificial sequence
<223> P35S F
<400> 4
atgacgcaca atcccactat ccttc 25
<210>5
<211> 26
<212> DNA
<213> Artificial sequence
<223> FoTOR12 R
<400> 5
gcggccgccg atccaggaga gactac 26
<210>6
<211> 21
<212> DNA
<213> Artificial sequence
<223> siRNA1
<400> 6
ccttacaaac accaggtaat t 21
<210>7
<211> 21
<212> DNA
<213> Artificial sequence
<223> siRNA2
<400> 7
gcaagatcct gctcaacatt t 21
<210>8
<211> 21
<212> DNA
<213> Artificial sequence
<223> siRNA3
<400> 8
gaggtggcga tgaagagagt t 21
<210>9
<211> 21
<212> DNA
<213> Artificial sequence
<223> negative control
<400> 9
ttctccgaac gtgtcacgtt t 21
Claims (2)
1. A method for preventing and treating potato dry rot and fusarium wilt by combining fusarium oxysporum RNAi vector and salicylic acid is characterized in that: fusarium oxysporumTORTransferring the gene RNAi vector into a potato to obtain a transgenic potato, and treating the transgenic potato by salicylic acid to prevent and control the dry rot and the wilt of the potato; the Fusarium oxysporumTORThe gene RNAi vector is characterized in that a plant expression vector pEarleyGate 303 is used as a skeleton vector, and a Seq ID No: 3, and (b) is the sequence shown in the specification.
2. The method of claim 1, wherein: and spraying salicylic acid solution to prevent dry rot and blight of the transgenic potatoes in the plant growth process.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910831986.XA CN110468151B (en) | 2019-09-04 | 2019-09-04 | Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910831986.XA CN110468151B (en) | 2019-09-04 | 2019-09-04 | Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110468151A CN110468151A (en) | 2019-11-19 |
| CN110468151B true CN110468151B (en) | 2021-03-02 |
Family
ID=68514788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910831986.XA Active CN110468151B (en) | 2019-09-04 | 2019-09-04 | Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110468151B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111436337B (en) * | 2020-03-04 | 2021-10-22 | 沈阳农业大学 | Application of rapamycin target protein activator MHY1485 in promotion of tomato seed germination and seedling growth and development |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274122A (en) * | 2015-11-04 | 2016-01-27 | 重庆大学 | RNAi (ribonucleic acid interference) expression vector for TOR (target of rapamycin) genes of plutella xylostella, method for constructing RNAi expression vector and application thereof |
| CN108676750A (en) * | 2018-05-29 | 2018-10-19 | 重庆大学 | A kind of streptomyces hygroscopicus producing salicylic acid and rapamycin and its application in prevention plant Oomycete and fungal disease |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010071973A1 (en) * | 2008-12-24 | 2010-07-01 | National Research Council Of Canada | Modification of plant phenotypes through tor gene expression |
| CN105274101B (en) * | 2015-11-04 | 2018-06-05 | 重庆大学 | The RNAi expression vector and its construction method of colorado potato bug TOR genes and application |
| CN105594715B (en) * | 2016-03-24 | 2017-12-26 | 重庆大学 | TOR protein inhibitors suppress the new application of plant of Solanaceae late disease bacteria |
| CN105794803B (en) * | 2016-05-06 | 2018-06-05 | 重庆大学 | TOR protein inhibitors inhibit plant wilt, the new application of verticillium wilt pathogen |
| CN105918330B (en) * | 2016-05-24 | 2018-06-05 | 重庆大学 | Rapamycin inhibits the new application of plant early epidemic germ |
-
2019
- 2019-09-04 CN CN201910831986.XA patent/CN110468151B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274122A (en) * | 2015-11-04 | 2016-01-27 | 重庆大学 | RNAi (ribonucleic acid interference) expression vector for TOR (target of rapamycin) genes of plutella xylostella, method for constructing RNAi expression vector and application thereof |
| CN108676750A (en) * | 2018-05-29 | 2018-10-19 | 重庆大学 | A kind of streptomyces hygroscopicus producing salicylic acid and rapamycin and its application in prevention plant Oomycete and fungal disease |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110468151A (en) | 2019-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mullins et al. | Agrobacterium-mediated transformation of Fusarium oxysporum: an efficient tool for insertional mutagenesis and gene transfer | |
| CN107709563B (en) | Control of fungal pathogens by disabling the small RNA pathway of fungal pathogens using RNAi-based strategies | |
| CN106573963B (en) | Phytophthora resistant plants belonging to the solanaceae family | |
| JP2001518786A (en) | Agrobacterium-mediated transformation of filamentous fungi, especially those belonging to the genus Aspergillus | |
| AU2019313162B2 (en) | RNA molecules comprising non-canonical base pairs | |
| US20210189410A1 (en) | Targeted editing of citrus genes for disease resistance | |
| EP3243830A1 (en) | Protein associated with disease resistance and encoding gene thereof, and use thereof in regulation of plant disease resistance | |
| US11085051B2 (en) | Controlling fungal pathogens by disabling their small RNA pathways using RNAi-based strategy | |
| CN110468151B (en) | Fusarium oxysporum TOR gene RNAi vector and method for preventing and treating potato dry rot and blight by combining fusarium oxysporum TOR gene RNAi vector with salicylic acid | |
| CN101056981A (en) | Method for down-regulating gene expression in fungi | |
| US20180216131A1 (en) | Artificially synthesized insect-resistant protein, biological materials associated therewith, and use thereof | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN105349441B (en) | High sporogenic Trichoderma T23-Ovel1 bacterial strain and its construction method | |
| CN107299103A (en) | Thick boisiana IpASR genes and its encoding proteins and application | |
| CN114107327B (en) | Trichoderma viride high-temperature stress response key enzyme gene TvHSP70, recombinant expression vector, engineering bacteria and application thereof | |
| CN103361325B (en) | A kind of albumen relevant to paddy rice bacterial leaf spot resistance and encoding gene thereof and application | |
| Kano et al. | Agrobacterium tumefaciens-mediated transformation of the plant pathogenic fungus Rosellinia necatrix | |
| Vershinina et al. | Associative Symbiosis between Rhizobia and Transgenic Tomatoes Increases Plant Resistance to Fuzarium oxysporum f. sp. lycopersici | |
| CN105112423A (en) | Clone of miRNA for enhancing disease resistance of mulberry and application thereof | |
| AU2020325060A1 (en) | RNA molecules for modulating flowering in plants | |
| CN105255918A (en) | Verticillium dahliae phospholipase target gene fragment and interference vector and application thereof | |
| Grosser et al. | Progress towards the development of transgenic disease resistance in citrus | |
| CN116926088B (en) | Verticillium dahliae VdNRPS6 gene antipathogenic target gene fragment, interference vector and application thereof | |
| WO2022213453A1 (en) | Use of aluminum ion receptor alr1 gene or protein for regulating aluminum resistance of plant | |
| CN116426567B (en) | Application of N gene and protein thereof in resisting tomato yellow leaf curl virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |