CN110468127B - CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof - Google Patents
CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof Download PDFInfo
- Publication number
- CN110468127B CN110468127B CN201910858885.1A CN201910858885A CN110468127B CN 110468127 B CN110468127 B CN 110468127B CN 201910858885 A CN201910858885 A CN 201910858885A CN 110468127 B CN110468127 B CN 110468127B
- Authority
- CN
- China
- Prior art keywords
- pulp
- honey
- pomelos
- pomelo
- white
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of citrus molecular breeding, and discloses a CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof; the method is suitable for identifying different bud mutation varieties of MiYou Mixi pomelo, including red-pulp Honey pomelo, white-pulp Honey pomelo and yellow-pulp Honey pomelo, and the application thereof, the method designs a set of specific PCR primers by using the DNA sequence information of the known site, then amplifies a certain DNA fragment on the site by using the primers, then cuts the amplified product by using a specific restriction enzyme, separates the enzyme-cut fragment by gel electrophoresis, and then identifies different materials by analyzing the electrophoresis result; develops the molecular marker of enzyme-Cutting Amplification Polymorphic Sequence (CAPS), and the molecular marker can be used for identifying the early variety of the MiYou xi GUAN seedling and has accurate and reliable result.
Description
Technical Field
The invention relates to the technical field of citrus molecular breeding, in particular to a CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof.
Background
You xi Mi GUAN is a fruit of Citrus of Rutaceae, native to peace and county of Fujian province, and is a famous product for culturing pomelos. YoYou xi Mi GUAN is big, without stone, excellent in quality, strong in adaptability, high in yield and good in marketability. You xi Mi GUAN is characterized by thin skin, juicy, sweet, mellow and sweet and moderate sour and sweet. The red-pulp honey pomelo and the yellow-pulp honey pomelo are from bud change of the MiYou honey pomelo, the pulp of mature fruit is red and orange yellow, and the change of the color of the pulp ensures that the red-pulp honey pomelo and the yellow-pulp honey pomelo have good health care efficacy, can attract consumers and bring higher economic value.
The seedling price of bud varieties such as red pulp honey pomelo is 1.5-2 times of that of common white pulp honey pomelo, but the bud varieties are difficult to distinguish morphologically in the seedling stage, and particularly, in the current process of selling the seedlings of the MiYoxi honey pomelo, some bad salers are intentionally confused to obtain higher profits, thereby bringing risks to the MiYoxi honey pomelo industry and fruit growers. If the early selection can be achieved by using DNA molecular markers during the seedling stage, it is helpful for the healthy development of the MiYou Mi shaddock industry. The construction of the genetic map of the whole genome of the pomelo is completed in the early stage of our laboratory, and the genome variation information of the red-pulp honey pomelo, the white-pulp honey pomelo and the yellow-pulp honey pomelo is obtained, so that a foundation is provided for developing molecular markers.
The traditional identification method is easily interfered by factors such as development period, environmental conditions and the like, the number of morphological markers in seedling cultivation is small, the morphological markers are easily interfered by environmental factors, and different varieties are difficult to distinguish in the childhood. The molecular marker assisted breeding can be carried out in any growth period, is not influenced by the development period and environmental conditions, and has the advantages of high speed, economy, efficiency, high accuracy and the like.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a molecular marker suitable for identifying red-red pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof, the invention designs a set of specific PCR primers by utilizing DNA sequence resources of known sites, then uses the primers to amplify a certain DNA segment on the site, then uses a specific restriction enzyme to cut the obtained amplification product, separates enzyme segments by gel electrophoresis, and identifies different materials by analyzing electrophoresis results; a restriction amplification polymorphism sequence (CAPS) molecular marker is developed, and the molecular marker can be used for identifying the early variety of the MiYou xi GUAN seedling and has accurate and reliable results.
In order to achieve the purpose, the invention designs two specific primer pairs, wherein the specific primer pair consists of a primer pair RW F/R and a primer pair YW F/R, and the RW F/R and the YW F/R are as follows:
forward primer RW-F: 5'-CGCACTAATCTTTTCTCCCAACT-3' the flow of the air in the air conditioner,
reverse primer RW-R: 5'-AATACTACTCTCATTCTCCCCAA-3' are provided.
Forward primer YW-F: 5'-CTGCTTAGGGATTTGC-3' the flow of the air in the air conditioner,
reverse primer YW-R: 5'-TGTTCTGGTGGACTGG-3' are provided.
The specific primer pair is applied to identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos.
The invention also provides a kit for identifying red-fleshed honey pomelos, white-fleshed honey pomelos and yellow-fleshed honey pomelos, and the kit contains the specific primer pair.
The method for identifying the red-pulp honey pomelos, the white-pulp honey pomelos and the yellow-pulp honey pomelos comprises the following steps:
1) taking genome DNA of honey pomelos to be detected as a template; respectively amplifying RW F/R by using the primers of claim 1 to obtain amplification products;
2) carrying out enzyme digestion on the amplified product by BstNS I enzyme;
3) electrophoresis, wherein if the enzyme digestion product has two fragments of 414bp and 88bp, the honey pomelo to be detected is red pulp honey pomelo;
or, if the enzyme digestion product has three fragments of 414bp, 88bp and 502bp, the honey pomelo to be detected is white-fleshed honey pomelo or yellow-fleshed honey pomelo (the SNP site of the red-fleshed honey pomelo is a homozygous site, the SNP site of the white-fleshed honey pomelo and the yellow-fleshed honey pomelo is a heterozygous site, when the enzyme digestion is carried out by using restriction enzyme, the red-fleshed honey pomelo is cut into 2 strips, and the white-fleshed honey pomelo and the yellow-fleshed honey pomelo are cut into 3 strips as shown in figure 1);
4) then, taking the genome DNA of the honey pomelo to be detected as a template, and respectively amplifying YW F/R by adopting the primers to obtain amplification products;
5) carrying out enzyme digestion on the amplified product by Bst4C I enzyme;
6) electrophoresis, wherein if the enzyme digestion product has two fragments of 505bp, 390bp and 115bp, the honey pomelo to be detected is yellow-fleshed honey pomelo;
or, if the enzyme-digested product has two fragments of 390bp and 115bp, the honey pomelo to be detected is white honey pomelo (the SNP site of the yellow honey pomelo is a heterozygous site, the white honey pomelo is a homozygous site, when the enzyme-digested product is digested by using restriction enzymes, the yellow honey pomelo is cut into 3 bands, and the white honey pomelo is cut into 2 bands as shown in fig. 2).
The invention has the beneficial effects that:
the invention successfully obtains CAPS marks for identifying red-pulp honey pomelo, white-pulp honey pomelo and yellow-pulp honey pomelo, and the marks are used for identifying the nursery stock of different pulp color varieties of the MiYou-xi honey pomelo, thereby reducing the breeding workload and ensuring the purity of the nursery stock variety.
Drawings
FIG. 1 is a schematic diagram showing the cleavage of RW tag;
FIG. 2 is a schematic diagram of enzyme digestion with YW label;
FIG. 3 is the amplified map of the primer RW F/R after enzyme digestion of the amplified products of the citrus genome DNA of red-fleshed honey pomelo, white-fleshed honey pomelo and yellow-fleshed honey pomelo;
in the figure, 1-3 are red pulp honey pomelos, 4-6 are white pulp honey pomelos, and 7-9 are yellow pulp honey pomelos;
FIG. 4 is the amplified pattern of the enzyme-digested amplified products of YW F/R in the genomic DNA of yellow-fleshed honey pomelo and white-fleshed honey pomelo. 1-3 is yellow-fleshed honey pomelo; 4-6 is white pulp honey pomelo.
Detailed Description
The present invention is described in further detail below with reference to specific examples so as to be understood by those skilled in the art.
Example 1 CAPS marker establishment and primer-specific primer screening
The DNA-seq is used to detect the differential SNP locus in red-meat-vs-white-meat honey pomelo:
the DNA of the leaves of red and white honey pomelo were extracted separately and sequenced on the Illumina platform (sequencing depth 30X). Sequencing data of red-fleshed honey pomelos and white-fleshed honey pomelos, respectively, were aligned to the pomelo reference genome using BWA software, and SAMtools software was genotyped to determine the SNP sites such as SED ID nos. 1 and 2 of the differences between red-fleshed honey pomelos and white-fleshed honey pomelos for development of differential markers for red-fleshed honey pomelos and white-fleshed honey pomelos. Wherein the content of the first and second substances,
SED ID No.1：
CGCACTAATCTTTTCTCCCAACTTTTAAATTGCCTCCTTGTTCATGCACATTATGGGTATCTTATGAATCTACCCAAAATGTTGCATGTGTAAAGGATTGATTTTTAATATCTCCAATCCCAGTTGGTTGAGTCAAAACTATCAGTGCTATGTCAAAATGCAATGGTCCTCCCATAAGCACCCTTTTCTTTTCTTCTCCCTATGAATGTTACAATGTCTGCCTCTTCTTCTTTTAAAATGATTGCTTGACACTTGCGAATTAATTCCTCAATATCCATAGTTTACTGCGAATTAATTCCTCAGTATCCATAGTTTACAGTGTTTCCAGTAATAAATTGTCTCACCAACCTACTAGGATCCATAAATAAATGCAATAAGTAGGAATTATCTGCCCAAATTTCATCGAGAAACTGTAACGAAAATTGTAAGGAAGCACCCAACTAAACTTTGCTTCACGAAACTAAAGTGGCCACTTGTATTTGGGGAGAATGAGAGTAGTATT
SED ID No.2：
CGCACTAATCTTTTCTCCCAACTTTTAAATTGCCTCCTTGTTCATGCACATTATGGGTATCTTATGAATCTACCCAAAATGTTGY(C/T)ATGTGTAAAGGATTGATTTTTAATATCTCCAATCCCAGTTGGT/TGAGTCAAAACTATCAGTGCTATGTCAAAATGCAATGGTCCTCCCATAAGCACCCTTTTCTTTTCTTCTCCCTATGAATGTTACAATGTCTGCCTCTTCTTCTTTTAAAATGATTGCTTGACACTTGCGAATTAATTCCTCAATATCCATAGTTTACTGCGAATTAATTCCTCAGTATCCATAGTTTACAGTGTTTCCAGTAATAAATTGTCTCACCAACCTACTAGGATCCATAAATAAATGCAATAAGTAGGAATTATCTGCCCAAATTTCATCGAGAAACTGTAACGAAAATTGTAAGGAAGCACCCAACTAAACTTTGCTTCACGAAACTAAAGTGGCCACTTGTATTTGGGGAGAATGAGAGTAGTATT
detection of differential SNP sites in yellow-vs-white-fleshed honey pomelos using DNA-seq:
DNA was extracted from the leaves of yellow and white honey pomelos, respectively, and DNA sequencing was performed on an Illumina platform (sequencing depth 30X). Sequencing data of the yellow-fleshed honey pomelo and the white-fleshed honey pomelo are respectively aligned to a pomelo reference genome by using BWA software, and the SAMtools software carries out genotyping to determine SNP loci (such as SED ID No.3 and 4) of differences between the yellow-fleshed honey pomelo and the white-fleshed honey pomelo for developing identification markers of the yellow-fleshed honey pomelo and the white-fleshed honey pomelo; wherein, the first and the second end of the pipe are connected with each other,
SED ID No.3：
CTGCTTAGGGATTTGCAGAATAGAAGAGATGTATAATTCTTTATCTTGAAATTTGTGCATCAATGTGAAGTTGGATAACATGAGTAACCTATTTATATGTTGATTGTTCATGCAGTTTCATTCAACTAGATTTGGGCCATCTACGGGTGACAAATGAAATAAATTGGCATGGGGACCCTGAGAAGGATCCTTCAGCTGTCCATATTGATGTTCTTCATGCCGAGGTAGAGGAGTTTATGATGTTCTGGCTTCATGTTAATTAGTGAATTGTTGTTCACTCAAGGGCATACTTGCAGATTATGGGGATCAACATGTCTGTAGGAATTGATGGTTGTCTGGGTAAGCCAATGATACGGGAAGAGCAAGGACTTGATGTTTATGTCCGCCACGR(G/A)TTTGAGGGATGTTTTCAGGAAAGTTCCAACATTTTCTCTTGAAGTTAAGGTAATCTATGTAATTTGAATTTCTTGTAATTGTTTATTCCCCCACTCTCCCAGTCCACCAGAACA
SED ID No.4：
CTGCTTAGGGATTTGCAGAATAGAAGAGATGTATAATTCTTTATCTTGAAATTTGTGCATCAATGTGAAGTTGGATAACATGAGTAACCTATTTATATGTTGATTGTTCATGCAGTTTCATTCAACTAGATTTGGGCCATCTACGGGTGACAAATGAAATAAATTGGCATGGGGACCCTGAGAAGGATCCTTCAGCTGTCCATATTGATGTTCTTCATGCCGAGGTAGAGGAGTTTATGATGTTCTGGCTTCATGTTAATTAGTGAATTGTTGTTCACTCAAGGGCATACTTGCAGATTATGGGGATCAACATGTCTGTAGGAATTGATGGTTGTCTGGGTAAGCCAATGATACGGGAAGAGCAAGGACTTGATGTTTATGTCCGCCACGGTTTGAGGGATGTTTTCAGGAAAGTTCCAACATTTTCTCTTGAAGTTAAGGTAATCTATGTAATTTGAATTTCTTGTAATTGTTTATTCCCCCACTCTCCCAGTCCACCAGAACA
designing a specific primer according to the sequence of the SNP locus:
the specific primer pair consists of a primer pair RW F/R and a primer pair YW F/R, wherein the RW F/R and the YW F/R are as follows:
forward primer RW-F: 5'-CGCACTAATCTTTTCTCCCAACT-3' the flow of the air in the air conditioner,
reverse primer RW-R: 5'-AATACTACTCTCATTCTCCCCAA-3' are provided.
Forward primer YW-F: 5'-CTGCTTAGGGATTTGC-3' the flow of the air in the air conditioner,
reverse primer YW-R: 5'-TGTTCTGGTGGACTGG-3' are provided.
Example 2
The kit for identifying red-fleshed honey pomelos, white-fleshed honey pomelos and yellow-fleshed honey pomelos comprises the specific primer pair, wherein the specific primer pair consists of a primer pair RW F/R and a primer pair YW F/R, and the RW F/R and the YW F/R are as follows:
forward primer RW-F: 5'-CGCACTAATCTTTTCTCCCAACT-3' the flow of the air in the air conditioner,
reverse primer RW-R: 5'-AATACTACTCTCATTCTCCCCAA-3' are provided.
Forward primer YW-F: 5'-CTGCTTAGGGATTTGC-3' the flow of the air in the air conditioner,
reverse primer YW-R: 5'-TGTTCTGGTGGACTGG-3' are provided.
The method for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos by using the kit comprises the following steps: the method comprises the following steps:
1) extracting genome DNA of red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos by adopting an improved CTAB method;
2) the primer pair RW F/R in the kit is used for amplification analysis of the red-pulp honey pomelo, white-pulp honey pomelo and yellow-pulp honey pomelo genome DNA:
the PCR reaction system is as follows: 25 μ L of 2 XPhanta Max Buffer, 1 μ L of DNTP Mix (10mM), 1 μ L of Phanta Max Super-Fidelity DNA Polymerase (both from Vazyme), 100ng of DNA, 2 μ L each of forward and reverse primers, ddH2O to a final volume of 50 μ L;
the thermal cycle parameters were: 5min at 95 ℃; 30sec at 94 ℃, 30sec at 55 ℃, 35sec at 72 ℃ for 35 cycles; 5min at 72 ℃ for 1 cycle; storing at 4 ℃, and completing the reaction on an S1000Thermal Cycler PCR instrument;
3) the PCR product obtained above was digested with the restriction enzyme BstNS I
The enzyme digestion reaction system is as follows: 10 μ L of PCR amplification product, 0.5 μ L of LBstNS I enzyme, Vazyme Co., Ltd.), 2 μ L of Buffer, 0.2 μ L of LBSA, ddH2O was replenished to a final volume of 20. mu.L. The enzyme digestion reaction parameters are as follows: 1h at 37 ℃;
4) detecting the enzyme digestion product by 2.0% agarose gel electrophoresis on a horizontal electrophoresis tank, using 1 XTAE buffer solution (0.04M Tris-acetate, 0.001M EDTA, pH8.0), voltage 6V/cm, electrophoresis for 20min, and taking a picture by a gel imaging system (UVP) for storage after electrophoresis is finished;
5) electrophoresis, wherein if the enzyme digestion product has two fragments of 414bp and 88bp, the honey pomelo to be detected is red pulp honey pomelo;
or if the enzyme digestion product has three fragments of 414bp, 88bp and 502bp, the honey pomelo to be detected is white-pulp honey pomelo or yellow-pulp honey pomelo;
6) and (3) analyzing the genomic DNA of the white-pulp honey pomelos and the yellow-pulp honey pomelos by utilizing the primer pair YW F/R in the kit through amplification:
the PCR reaction system is as follows:
25 μ L of 2 XPPhanta Max Buffer, 1 μ L of DNTP Mix (10mM), 1 μ L of Phanta Max Super-Fidelity DNA Polymerase (all available from Vazyme), 100ng of DNA, 2 μ L each of forward and reverse primers, ddH2O to a final volume of 50 μ L;
the thermal cycle parameters were: 5min at 95 ℃; 30sec at 94 ℃, 30sec at 55 ℃, 35sec at 72 ℃ for 35 cycles; 5min at 72 ℃ for 1 cycle; storing at 4 ℃, and completing the reaction on an S1000Thermal Cycler PCR instrument;
7) carrying out enzyme digestion on the obtained PCR product by using restriction enzyme Bst4C I;
the enzyme digestion reaction system is as follows: 10 μ L of PCR amplification product, 1 μ L of LBst4C I enzyme, Vazyme Co., Ltd.), 2 μ L of Buffer, ddH2O was replenished to a final volume of 20. mu.L. The enzyme digestion reaction parameters are as follows: 1h at 65 ℃;
8) detecting the enzyme digestion product by 2.0% agarose gel electrophoresis on a horizontal electrophoresis tank, using 1 XTAE buffer solution (0.04M Tris-acetate, 0.001M EDTA, pH8.0), voltage 6V/cm, electrophoresis for 30min, after the electrophoresis is finished, photographing by a gel imaging system (UVP) for storage;
9) respectively amplifying YW F/R by using the genome DNA of the honey pomelo to be detected as a template and adopting the primer in claim 1 to obtain amplification products;
10) carrying out enzyme digestion on the amplified product by Bst4C I enzyme;
11) electrophoresis, wherein if the enzyme digestion product has two fragments of 505bp, 390bp and 115bp, the honey pomelo to be detected is yellow-fleshed honey pomelo;
or if the enzyme digestion product has two fragments of 390bp and 115bp, the honey pomelo to be detected is white-pulp honey pomelo.
Example 3
The kit is used for detecting 9 samples, and the results are shown in figures 3-4: 3 parts of white-pulp honey pomelos, 3 parts of yellow-pulp honey pomelos and 3 parts of red-pulp honey pomelos.
Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> CAPS molecular marker applicable to identifying red-fleshed honey pomelos, white-fleshed honey pomelos and yellow-fleshed honey pomelos and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 502
<212> DNA
<213> Red-fleshed honey pomelo (Citrus grandis 'Hongrou miyou')
<400> 1
cgcactaatc ttttctccca acttttaaat tgcctccttg ttcatgcaca ttatgggtat 60
cttatgaatc tacccaaaat gttgcatgtg taaaggattg atttttaata tctccaatcc 120
cagttggttg agtcaaaact atcagtgcta tgtcaaaatg caatggtcct cccataagca 180
cccttttctt ttcttctccc tatgaatgtt acaatgtctg cctcttcttc ttttaaaatg 240
attgcttgac acttgcgaat taattcctca atatccatag tttactgcga attaattcct 300
cagtatccat agtttacagt gtttccagta ataaattgtc tcaccaacct actaggatcc 360
ataaataaat gcaataagta ggaattatct gcccaaattt catcgagaaa ctgtaacgaa 420
aattgtaagg aagcacccaa ctaaactttg cttcacgaaa ctaaagtggc cacttgtatt 480
tggggagaat gagagtagta tt 502
<210> 3
<211> 502
<212> DNA
<213> white-fleshed honey pomelo (Citrus grandis 'Bairou miyou')
<400> 3
cgcactaatc ttttctccca acttttaaat tgcctccttg ttcatgcaca ttatgggtat 60
cttatgaatc tacccaaaat gttgyatgtg taaaggattg atttttaata tctccaatcc 120
cagttggttg agtcaaaact atcagtgcta tgtcaaaatg caatggtcct cccataagca 180
cccttttctt ttcttctccc tatgaatgtt acaatgtctg cctcttcttc ttttaaaatg 240
attgcttgac acttgcgaat taattcctca atatccatag tttactgcga attaattcct 300
cagtatccat agtttacagt gtttccagta ataaattgtc tcaccaacct actaggatcc 360
ataaataaat gcaataagta ggaattatct gcccaaattt catcgagaaa ctgtaacgaa 420
aattgtaagg aagcacccaa ctaaactttg cttcacgaaa ctaaagtggc cacttgtatt 480
tggggagaat gagagtagta tt 502
<210> 3
<211> 505
<212> DNA
<213> yellow-fleshed honey pomelo (Citrus grandis 'Huanggrou miyou')
<400> 3
ctgcttaggg atttgcagaa tagaagagat gtataattct ttatcttgaa atttgtgcat 60
caatgtgaag ttggataaca tgagtaacct atttatatgt tgattgttca tgcagtttca 120
ttcaactaga tttgggccat ctacgggtga caaatgaaat aaattggcat ggggaccctg 180
agaaggatcc ttcagctgtc catattgatg ttcttcatgc cgaggtagag gagtttatga 240
tgttctggct tcatgttaat tagtgaattg ttgttcactc aagggcatac ttgcagatta 300
tggggatcaa catgtctgta ggaattgatg gttgtctggg taagccaatg atacgggaag 360
agcaaggact tgatgtttat gtccgccacg rtttgaggga tgttttcagg aaagttccaa 420
cattttctct tgaagttaag gtaatctatg taatttgaat ttcttgtaat tgtttattcc 480
cccactctcc cagtccacca gaaca 505
<210> 4
<211> 505
<212> DNA
<213> white-fleshed honey pomelo (Citrus grandis 'Bairou miyou')
<400> 4
ctgcttaggg atttgcagaa tagaagagat gtataattct ttatcttgaa atttgtgcat 60
caatgtgaag ttggataaca tgagtaacct atttatatgt tgattgttca tgcagtttca 120
ttcaactaga tttgggccat ctacgggtga caaatgaaat aaattggcat ggggaccctg 180
agaaggatcc ttcagctgtc catattgatg ttcttcatgc cgaggtagag gagtttatga 240
tgttctggct tcatgttaat tagtgaattg ttgttcactc aagggcatac ttgcagatta 300
tggggatcaa catgtctgta ggaattgatg gttgtctggg taagccaatg atacgggaag 360
agcaaggact tgatgtttat gtccgccacg gtttgaggga tgttttcagg aaagttccaa 420
cattttctct tgaagttaag gtaatctatg taatttgaat ttcttgtaat tgtttattcc 480
cccactctcc cagtccacca gaaca 505
Claims (3)
1. The application of the specific primer pair in identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos is characterized in that: the specific primer pair consists of a primer pair RW F/R and a primer pair YW F/R, wherein the RW F/R and the YW F/R are as follows:
forward primer RW-F: 5'-CGCACTAATCTTTTCTCCCAACT-3' the flow of the air in the air conditioner,
reverse primer RW-R: 5'-AATACTACTCTCATTCTCCCCAA-3', respectively;
forward primer YW-F: 5'-CTGCTTAGGGATTTGC-3' the flow of the air in the air conditioner,
reverse primer YW-R: 5'-TGTTCTGGTGGACTGG-3' are provided.
2. The application of the kit in identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos is characterized in that: the kit contains the specific primer pair in claim 1.
3. A method for identifying red-fleshed honey pomelos, white-fleshed honey pomelos and yellow-fleshed honey pomelos is characterized by comprising the following steps: the method comprises the following steps:
1) taking the genome DNA of the honey pomelo to be detected as a template; respectively amplifying RW F/R by using the primers in claim 1 to obtain amplification products;
2) by usingBstPerforming enzyme digestion on the amplified product by NS I enzyme;
3) electrophoresis is carried out, if the enzyme digestion product has two fragments of 414bp and 88bp, the honey pomelo to be detected is red-pulp honey pomelo;
or if the enzyme digestion product has three fragments of 414bp, 88bp and 502bp, the honey pomelo to be detected is white-pulp honey pomelo or yellow-pulp honey pomelo;
4) respectively amplifying YW F/R by using the genome DNA of the honey pomelo to be detected as a template and adopting the primer in claim 1 to obtain amplification products;
5) by usingBst4C I enzyme cuts the amplified product;
6) electrophoresis, wherein if the enzyme digestion product has two fragments of 505bp, 390bp and 115bp, the honey pomelo to be detected is yellow-fleshed honey pomelo;
or if the enzyme digestion product has two fragments of 390bp and 115bp, the honey pomelo to be detected is white-pulp honey pomelo.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910858885.1A CN110468127B (en) | 2019-09-11 | 2019-09-11 | CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910858885.1A CN110468127B (en) | 2019-09-11 | 2019-09-11 | CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110468127A CN110468127A (en) | 2019-11-19 |
| CN110468127B true CN110468127B (en) | 2022-06-21 |
Family
ID=68515637
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910858885.1A Active CN110468127B (en) | 2019-09-11 | 2019-09-11 | CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110468127B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114438249B (en) * | 2022-02-22 | 2022-10-21 | 江西省农业科学院园艺研究所 | Primer group, kit and identification method for identifying cultivation types of valium odoratum honey pomelos |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103792219A (en) * | 2014-02-27 | 2014-05-14 | 厦门大学 | Red pulp honey pomelo spectrum identification method |
-
2019
- 2019-09-11 CN CN201910858885.1A patent/CN110468127B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103792219A (en) * | 2014-02-27 | 2014-05-14 | 厦门大学 | Red pulp honey pomelo spectrum identification method |
Non-Patent Citations (6)
| Title |
|---|
| CAPS 标记技术及其应用进展;邢延豪 等;《江苏农业科学》;20111015;74-76 * |
| Identification and Parentage Analysis of Citrus Cultivars Developed in Japan by CAPS Markers;Keisuke Nonaka 等;《The Horticulture Journal》;20161004;208-221 * |
| Isolation and characterization of carotenoid cleavage dioxygenase 4 genes from different citrus species;Xiongjie Zheng 等;《Mol Genet Genomics》;20150331;1589-1603 * |
| 基于SSR标记的浙江地方柚类种质资源遗传关系分析;刘冬峰 等;《果树学报》;20171231;166-174 * |
| 柑橘 CAPS 标记和 AS-PCR 引物的开发;雷天刚 等;《园艺学报》;20120625;1027-1034 * |
| 红肉蜜柚果实品质评价及遗传鉴定;朱东煌;《东南园艺》;20151215;1-5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110468127A (en) | 2019-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660246B (en) | InDel molecular markers of Ma (Citrus paradisi) pomelos and application of InDel molecular markers in early-stage differentiation of rough-peel Ma pomelos of citrus varieties | |
| CN110438252B (en) | Molecular marker closely linked with male and female sex of spinach and application thereof | |
| CN110468127B (en) | CAPS molecular marker suitable for identifying red-pulp honey pomelos, white-pulp honey pomelos and yellow-pulp honey pomelos and application thereof | |
| CN113621734B (en) | Molecular marker primer combination for rapidly identifying super-large fruit type characters of waxberries and application thereof | |
| CN106498048A (en) | A kind of QTL related to soybean nodulation number, SNP marker and application | |
| CN111621586B (en) | SNP molecular marker closely linked with pumpkin yellow stem character and application thereof | |
| CN110273020B (en) | SNP molecular marker for distinguishing summer orange and common sweet orange of citrus and application thereof | |
| CN116622876B (en) | Haplotype molecular marker related to vitamin C content of papaya pulp and application thereof | |
| CN109880932B (en) | SSR primer pair for identifying cotton 1279 in hybrid cotton variety, product thereof and identification method | |
| CN108165652B (en) | Specific molecular marker TGMI001 for identifying sex of torreya grandis at seedling stage | |
| Tsuruta et al. | Marker-assisted selection for pollen-free somatic plants of Sugi (Japanese cedar, Cryptomeria japonica): a simple and effective methodology for selecting male-sterile mutants with ms1-1 and ms1-2 | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN115679012A (en) | Hot pepper whole genome SNP-Panel and application thereof | |
| CN111876477B (en) | Molecular marker primer combination for identifying sex characters of holly plants and application thereof | |
| CN109652582B (en) | SNP molecular marker for identifying Huyunuo No.3 waxy corn and application thereof | |
| CN115838790B (en) | Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4 | |
| CN116334269B (en) | Molecular marker for sex identification of actinidia arguta and specific primer pair M3 thereof | |
| US20240229165A1 (en) | Single-nucleotide polymorphism locus significantly related to yardlong bean anthocyanin content, kompetitive allele-specific polymerase chain reaction markers and application thereof | |
| CN116411127B (en) | Molecular marker primer combination for rapidly identifying mature-period characters of peach fruits and application thereof | |
| CN115873975B (en) | SNP molecular marker for identifying wheat powdery mildew resistance and application thereof | |
| KR102098310B1 (en) | Composition for identification of Pleurotus ostreatus cultivar and discrimination method using the same | |
| CN106755493B (en) | SNP marker primer combination for identifying leymus chinensis varieties and identification method | |
| CN109487002A (en) | SNP marker, detection method and the application of a kind of muskmelon pericarp fruit face ditch | |
| CN114262744A (en) | Purple leaf rice two-line sterile line and breeding method and application thereof | |
| CN115976257A (en) | KASP molecular marker for identifying zongzi and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |