CN110452980B - Mitochondrial encephalomyopathy diagnosis kit and application - Google Patents

Abstract

The invention discloses a mitochondrial encephalomyopathy diagnosis kit and application thereof. The mitochondrial encephalomyopathy diagnosis kit comprises ECHS1 gene sequence detection reagents. The ECHS1 gene sequence detection reagent is applied to the preparation of mitochondrial encephalomyopathy diagnosis reagent. The invention provides a diagnosis kit for mitochondrial encephalomyopathy and application of an ECHS1 gene sequence detection reagent by defining the association relationship between the ECHS1 gene and the mitochondrial encephalomyopathy, particularly the mitochondrial encephalomyopathy caused by the 3 rare mutation c.414+5G > A of the ECHS1 gene, and provides important genetic basis for diagnosis and diagnosis of mitochondrial encephalomyopathy.

Description

Mitochondrial encephalomyopathy diagnosis kit and application

Technical Field

The invention belongs to the field of medical diagnosis, and particularly relates to a mitochondrial encephalomyopathy diagnosis kit and application thereof.

Background

Mitochondrial damage related diseases, mainly caused by inheritance, mainly include various different types of clinical phenotypes. Most cases have brain abnormalities, but few clinical cases only manifest themselves as brain abnormalities. In addition, it is very difficult to make a definitive diagnosis of diseases associated with mitochondrial damage in patients, particularly infants. Various genetic mutations in nuclear genes that encode mitochondrial proteins, which may lead to mitochondrial dysfunction, are the central cause of diseases associated with mitochondrial damage. Understanding the relationship between the clinical manifestation of the mitochondrial injury related diseases and genetic mutation of genes has important significance for establishing diagnosis and preventing misdiagnosis.

Mitochondrial Encephalomyopathy (ME) is a group of unusual mitochondrial structural and/or functional abnormalities that lead to a multi-system disease that is predominantly brain and muscle affected. The muscle damage is mainly represented by skeletal muscle which is extremely intolerant to fatigue, the nervous system is mainly represented by extraocular muscle paralysis, stroke, recurrent seizures, myoclonus, migraine, ataxia, intelligent disorder, optic neuropathy and the like, and other system manifestations can be heart block, cardiomyopathy, diabetes, renal insufficiency, intestinal pseudo obstruction, short stature and the like. From the current study of the disease, it is mostly considered that the disease is due to the patient carrying harmful genetic genes and mitochondrial dysfunction, and thus causes clinical manifestation diversity. There is no definite related gene of mitochondrial encephalomyopathy, and the mitochondrial encephalomyopathy cannot be diagnosed at present by the detection result of mitochondrial genes.

Disclosure of Invention

In order to address the above-mentioned shortcomings or improvements of the prior art, the present invention provides a mitochondrial brain disease detection kit and its application, which aims atECHS1The exact association relationship between the gene and the mitochondrial encephalomyopathy is adoptedECHS1The gene detection reagent is used for preparing a mitochondrial encephalomyopathy diagnosis reagent, so that the technical problem that an effective diagnosis means is lacking in the existing mitochondrial encephalomyopathy is solved.

To achieve the above object, according to one aspect of the present invention, there is provided a diagnostic kit for mitochondrial encephalomyopathy comprisingECHS1And (3) a gene sequence detection reagent.

Preferably, the mitochondrial encephalomyopathy diagnosis kit comprisesECHS1And (3) a gene sequence detection reagent of the gene intron 3.

Preferably, the mitochondrial encephalomyopathy diagnosis kit comprisesECHS1Introns 3 rarely variant c414+5G>A detection reagent.

Preferably, said mitochondrial encephalomyopathy diagnostic kitECHS1The gene sequence detection reagent comprisesECHS1A gene amplification reagent.

Preferably, said mitochondrial encephalomyopathy diagnostic kitECHS1The gene amplification reagent includes:

forward primer: 5'-AGCTACACCTGGAGCCACTG-3'; a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-CCATGGACACGAATCACAAG-3'.

Preferably, the mitochondrial encephalomyopathy diagnosis kit comprisesECHS1And (3) a gene expression detection reagent.

Preferably, said mitochondrial encephalomyopathy diagnostic kitECHS1The gene expression detection reagent comprisesECHS1Gene RT-PCR primers:

forward primer: 5'-TCTGAGTCACCTGGACAACC-3'; a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-ATCTCAGTGGTATTTGTCAGC-3'.

According to another aspect of the present invention, there is provided a method ofECHS1The application of the gene sequence detection reagent is applied to the preparation of mitochondrial encephalomyopathy diagnosis reagents.

Preferably, the application, which is applied toECHS1Preparation of diagnostic reagent for mitochondrial encephalomyopathy caused by abnormal gene intron 3.

Preferably, the application, which is applied toECHS1The non-coding region of the gene rarely has mutation c.414+5G>Preparation of diagnostic reagent for mitochondrial encephalomyopathy caused by A.

In general, the above technical solutions conceived by the present invention, compared with the prior art, enable the following beneficial effects to be obtained:

the invention is by definitionECHS1Correlation between genes and mitochondrial encephalomyopathy, in particularECHS1Gene intron 3 rarely has mutation c.414+5g>A causes mitochondrial encephalomyopathy, provides a diagnosis kit for mitochondrial encephalomyopathy andECHS1the application of the gene sequence detection reagent provides an important genetic basis for the confirmation of mitochondrial encephalomyopathy.

Drawings

FIG. 1 is an MRI test result of an infant patient according to an embodiment of the present invention;

the results of the skull MRI showed bilateral basal ganglia and midbrain symmetry abnormalities, bilateral frontotemporal subarachnoid space broadening, bilateral frontotemporal occipital cortex, brainstem, basal ganglia abnormalities (A-F).

FIG. 2 shows the MRS detection result of an infant patient according to the embodiment of the present invention;

MRS results showed a Ch/NAA value of 3.47, which was reduced compared to the normal value.

FIG. 3 shows an infant patient according to an embodiment of the present inventionECHSGene sequencing results and c.414+5G>Bioinformatic prediction of the a mutation;

the second generation sequencing result shows that the infant patientECHS1The occurrence of c.414+5G in intron 3 of the Gene>A mutation (A). The results showed c.414+5G using bioinformatics analysis>A mutation may lead toECHS1A39 bp deletion (B) of the gene cDNA occurred.

FIG. 4 is a function of the analysis of c.414+5G > A mutation of example minigene analysis of the present invention;

observation of c.414+5G with minigene>Function of A mutation. The results of the gel electrophoresis experiments showed c.414+5G>A mutations can causeECHS1A39 bp deletion (A) was found in the gene cDNA. B is c.414+5G>The A mutation causesECHS1Pattern of 39bp deletion of gene cDNA. Verification of c.414+5G using Sanger sequencing>The A mutation causesECHS1A39 bp deletion (C) of the gene cDNA occurred.

FIG. 5 shows the bioinformatics prediction of structural changes in ECHS1 protein caused by mutation c.414+5G > A according to the example of the present invention;

the results of bioinformatic predictions show that the c.414+5g > a mutation results in a deletion of 13 core amino acids in the enzymatic active region of the ECHS1 protein.

FIG. 6 is a carrying case of an embodiment of the inventionECHS1Gene c.414+5G>A mutant infant, having altered activity of ECHS1 (2-enoyl coa hydratase) in fibroblasts.

Spectrophotometry is adopted to detect, and c.414+5G in the fibroblast of the infant>Effect of mutation a on ECHS1 enzyme activity. Results show that carry-onECHS1Gene c.414+5G>The enzyme activity of ECHS1 (2-enoyl coenzyme A hydratase) in fibroblasts of the A mutant infant is obviously reduced.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.

ECHS1The gene is located on chromosome 10q26.2-q26.3.ECHS1The gene encodes a mitochondrial short chain acrylyl coa hydratase (short chain enoyl coa hydratase, sceh or echs 1) that localizes to the mitochondrial matrix, catalyzing hydration of enoyl coa in a number of metabolic pathways, including short chain fatty acid β -oxidation and branching. Amino acid catabolism, mitochondrial enzymes catalyze unsaturated fatty acids and participate in the metabolism of branched-chain amino acids such as valine, leucine, isoleucine and the like of eukaryotes.ECHS1Are widely studied in model organisms due to their specific role in mitochondrial oxidation function, but heretoforeECHS1The relationship with infant health and illness is not yet clear. The inventor discovers a new typeECHS1Mutations and provide sufficient experimental evidence that the mutations cause mitochondrial encephalomyopathy.

The invention provides a mitochondrial encephalomyopathy diagnosis kit, which comprises: DNA extraction reagent,ECHS1Gene sequence detection reagent and method for detecting gene sequenceECHS1A gene expression detection reagent;

the DNA extraction reagent is a whole genome DNA extraction and purification reagent, preferably a peripheral blood whole genome DNA extraction reagent containing EDTA.

The saidECHS1Gene sequence detection reagents comprisingECHS1Gene sequence detection reagent for gene intron 3, comprisingECHS1And (3) a gene PCR amplification reagent. The saidECHS1The template adopted by the gene PCR amplification reagent is whole genome DNA extracted from peripheral blood, and the adopted primers are:

forward primer: 5'-AGCTACACCTGGAGCCACTG-3'; a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-CCATGGACACGAATCACAAG-3'.

The saidECHS1Gene expression detection reagent comprisingECHS1Gene expression detection reagent, preferablyECHS1Gene RT-PCR detection reagent usingThe primers of (2) are:

forward primer: 5'-TCTGAGTCACCTGGACAACC-3'; a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-ATCTCAGTGGTATTTGTCAGC-3'.

The invention makes clearECHS1Abnormal gene function, causing mitochondrial encephalomyopathy, thusECHS1The gene sequence detection reagent can be applied to the preparation of mitochondrial encephalomyopathy diagnosis reagents; in particular, the number of the components to be processed,ECHS1the mutation c.414+5G is rarely found in the rare variety of gene non-coding region intron 3>Preparation of diagnostic reagent for mitochondrial encephalomyopathy caused by A.

The following are examples:

one infant is collected and treated by the child hospital in the Wuhan market, and is a male infant, a parent, a pregnant infant, a production period of 40 weeks, a birth weight of 3,500 g and a body length of 51 cm. The infant is the first case in the family, and its brothers have no symptoms. Parents are Chinese, and are not closely related. When the infant is born, hug-like symptoms are found, the infant is frequently ill at night 5-6 times a day.

When the infant is one month old, the infant is hospitalized for neonatal pneumonia, neonatal jaundice and left hydronephrosis. Mental retardation was found at 8 months of age. The head cannot be raised in eight months, the head cannot be singly seated in thirteen months, and one sentence of significance cannot be expressed in two years. After one year of age, spasticity manifests itself particularly.

The infant is examined and the electromyogram and the repeated electroencephalogram are normal. Laboratory examination showed an increase in lactic acid of 11.41 mmol/L (normal range 0.5-2.22 mmol/L) and blood ammonia of 201. Mu. Mol/L (normal range 18-72. Mu. Mol/L). The analysis result of the acyl carnitine in the blood is not abnormal. Urine organic acid analysis showed a significant increase in the excretion of 3-hydroxybutyl carnitine. Urinalysis showed keto3+, bil1+, pro1+. The fecal occult blood test is positive, which indicates that the patient has intestinal mucosa injury. The T3, T4 and TSH levels are within normal ranges. Liver, kidney function, myocardial enzymes, and electrolyte levels were essentially normal. We judged the child to be "mitochondrial encephalomyopathy" and performed three months of cocktail therapy on it. After treatment, the symptoms are significantly improved and the frequency of hug-like attacks is reduced.

Brain magnetic resonance scans show diffuse, long and symmetrical T1 and T2 signal distribution in bilateral forehead occipital cortex, brain stem and basal ganglia. DWI shows a high signal. The ventricles on both sides are slightly larger and the sulcus is slightly wider. No obvious abnormal signal was seen in the posterior fossa cerebellum and no shift was seen in the midline structure (fig. 1). MRS results showed a decrease in NAA, and CH/NAA decreased by 3.47 (FIG. 2).

DNA extraction:

DNA extraction reagent: whole genome DNA was extracted and purified from peripheral blood of an infant patient. In this example, the peripheral blood DNA was extracted using a peripheral blood genome extraction and purification kit manufactured by the company "Axygen Scientific". First, 500. Mu.L of sterilized ultrapure water was added to 200. Mu.L of peripheral blood, and erythrocytes were lysed. The supernatant was then discarded and the pellet was retained as white blood cells by centrifugation at 4 ℃ for 15 minutes. Proteinase K, produced by Roche, was added to lyse the white blood cells. Isopropanol was then added to precipitate genomic DNA, and finally 75% ethanol was added to rinse.

ECHS1Gene amplification:

amplification primers:

forward primer: 5'-AGCTACACCTGGAGCCACTG-3' (SEQ No. 1); a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-CCATGGACACGAATCACAAG-3' (SEQ No. 2).

PCR amplification of ECHS1 gene exon 2, exon 3, exon 4 and intron 2, intron 3 sequences using whole genome DNA as template and direct sequencing analysis of PCR products using ABI PRISM 3500xL gene analyzer (Applied Biosystems, USA).ECHS1The gene has the gene phenotype number 616277 in NCBI OMIM database and the gene sequence number ENSG00000210049 in ENSEMBL.

The above PCR product was digested with XhoI, bamHI restriction enzymes to generate cohesive ends, and then the gene PCR product was cloned into pSPL3 vector and verified whether the DNA fragment was inserted correctly. Wild type vector and insert with c.414+5G>A mutationECHS1The vector of the gene was transferred into African green monkey kidney COS7 cell line for splicing analysis, and after 48 hours transfection, total RNA was extracted and RT-PCR was performed.

ECHS1Gene expression RT-PCR detection:

specific methods of RNA extraction and RT-PCR are described in "Qing Brick Teas (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf 2) anti-current path.2018.103:637-644". The specific method comprises the following steps: total RNA was extracted using Trizol kit (Thermo Fisher Scientific). RNA was synthesized into cDNA using one-step SYBR ™ RT-PCR Kit (Japanese Takara Co.). The cDNA was added as a template (1. Mu.L), SYBR Green Master Mix (Japanese Takara Co.), a specific primer and distilled water to a PCR amplification system in a total volume of 50. Mu.L.

The specific primer:

forward primer: 5'-TCTGAGTCACCTGGACAACC-3' (SEQ No. 3); a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-ATCTCAGTGGTATTTGTCAGC-3' (SEQ No. 4).

The PCR procedure was 95℃for 5 minutes, 95℃for 30 s,60℃for 30 s,72℃for 30 s for a total of 35 cycles. The PCR products were analyzed by agarose gel electrophoresis. To confirm the ECHS1 gene c.414+5G > A mutation, sanger sequencing was performed using standard reagents and conditions.

Analysis of the cleavage site:

variant validator software (Freeman PJ, hart RK, gretton LJ, brookes AJ, dalgleish R. Variant validator: accurate validation, mapping, and formatting of sequence variation descriptions, hum Mutat. 2018; 39:61-68.) was used to determine the chr10:g.13345596_13345635 deletion.

Human Splice Finder software (Desmet FO, hamroun D, laland M, cold-Beroud G, claustres M, beroud C. Human Splicing Finder: an online bioinformatics tool to predict splicing signals Nucleic Acids Res.2009; 37:e 67), splice Port software (Dowan RI, getor L, wilbur WJ, mount SM. splicePort-an interactive Splice-site analysis tool, nucleic Acids Res.2007; 35:W285-W291.) and Fruit Fly Splice Predictor software (The Berkeley Drosophila Genome Project (BDGP) is a consortium of the Drosophila Genome Center funded by the National Human Genome Research Institute and the National Institute of General Medical Sciences through its support of work in the Susan Celniker, J.ben Brown, erwin Frise and Gary Karpen labborides.) were used to predict the effect of gene cleavage sites.

The infant gene was analyzed using Sanger sequences and a non-coding rare mutation, c.414+5G > A, was found in intron 3 of its ECHS1[ MIM# 602292] gene (chr10: g.13345596_13345635 deletion GTCAAGAAGCCAGTCATCGCTGCTG TCAATGGCTATGCC; NM-004092.4). Other regions of the genome are free of abnormalities. Analysis of genomic DNA from a parent indicated that the patient was homozygous and his parent was heterozygous for the variant.

We first performed bioinformatics analysis on the c.414+5g > a mutation using Human Splice Finder software, splice Port software and Fruit Fly Splice Predictor software to predict the function of the mutation. The results show that this mutation is likely to result in a change in the intron splice site, and a deletion of the 39bp sequence occurs. Splice Site Score calculator was used to evaluate the strength of the splice sites, the splice strengths of the wild-type and c.414+5G > A mutants were 14.2 and 7.9, respectively (http:// rulai.cshl. Edu/new_alt_exo_db2/html/score. Html). (FIG. 3)

To demonstrate that the 39bp deletion was caused by the detected c.414+5g > a mutation, we observed gene splice products by PCR amplification of plasmid specific primers and polyacrylamide gel electrophoresis analysis using a minigene assay (minigene analysis). The results show that: the c.414+5g > a mutation had a significant effect on the splice pattern of the ECHS1 gene (fig. 4). Meanwhile, sanger sequencing results also strongly prove that the cDNA fragment obtained from the constructed c.414+5G > A mutant plasmid also has a deletion of 39bp, which is consistent with the detection result in the cDNA of the infant patient.

Analysis of functional variation of c.414+5g > a protein

To examine the effect of the 39bp deletion caused by the c.414+5G > A mutation on protein function, we first performed a silico analysis. The result shows that the deletion of 39bp can possibly result in the deletion of 13 amino acids in the catalytic region of ECHS1 core enzyme. Subsequently, three-dimensional structure prediction was performed on ECHS1 using PyMol software. The results are shown in FIG. 5, where 13 amino acid deletions are located at the active site of the protein. The c.414+5G > A mutation results in a deletion of the amino acid sequence that is highly conserved in the enzymatic active region, which may greatly affect the activity of the ECHS1 protein.

ECHS1Gene function test:

based on the computer prediction, the exact influence of the c.414+5G > A mutation of ECHS1 on the enzyme activity of the ECHS1 is continuously observed, and whether the activity of the 2-enoyl-CoA hydratase of the infant is changed or not is detected.

Primary myoblasts were established from patient skeletal muscle biopsies and cultured in DMEM/F-12 medium (Thermo Fisher Scientifific supplied) supplemented with 20% (V/V) fetal bovine serum (FBS, thermo Fisher Scientifific supplied). The culture conditions were 37℃and 5% CO2.

The activity of 2-enoyl-CoA hydratase, the ECHS1 enzyme, was determined by spectrophotometry for a change in absorbance after reacting a fibroblast lysate with an unsaturated croonyl-CoA substrate for a sufficient time (15 minutes). Specific methods are found in Fong JC, schulz H. Purification and properties of pig heart crotonase and the presence of short chain and long chain enoyl coenzyme A hydratases in pig and guinea pig tisses J Biol Chem 1977;252:542-Luis PB, ruiter JP, ofman R, et al Valproic acid utilizes the isoleucine breakdown pathway for its complete beta-oxidation. Biochem Pharmacol 2011;82:1740-1746.

The results show that: the activity of 2-enoyl-coa hydratase was significantly reduced in the infant fibroblasts compared to the wild-type control, as shown in fig. 6.

It will be readily appreciated by those skilled in the art that the foregoing description is merely a preferred embodiment of the invention and is not intended to limit the invention, but any modifications, equivalents, improvements or alternatives falling within the spirit and principles of the invention are intended to be included within the scope of the invention.

Claims (3)

1. Detection ofECHS1Gene intron 3 c.414+5G>Preparation of reagents for A mutationECHS1Gene intron 3 rarely has mutation c.414+5g>An application of the diagnosis kit for mitochondrial encephalomyopathy caused by A,ECHS1the gene is numbered 602292 in NCBI OMIM database.

2. The mitochondrial encephalomyopathy diagnostic kit of claim 1, wherein theECHS1The gene sequence detection reagent comprisesECHS1A gene amplification reagent; the saidECHS1The gene amplification reagent includes:

forward primer: 5'-AGCTACACCTGGAGCCACTG-3'; a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-CCATGGACACGAATCACAAG-3'.

3. The diagnostic kit for mitochondrial encephalomyopathy according to claim 1, comprisingECHS1A gene expression detection reagent; the saidECHS1The gene expression detection reagent comprisesECHS1Gene RT-PCR primers:

forward primer: 5'-TCTGAGTCACCTGGACAACC-3'; a kind of electronic device with high-pressure air-conditioning system:

reverse primer: 5'-ATCTCAGTGGTATTTGTCAGC-3'.