CN110452929B

CN110452929B - Construction method of non-chimeric gene editing pig embryo model

Info

Publication number: CN110452929B
Application number: CN201910616058.1A
Authority: CN
Inventors: 黄军就; 苏小虎
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2019-07-09
Filing date: 2019-07-09
Publication date: 2021-07-20
Anticipated expiration: 2039-07-09
Also published as: CN110452929A

Abstract

The invention discloses a method for constructing a non-chimeric gene editing pig embryo model. In the method, after the ovum in the live foaming period of the pig passes through a cytoplasm microinjection gene editing system, a target gene can be edited to obtain a mature ovum with gene editing; the cytoplasm microinjection gene editing system is used for obtaining the non-chimeric gene editing embryo by in vitro maturation culture and in vitro insemination of the ovum during the pig live foaming period. The invention has important application value for quickly constructing the non-chimeric maternal gene editing F0 embryo and quickly producing large animal disease models and breeding new varieties.

Description

Construction method of non-chimeric gene editing pig embryo model

Technical Field

The invention belongs to the field of biotechnology. More particularly, relates to a method for constructing a non-chimeric gene editing pig embryo model.

Background

Pigs and humans are genetically, anatomically, physiologically, pathologically, and neurologically similar. This makes pigs a suitable model for the study of human disease or drug development. Genome editing can effectively carry out targeted modification on pigs, so that the method is expected to be used for producing gene mutation pig models.

Traditional production strategies for genetically modified pigs rely on somatic gene modification and Somatic Cell Nuclear Transfer (SCNT). However, the limitations of high technical requirements, low development efficiency, and abnormal primary (fountain, F0) development of SCNTs are the bottlenecks in the widespread use of SCNTs. An emerging gene editing tool, clustered regularly repeated short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) 9(CRISPR/Cas9), can efficiently induce double-strand breaks (DSBs) of DNA at specific sites. When DSBs are repaired by non-homologous end joining (NHEJ), which is highly efficient and imprecise, insertion/deletion (indel) mutations are generated, causing damage to the target gene. The CRISPR/Cas9 is released for the first time in 2012, and simple and efficient gene editing is realized by the cytoplasmic microinjection of mouse, rabbit, pig, monkey and other various fertilized eggs.

However, due to the rapid division of the preimplantation embryo, CRISPR/Cas9 is unevenly distributed among different blastomeres, so that the gene editing F0 individuals are basically chimeras. Chimerism is a common phenomenon in zygote microinjection CRISPR/Cas9 construction gene editing primary animal studies. However, for gene editing in large animals, F0 chimerism is a major obstacle to obtaining non-chimeric offspring due to the high cost and long propagation period. The method is not suitable for constructing a pig disease model with a long breeding cycle.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defects of the existing pig embryo model preparation technology for the research related to human diseases, and provides a method for realizing one-step construction of a non-chimeric gene editing pig embryo model by carrying out gene editing on ova in the pig live foaming period. For example, after gene editing is carried out by an egg cytoplasm microinjection gene editing system in the foaming period, the obtained gene editing mature ovum is inseminated in vitro to obtain the non-chimeric Dmd gene editing pig embryo.

The invention aims to provide a method for constructing a non-chimeric gene editing pig embryo model.

The invention also aims to provide a preparation method of the non-chimeric Dmd gene edited pig embryo model.

Still another object of the present invention is to provide a kit for preparing a non-chimeric Dmd gene-edited porcine embryo.

The above purpose of the invention is realized by the following technical scheme:

a construction method of a non-chimeric gene editing pig embryo model comprises the steps of firstly editing a target gene through an ovum cytoplasm microinjection gene editing system in a pig live foaming period to obtain a target gene editing mature ovum; and then performing in-vitro fertilization on the mature ovum edited by the target gene to obtain a non-chimeric target gene edited pig embryo.

Specifically, the method comprises the following steps:

s1, constructing a gene editing system of a targeted pig target gene;

s2, microinjection culture: editing the target gene by an ovum cytoplasm microinjection gene editing system in the pig live foaming period to obtain a target gene editing mature ovum;

s3, in-vitro fertilization: and (3) carrying out in-vitro fertilization on the mature ovum edited by the target gene to obtain a non-chimeric gene edited pig embryo.

After in vitro fertilization, PCR amplification and genotype detection of a single mature oocyte or embryo are required, and the editing efficiency of a gene editing system and the genotype mosaic condition of a gene editing pig embryo are detected; to obtain a non-chimeric gene-edited porcine embryo.

S4, carrying out PCR amplification and genotype detection on a single mature oocyte or embryo, and detecting the editing efficiency of a gene editing system and the genotype mosaic condition of a gene editing pig embryo.

Based on the method, the invention provides a preparation method of a non-chimeric Dmd gene edited pig embryo, and the target gene is Dmd gene. Specifically, the method comprises the following steps:

s1, constructing a gene editing system of a targeted pig Dmd gene;

s2, microinjection culture: editing Dmd gene by an ovum cytoplasm microinjection gene editing system in the pig live foaming period to obtain Dmd gene editing mature ovum;

s3, in-vitro fertilization: performing in-vitro fertilization on the Dmd gene-edited mature ovum to obtain a non-chimeric Dmd gene-edited pig embryo;

As a preferred alternative, the gene editing system can BE the CRISPR/Cas9 system or a single base editor system (e.g., BE 3).

More preferably, the CRISPR/Cas9 system includes grnas targeting the porcine Dmd gene and CRISPR/Cas9 mRNA; more preferably, the gRNA is any one or several of g1, g2, g3 or g4, and the sequences are respectively shown in SEQ ID NO. 1-4;

preferably, the CRISPR/Cas9mRNA sequence is shown in SEQ ID No. 5.

Further preferably, the single base editor BE3 system includes gRNA targeting the pig Dmd gene and BE3 mRNA. More preferably, the gRNA is any one or several of g5, g6, g7, g8 and g9, and the sequences are respectively shown in SEQ ID NO. 14-18.

Preferably, the BE3mRNA sequence is shown in SEQ ID NO. 19.

Preferably, the specific method of step S2 is: collecting a cumulus-oocyte complex, performing ovum microinjection culture in a foaming period, and adopting a sectional culture mode of 22h +22 h.

Preferably, the conditions of the microinjection culture are: each oocyte is injected with a 40-60pL (preferably 50pL) gene editing system.

Preferably, the gene editing system is a mixture of 200 ng/. mu.L of editing protein mRNA (such as CRISPR/Cas9mRNA or BE3mRNA) and 100 ng/. mu.L gRNA.

Preferably, the volume ratio of mRNA to gRNA in the gene editing system is 1: 1.

preferably, in step S3: completely removing granular cells from mature ovum, incubating sperm and ovum for 5-8h (preferably 6h), and culturing in embryo culture solution.

In step S4: 2.5. mu.L of each sample was lysed and PCR was performed using TOYOBO KOD FX.

In step S4, when the editing system is CRISPR/Cas9 system, the PCR amplification primer sequences are as follows:

g1F(SEQ ID NO.6):5′-TGATGGCAAACTCCACTGAGAA-3′；

g1R(SEQ ID NO.7):5′-CGCAGGGCTATGAACGAACT-3′；

g2F(SEQ ID NO.8):5′-TCAGCGTTTGGAATCTCCTGAA-3′；

g2R(SEQ ID NO.9):5′-ACACTAAATTCCCCAAATACAAGGG-3′；

g3F(SEQ ID NO.10):5′-AAGCTAGTGTGAGCAATGAGTGT-3′；

g3R(SEQ ID NO.11):5′-CGAGAGGAAGTGGGATAACTGG-3′；

g4F(SEQ ID NO.12):5′-TGCTCATCTGGAACAAAGATACAC-3′；

g4R(SEQ ID NO.13):5′-GGCTTCTTAGCTTCACGTTCAT-3′。

the PCR products were sent to the company for sequencing analysis with g1F, g2F, g3F and g4F primers, respectively.

In step S4, when the editing system is the single base editor BE3 system, the PCR amplification primer sequences are as follows:

g5F(SEQ ID NO.20):5′-ATGATCAATCTTCCACCTGCATCA-3′；

g5R(SEQ ID NO.21):5′-GGG GGATCTGGCCAACCATA-3′；

g6/7F(SEQ ID NO.22):5′-AAAAGTATGAAGGGCGAAGGG-3′；

g6/7R(SEQ ID NO.23):5′-GCATAGGGAAAAGAACTCTGGTCA-3′；

g8F(SEQ ID NO.24):5′-GCTTGTGGTGTGCATCCTAA-3′；

g8R(SEQ ID NO.25):5′-TCATCCGTTGCCTCCTGAAG-3′；

g9F(SEQ ID NO.26):5′-CTCGGCTTATAGGACTGCCAT-3′；

g9R(SEQ ID NO.27):5′-ACAGTCCAGGTGAACACTAAGTC-3′。

the PCR products were sent to the company for sequencing analysis with g5F, g6/7R, g8R and g9R, respectively.

In addition, the invention also provides a kit for preparing a non-chimeric Dmd gene-edited pig embryo, which comprises gRNA and CRISPR/Cas9 mRNA; the gRNA is any one or more of g1, g2, g3 or g4, and the sequences of the gRNA are respectively shown in SEQ ID NO. 1-4.

Preferably, the CRISPR/Cas9mRNA sequence is shown in SEQ ID No. 5.

Preferably, the kit further comprises PCR amplification and sequencing primers, and the sequence is shown as SEQ ID NO. 6-13.

The invention also provides a kit for preparing a non-chimeric Dmd gene edited pig embryo, which comprises gRNA and BE3 mRNA; the gRNA is any one or more of g5, g6, g7, g8 and g9, and the sequences are respectively shown in SEQ ID NO. 14-18.

Preferably, the BE3mRNA sequence is shown in SEQ ID NO. 19.

The invention has the following beneficial effects:

according to the invention, a pig live-foaming-stage ovum cytoplasm microinjection CRISPR/Cas9 system is used for editing Dmd gene located on X chromosome, so that a Dmd gene editing mature ovum is obtained; further, the mature ovum edited by the Dmd gene is inseminated in vitro, and the non-chimeric Dmd gene mutation pig embryo is efficiently obtained.

The invention has potential value for quickly constructing the non-chimeric maternal gene editing F0 embryo and quickly producing large animal disease models and new quality.

Drawings

FIG. 1 is a flow chart of the DMD disease model pig embryo preparation technology of the present invention.

FIG. 2 is a flow chart of the preparation technology of the DMD disease model pig embryo (CRISPR/Cas9mRNA system).

FIG. 3 is a schematic representation and sequence of gRNAs (in-frame italic sequence PAM region).

FIG. 4 shows the result of gene editing of pig ovum Dmd (A: peak of PCR product sequencing. blue underline indicates gRNA sequence, red triangle indicates cleavage position, green underline indicates PAM region. B: comparison of editing efficiency between different gRNAs).

FIG. 5 shows the in vitro fertilization embryo gene editing results (A: different gRNA editing efficiency and allele number. B: single genotype mutant embryo target sequence. the underlined position in WT sequence represents PAM region.

FIG. 6 is a flow chart of the DMD disease model pig embryo preparation technique (Single base editor BE3 system) of the present invention.

Fig. 7 is a schematic diagram of grnas and sequences (red C as editing target and blue sequence as PAM region).

FIG. 8 shows the editing result of the Dmd gene of pig ovum (A: sequencing peak of PCR product. blue underline represents gRNA sequence, red triangle represents editing target, green underline represents PAM region. B: comparison of editing efficiency between different gRNAs).

FIG. 9 shows the results of in vitro fertilization embryo gene editing (A: different gRNA editing efficiency and allele number. B: single and two genotype mutant embryo target sequences. the underlined positions in the WT sequences represent PAM regions. Red T represents the C > T mutation resulting from single base editing.the horizontal line represents the missing base.Red lower case letters represent the alternative bases.blue C (5) > T represents that the embryo contains only the expected target C > T mutation.Brown C (5) > T represents that the embryo contains other mutation types than the expected target C > T mutation.M represents male, F represents female).

Detailed Description

The present invention is further illustrated by the following specific examples, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

The technological process of preparing the DMD disease model pig embryo is shown in figure 1, and the following examples refer to the specific two gene editing system technologies.

The reagent formulations used in the examples below:

A.TL-HEPES-PVA：114mM NaCl，3.2mM KCl，0.34mM NaH₂PO₄10mM sodium lactate, 0.5mM MgCl₂·6H₂O, 10mM HEPES, 0.2mM sodium pyruvate, 12mM sorbitol, 2mM NaHCO₃，2mM CaCl₂·2H₂O, 25. mu.g/mL gentamicin and 65. mu.g/mL penicillin.

B. In vitro maturation culture solution

i. Basic culture solution: TCM-199, 26.19mM NaHCO₃3.05mM D-glucose, 0.91mM sodium pyruvate, 75. mu.g/mL penicillin sodium salt, 50. mu.g/mL streptomycin sulfate and 0.1% PVA (w/v).

ii.0-22h in vitro maturation medium: to the basal medium were added 0.5. mu.g/mL luteinizing hormone, 0.5. mu.g/mL follicle stimulating hormone, 10ng/mL Epidermal Growth Factor (EGF), 10% Porcine Follicular Fluid (PFF) and 0.57 mML-cysteine.

iii.22-44h in vitro maturation medium: to the basal medium, 10ng/ml EGF and 10% PFF were added. The mature culture solution is prepared one day ahead of time and at 38.5 deg.C with 5% CO₂Buffer in incubator for 4h or more or overnight.

C. Operation liquid: to TCM-199 was added 30mM NaCl, 0.595mM NaHCO₃0.1% HEPES, 50. mu.g/mL penicillin, 60. mu.g/mL streptomycin and 0.3% BSA.

D. Melting liquid: 0.3M mannitol, 1.0mM CaCl₂·2H₂O，0.1mM MgCl₂·6H₂O, 0.5mM HEPES. The pH was adjusted to 7.4.

E. Embryo culture solution: 108mM NaCl, 10mM KCl, 0.35mM KH₂PO₄，0.40mM MgSO₄·7H₂O，25mM NaHCO₃2mM L-glutamine, 4.99mM hypotaurine (hypotaurine), 50 μ g/mL gentamycin, 0.20mM sodium pyruvate, 0.06g/100mL calcium lactate, and 2% BME amino acid.

F.mTBM：113mMNaCl，3mMKCl，10mM CaCl₂·2H₂O, 20mM Tris, 11mM glucose, 5mM sodium pyruvate, 0.2% BSA,2mM caffeine, 0.075mg/mL penicillin, 0.05mg/mL streptomycin and 0.069mg/mLL-cysteine.

Example 1 CRISPR/Cas9 System editing porcine oocytes preparation of non-chimeric DMD mutant model porcine embryos

The technical process for constructing the DMD disease model pig embryo based on the CRISPR/Cas9 system is shown in FIG. 2.

Design and synthesis of gRNA of targeted porcine Dmd gene and synthesis of CRISPR/Cas9mRNA

Schematic diagram and sequence of gRNA design are shown in FIG. 3, which specifically includes the following steps:

1. pig Dmd gene target site design

The gRNA sequences are shown below:

g1(SEQ ID NO.1)：TAGGCATAGCTCTTGAACCG；

g2(SEQ ID NO.2)：GAGGACACACTGCAAGCACA；

g3(SEQ ID NO.3)：GTGGTAGTCGATGAATCTAG；

g4(SEQ ID NO.4)：GCCTCTTGTACTGATACCAC；

the sequence of the SpCas9mRNA is shown as SEQ ID NO. 5.

2. Synthetic preparation of CRISPR/Cas9mRNA and gRNAs

gRNAs and SpCas9 mRNAs were transcribed in vitro by pDR274(Addgene, #42250) and pT7-3 XFlag-hCas 9, respectively.

Of these, pT7-3 XFlag-hCas 9 was linearized with PmE I and transcribed in vitro using the mMESSAGEMCHINE T7ULTRA kit (Invitrogen), while pDR274 was linearized with Dra I and transcribed in vitro using the MEGASHORTscript T7kit (Invitrogen). After transcription was complete, Cas9mRNA and gRNAs were purified using the RNeasy Mini Kit (Qiagen), finally collected with RNase-free water and concentrations determined using NanoDrop-1000.

Second, collection of cumulus-oocyte complex and ovum microinjection culture in the stage of foaming

1. Collection of cumulus-oocyte complexes

The experimental ovaries are collected from slaughterhouses, collected into sample boxes within the shortest time after slaughter and stored in an insulated manner. The ovary should be selected during the collection process, and the ovary with uniform follicle size, most 3-6mm diameter and transparent pale yellow follicle liquid is selected. Ovaries with too large, too small follicles or engorged follicular fluid should be discarded. Pig ovaries collected from slaughterhouses were stored in a vacuum flask filled with a physiological saline preheated at 37 ℃ and brought back to the laboratory within 3 hours.

Before the collection, the ovary is washed for 2-3 times by physiological saline with the temperature of 37 ℃, and the blood water is removed; the follicular fluid in a 3-6mm transparent follicle on the ovary was aspirated by a 10mL syringe equipped with a 12G syringe needle, and the follicular fluid was collected in a centrifuge tube previously added with TL-HEPES-PVA and allowed to stand for precipitation.

Then, the cumulus-oocyte complexes in the follicular fluid are picked out under a stereomicroscope, and the cumulus-oocyte complexes with larger diameter, uniform and dark cytoplasm and more than 3 cumulus cell layers are selected and washed 3 times by TL-HEPES-PVA.

2. Ovum microinjection culture in the stage of foaming

The cumulus-oocyte complexes collected were used for cytoplasmic microinjection, and approximately 50pL of a 200 ng/. mu.L CRISPR/Cas9mRNA and 100 ng/. mu.L gRNA cocktail were injected into each oocyte.

Rinsing the injected cumulus-oocyte complex in oocyte basic culture solution once, transferring into in-vitro maturation culture solution for 0-22h, culturing about 100 cumulus-oocyte complexes in 1mL in-vitro maturation culture solution per hole of 12-hole plate, adding 5% CO at 38 deg.C₂Culturing in a saturated humidity incubator; and after 22h, transferring the cumulus-oocyte complex into 22-44h of in-vitro maturation culture solution, and continuing culturing for 22h to obtain a mature cumulus-oocyte complex.

3. Pig ovum Dmd gene editing result

After the ovum in the foaming period is subjected to cytoplasmic microinjection by a CRISPR/Cas9 system, the ovum develops to the MII period in 44 h. Single egg lysis, target PCR sent by company sequencing analysis.

The results show that 4 grnas were effective with efficiencies between 12.1% and 41.4% (fig. 4).

Third, in vitro fertilization of porcine oocytes

Transferring the mature cumulus-oocyte complex into a working solution added with 0.1 percent of hyaluronidase,repeatedly blowing and beating to ensure that cumulus cells completely fall off; oocytes that were homogeneous in cytoplasm and filled in the zona pellucida and visible in the first polar body were selected under a stereomicroscope and washed 3 times in mTBM. Then, the oocytes were transferred to 100. mu.L mTBM droplets covered with mineral oil, containing about 30 oocytes per droplet, at 38 ℃ in 5% CO₂And pre-incubating for 1h in a saturated humidity incubator, and waiting for fertilization.

Adding 2mL of semen into 5mL of TL-HEPES-PVA for cleaning, then washing twice in 5mL of mTBM, and centrifuging at 1500rpm for 5 min; after the last wash, the sperm concentration was diluted to 1X 10⁶one/mL. Then, 15. mu.L of sperm diluent was added to the drop of oocyte to be fertilized, and the drop was placed at 38 ℃ with 5% CO₂And incubating for 6 hours in a saturated humidity incubator.

After incubation, the zygote is put into embryo culture solution for washing for 6 times, and the sperm which does not enter the ovum falls off from the transparent belt by gentle blowing and beating in the washing process. Transferring cleaned zygote to embryo culture solution covered with mineral oil, adding 5% CO at 38 deg.C₂And culturing in a saturated humidity incubator.

PCR amplification and genotype detection of four, single mature oocytes or embryos

1. Mature oocytes or 8-cell stage embryos cultured in vitro are collected, washed in 0.01% BSA in PBS, and then individually placed in 0.2mL centrifuge tubes each containing 2.5. mu.L of genomic extract. The collected sample is put into a PCR instrument and incubated for 3h at 65 ℃ to ensure that the cell protein is fully hydrolyzed. Then incubated at 95 ℃ for 10min to inactivate protease K. After the sample is cracked, the target sequence can be amplified by PCR, and then sequencing is carried out.

The PCR product lengths of g1, g2, g3 and g4 are 789bp, 301bp, 587bp and 648bp, respectively.

The PCR primer sequences were as follows:

g1F:5′-TGATGGCAAACTCCACTGAGAA-3′；

g1R:5′-CGCAGGGCTATGAACGAACT-3′；

g2F:5′-TCAGCGTTTGGAATCTCCTGAA-3′；

g2R:5′-ACACTAAATTCCCCAAATACAAGGG-3′；

g3F:5′-AAGCTAGTGTGAGCAATGAGTGT-3′；

g3R:5′-CGAGAGGAAGTGGGATAACTGG-3′；

g4F:5′-TGCTCATCTGGAACAAAGATACAC-3′；

g4R:5′-GGCTTCTTAGCTTCACGTTCAT-3′。

PCR was performed using the TOYOBO KOD FX high fidelity enzyme as follows:

2×PCR buffer for KOD FX，10μL；2mM dNTPs，4μL；KOD FX(1.0U/μL)，0.4μL；10pmol/μL Primer F：0.4μL；10pmol/μL Primer R：0.4μL；ddH₂o, 2.3 μ L; template: 2.5. mu.L (single oocyte/embryo lysate).

PCR conditions were as follows: at 95 ℃ for 3 min; 35 cycles (98 ℃, 10 s; 55 ℃, 30 s; 68 ℃, 1 min); at 68 ℃ for 2 min; 4 ℃ and infinity.

2. Dmd Gene editing results of genotype analysis of in vitro fertilized embryo from ovum

A total of 22 g1 and 36 g4 injected embryos at 8-cell stage were collected for genotyping, and 72.7% (16/22) of the g1 injected group and 58.3% (21/36) of the g4 injected group were mutants (FIG. 5A). Further sequence analysis of the mutated embryos showed that 8 (50.0%) of the g1 injection group, 5 (23.8%) of the g4 injection group had only 1 genotype, 5 (31.3%) of the g1 injection group, and 6 (28.6%) of the g4 injection group had 2 genotypes (fig. 5A). The remaining embryos were of 3 genotypes or more, indicating that they were chimeric embryos (FIG. 5A). We focused on sequence information from non-chimeric embryos. The mutation types comprise small fragment deletion, insertion and substitution, and the maximum deletion and insertion are respectively 9bp and 20 bp. Mutant embryos with 1 or 2 genotypes were homozygous or heterozygous non-chimeric embryos, with g1 and g4 accounting for 81.3% and 52.4% of the total mutant embryos, respectively (fig. 5A). The G1 injection group had 8 single genotype mutant embryos, 4 with 5bp deletion, 1 with 2bp deletion, 1 with 4bp deletion, 1 with 1bp insertion, and 1 with a > G, C > G and +10bp substitutions (fig. 5B). The g4 injection group had 5 monogenotype mutant embryos, 3 with 9bp deletion and 2 with 3bp deletion (FIG. 5B).

Example 2 Single base editor BE3 editing porcine oocytes to prepare non-chimeric human DMD pathogenicity point mutation model porcine embryos

The technical process for constructing the DMD disease model pig embryo based on the single base editor BE3 system is shown in FIG. 6.

Design and synthesis of gRNA targeting pig Dmd gene and synthesis of BE3mRNA

Schematic diagram and sequence of gRNA design are shown in FIG. 7, which specifically includes the following steps:

1. pig Dmd gene target site design

gRNA sequences and targets are shown below:

g5(SEQ ID NO.14)：CAGAGCAACTGAACAGCCGG；

g6(SEQ ID NO.15)：GCACAGACCCTAACAGATGG；

g7(SEQ ID NO.16)：TTGGCACAGACCCTAACAGA；

g8(SEQ ID NO.17)：CCTACGAAAGCAGGCTGAGG；

g9(SEQ ID NO.18)：GAAGCTCCGAAGACTGCAGA。

red marker C is an editing target designed according to human DMD pathological mutation.

The BE3mRNA sequence is shown in SEQ ID NO. 19.

2. Synthesis preparation of BE3mRNA and gRNAs

gRNAs and BE3mRNA were transcribed in vitro by pDR274(Addgene, #42250) and pT7-3 Xflag-BE 3, respectively.

Of these, BE3 was linearized by Pme I and transcribed in vitro using the mMESSAGEEmMACHINE T7ULTRA kit (Invitrogen), while pDR274 was linearized by Dra I and transcribed in vitro using the MEGASHORTscript T7kit (Invitrogen). After transcription was complete, BE3mRNA and gRNAs were purified using the RNeasy Mini Kit (Qiagen), collected by dissolving with RNase-free water, and the concentration was determined using NanoDrop-1000.

1. Collection of cumulus-oocyte complexes

2. Ovum microinjection culture in the stage of foaming

The cumulus-oocyte complexes collected were used for cytoplasmic microinjection, and approximately 50pL of a mixture of 200 ng/. mu.L BE3mRNA and 100 ng/. mu.L gRNA was injected into each oocyte.

3. Pig ovum Dmd gene editing result

After the ovum in the foaming period passes through a cytoplasm microinjection BE3 system, the ovum develops to the MII period after 44 hours. Single egg lysis, target PCR sent by company sequencing analysis.

The results show that 5 grnas were effective with efficiencies between 6.8% and 54.8% (fig. 8).

Third, in vitro fertilization of porcine oocytes

Transferring the mature cumulus-oocyte complex into an operating fluid with 0.1% hyaluronidase, and repeatedly blowing and beating to ensure that the cumulus cells completely fall off; oocytes that were homogeneous in cytoplasm and filled in the zona pellucida and visible in the first polar body were selected under a stereomicroscope and washed 3 times in mTBM. Then, the oocytes were transferred to 100. mu.L mTBM droplets covered with mineral oil, containing about 30 oocytes per droplet, at 38 ℃ in 5% CO₂And pre-incubating for 1h in a saturated humidity incubator, and waiting for fertilization.

Adding 2mL of semen into 5mL of TL-HEPES-PVA for cleaning, then rinsing twice in 5mL of mTBM, and centrifuging for 5min at 1500 rpm; after the last rinse, the sperm concentration was diluted to 1X 10⁶one/mL. Then, 15. mu.L of sperm diluent was added to the drop of oocyte to be fertilized, and the drop was placed at 38 ℃ with 5% CO₂And incubating for 6 hours in a saturated humidity incubator.

1. Mature oocytes or 8-cell stage embryos cultured in vitro are collected, washed in 0.01% BSA in PBS, and then individually placed in 0.2mL centrifuge tubes each containing 2.5. mu.L of genomic extract. The collected samples were placed in a PCR instrument and incubated at 65 ℃ for 3h and then at 95 ℃ for 10 min. After the sample is cracked, the target sequence can be amplified by PCR, and then sequencing is carried out.

The PCR product lengths of g5, g6/g7, g8 and g9 were 735bp,904bp,445bp and 425bp, respectively.

The PCR primer sequences were as follows:

g5F:5′-ATGATCAATCTTCCACCTGCATCA-3′；

g5R:5′-GGG GGATCTGGCCAACCATA-3′；

g6/7F:5′-AAAAGTATGAAGGGCGAAGGG-3′；

g6/7R:5′-GCATAGGGAAAAGAACTCTGGTCA-3′；

g8F:5′-GCTTGTGGTGTGCATCCTAA-3′；

g8R:5′-TCATCCGTTGCCTCCTGAAG-3′；

g9F:5′-CTCGGCTTATAGGACTGCCAT-3′；

g9R:5′-ACAGTCCAGGTGAACACTAAGTC-3′.。

PCR was performed using the TOYOBO KOD FX high fidelity enzyme as follows:

A total of 38 blastula injected with g8 were collected for genotyping, with 50.0% (19/38) embryos being mutants (FIG. 9A). Further sequence analysis of the mutant embryos revealed that 5 (26.3%) had only 1 genotype, 9 (47.4%) had 2 genotypes (FIG. 9A), and the remaining embryos were 3 genotypes or more, indicating that they were chimeric embryos (FIG. 9A). Through sex identification analysis, all the 1 genotype mutant embryos are male, and the rest are female. In the male mutant embryo, 3 are expected site C > T mutations, and the efficiency is 60.0%; in female mutant embryos, 3 were expected heterozygous non-chimeric mutations with an efficiency of 21.4% (fig. 9B). Therefore, non-chimeric homozygous male and heterozygous female DMD disease model pig embryos simulating the pathological mutation of the human DMD can be obtained in one step.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Zhongshan university

<120> construction method of non-chimeric gene editing pig embryo model

<130>

<160> 27

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> g1

<400> 1

taggcatagc tcttgaaccg 20

<210> 2

<211> 20

<212> DNA

<213> g2

<400> 2

gaggacacac tgcaagcaca 20

<210> 3

<211> 20

<212> DNA

<213> g3

<400> 3

gtggtagtcg atgaatctag 20

<210> 4

<211> 20

<212> DNA

<213> g4

<400> 4

gcctcttgta ctgataccac 20

<210> 5

<211> 4269

<212> DNA

<213> CRISPR/Cas9 mRNA

<400> 5

gactataagg accacgacgg agactacaag gatcatgata ttgattacaa agacgatgac 60

gataagatgg ccccaaagaa gaagcggaag gtcggtatcc acggagtccc agcagccgac 120

aagaagtaca gcatcggcct ggacatcggc accaactctg tgggctgggc cgtgatcacc 180

gacgagtaca aggtgcccag caagaaattc aaggtgctgg gcaacaccga ccggcacagc 240

atcaagaaga acctgatcgg agccctgctg ttcgacagcg gcgaaacagc cgaggccacc 300

cggctgaaga gaaccgccag aagaagatac accagacgga agaaccggat ctgctatctg 360

caagagatct tcagcaacga gatggccaag gtggacgaca gcttcttcca cagactggaa 420

gagtccttcc tggtggaaga ggataagaag cacgagcggc accccatctt cggcaacatc 480

gtggacgagg tggcctacca cgagaagtac cccaccatct accacctgag aaagaaactg 540

gtggacagca ccgacaaggc cgacctgcgg ctgatctatc tggccctggc ccacatgatc 600

aagttccggg gccacttcct gatcgagggc gacctgaacc ccgacaacag cgacgtggac 660

aagctgttca tccagctggt gcagacctac aaccagctgt tcgaggaaaa ccccatcaac 720

gccagcggcg tggacgccaa ggccatcctg tctgccagac tgagcaagag cagacggctg 780

gaaaatctga tcgcccagct gcccggcgag aagaagaatg gcctgttcgg aaacctgatt 840

gccctgagcc tgggcctgac ccccaacttc aagagcaact tcgacctggc cgaggatgcc 900

aaactgcagc tgagcaagga cacctacgac gacgacctgg acaacctgct ggcccagatc 960

ggcgaccagt acgccgacct gtttctggcc gccaagaacc tgtccgacgc catcctgctg 1020

agcgacatcc tgagagtgaa caccgagatc accaaggccc ccctgagcgc ctctatgatc 1080

aagagatacg acgagcacca ccaggacctg accctgctga aagctctcgt gcggcagcag 1140

ctgcctgaga agtacaaaga gattttcttc gaccagagca agaacggcta cgccggctac 1200

attgacggcg gagccagcca ggaagagttc tacaagttca tcaagcccat cctggaaaag 1260

atggacggca ccgaggaact gctcgtgaag ctgaacagag aggacctgct gcggaagcag 1320

cggaccttcg acaacggcag catcccccac cagatccacc tgggagagct gcacgccatt 1380

ctgcggcggc aggaagattt ttacccattc ctgaaggaca accgggaaaa gatcgagaag 1440

atcctgacct tccgcatccc ctactacgtg ggccctctgg ccaggggaaa cagcagattc 1500

gcctggatga ccagaaagag cgaggaaacc atcaccccct ggaacttcga ggaagtggtg 1560

gacaagggcg cttccgccca gagcttcatc gagcggatga ccaacttcga taagaacctg 1620

cccaacgaga aggtgctgcc caagcacagc ctgctgtacg agtacttcac cgtgtataac 1680

gagctgacca aagtgaaata cgtgaccgag ggaatgagaa agcccgcctt cctgagcggc 1740

gagcagaaaa aggccatcgt ggacctgctg ttcaagacca accggaaagt gaccgtgaag 1800

cagctgaaag aggactactt caagaaaatc gagtgcttcg actccgtgga aatctccggc 1860

gtggaagatc ggttcaacgc ctccctgggc acataccacg atctgctgaa aattatcaag 1920

gacaaggact tcctggacaa tgaggaaaac gaggacattc tggaagatat cgtgctgacc 1980

ctgacactgt ttgaggacag agagatgatc gaggaacggc tgaaaaccta tgcccacctg 2040

ttcgacgaca aagtgatgaa gcagctgaag cggcggagat acaccggctg gggcaggctg 2100

agccggaagc tgatcaacgg catccgggac aagcagtccg gcaagacaat cctggatttc 2160

ctgaagtccg acggcttcgc caacagaaac ttcatgcagc tgatccacga cgacagcctg 2220

acctttaaag aggacatcca gaaagcccag gtgtccggcc agggcgatag cctgcacgag 2280

cacattgcca atctggccgg cagccccgcc attaagaagg gcatcctgca gacagtgaag 2340

gtggtggacg agctcgtgaa agtgatgggc cggcacaagc ccgagaacat cgtgatcgaa 2400

atggccagag agaaccagac cacccagaag ggacagaaga acagccgcga gagaatgaag 2460

cggatcgaag agggcatcaa agagctgggc agccagatcc tgaaagaaca ccccgtggaa 2520

aacacccagc tgcagaacga gaagctgtac ctgtactacc tgcagaatgg gcgggatatg 2580

tacgtggacc aggaactgga catcaaccgg ctgtccgact acgatgtgga ccatatcgtg 2640

cctcagagct ttctgaagga cgactccatc gacaacaagg tgctgaccag aagcgacaag 2700

aaccggggca agagcgacaa cgtgccctcc gaagaggtcg tgaagaagat gaagaactac 2760

tggcggcagc tgctgaacgc caagctgatt acccagagaa agttcgacaa tctgaccaag 2820

gccgagagag gcggcctgag cgaactggat aaggccggct tcatcaagag acagctggtg 2880

gaaacccggc agatcacaaa gcacgtggca cagatcctgg actcccggat gaacactaag 2940

tacgacgaga atgacaagct gatccgggaa gtgaaagtga tcaccctgaa gtccaagctg 3000

gtgtccgatt tccggaagga tttccagttt tacaaagtgc gcgagatcaa caactaccac 3060

cacgcccacg acgcctacct gaacgccgtc gtgggaaccg ccctgatcaa aaagtaccct 3120

aagctggaaa gcgagttcgt gtacggcgac tacaaggtgt acgacgtgcg gaagatgatc 3180

gccaagagcg agcaggaaat cggcaaggct accgccaagt acttcttcta cagcaacatc 3240

atgaactttt tcaagaccga gattaccctg gccaacggcg agatccggaa gcggcctctg 3300

atcgagacaa acggcgaaac cggggagatc gtgtgggata agggccggga ttttgccacc 3360

gtgcggaaag tgctgagcat gccccaagtg aatatcgtga aaaagaccga ggtgcagaca 3420

ggcggcttca gcaaagagtc tatcctgccc aagaggaaca gcgataagct gatcgccaga 3480

aagaaggact gggaccctaa gaagtacggc ggcttcgaca gccccaccgt ggcctattct 3540

gtgctggtgg tggccaaagt ggaaaagggc aagtccaaga aactgaagag tgtgaaagag 3600

ctgctgggga tcaccatcat ggaaagaagc agcttcgaga agaatcccat cgactttctg 3660

gaagccaagg gctacaaaga agtgaaaaag gacctgatca tcaagctgcc taagtactcc 3720

ctgttcgagc tggaaaacgg ccggaagaga atgctggcct ctgccggcga actgcagaag 3780

ggaaacgaac tggccctgcc ctccaaatat gtgaacttcc tgtacctggc cagccactat 3840

gagaagctga agggctcccc cgaggataat gagcagaaac agctgtttgt ggaacagcac 3900

aagcactacc tggacgagat catcgagcag atcagcgagt tctccaagag agtgatcctg 3960

gccgacgcta atctggacaa agtgctgtcc gcctacaaca agcaccggga taagcccatc 4020

agagagcagg ccgagaatat catccacctg tttaccctga ccaatctggg agcccctgcc 4080

gccttcaagt actttgacac caccatcgac cggaagaggt acaccagcac caaagaggtg 4140

ctggacgcca ccctgatcca ccagagcatc accggcctgt acgagacacg gatcgacctg 4200

tctcagctgg gaggcgacaa aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag 4260

aaaaagtga 4269

<210> 6

<211> 22

<212> DNA

<213> g1F

<400> 6

tgatggcaaa ctccactgag aa 22

<210> 7

<211> 20

<212> DNA

<213> g1R

<400> 7

cgcagggcta tgaacgaact 20

<210> 8

<211> 22

<212> DNA

<213> g2F

<400> 8

tcagcgtttg gaatctcctg aa 22

<210> 9

<211> 25

<212> DNA

<213> g2R

<400> 9

acactaaatt ccccaaatac aaggg 25

<210> 10

<211> 23

<212> DNA

<213> g3F

<400> 10

aagctagtgt gagcaatgag tgt 23

<210> 11

<211> 22

<212> DNA

<213> g3R

<400> 11

cgagaggaag tgggataact gg 22

<210> 12

<211> 24

<212> DNA

<213> g4F

<400> 12

tgctcatctg gaacaaagat acac 24

<210> 13

<211> 22

<212> DNA

<213> g4R

<400> 13

ggcttcttag cttcacgttc at 22

<210> 14

<211> 20

<212> DNA

<213> g5

<400> 14

cagagcaact gaacagccgg 20

<210> 15

<211> 20

<212> DNA

<213> g6

<400> 15

gcacagaccc taacagatgg 20

<210> 16

<211> 20

<212> DNA

<213> g7

<400> 16

ttggcacaga ccctaacaga 20

<210> 17

<211> 20

<212> DNA

<213> g8

<400> 17

cctacgaaag caggctgagg 20

<210> 18

<211> 20

<212> DNA

<213> g9

<400> 18

gaagctccga agactgcaga 20

<210> 19

<211> 5247

<212> DNA

<213> BE3 mRNA

<400> 19

gactataagg accacgacgg agactacaag gatcatgata ttgattacaa agacgatgac 60

gataagatgg ccccaaagaa gaagcggaag gtcggtatcc acggagtcac gcgtatgagc 120

tcagagactg gcccagtggc tgtggacccc acattgagac ggcggatcga gccccatgag 180

tttgaggtat tcttcgatcc gagagagctc cgcaaggaga cctgcctgct ttacgaaatt 240

aattgggggg gccggcactc catttggcga catacatcac agaacactaa caagcacgtc 300

gaagtcaact tcatcgagaa gttcacgaca gaaagatatt tctgtccgaa cacaaggtgc 360

agcattacct ggtttctcag ctggagccca tgcggcgaat gtagtagggc catcactgaa 420

ttcctgtcaa ggtatcccca cgtcactctg tttatttaca tcgcaaggct gtaccaccac 480

gctgaccccc gcaatcgaca aggcctgcgg gatttgatct cttcaggtgt gactatccaa 540

attatgactg agcaggagtc aggatactgc tggagaaact ttgtgaatta tagcccgagt 600

aatgaagccc actggcctag gtatccccat ctgtgggtac gactgtacgt tcttgaactg 660

tactgcatca tactgggcct gcctccttgt ctcaacattc tgagaaggaa gcagccacag 720

ctgacattct ttaccatcgc tcttcagtct tgtcattacc agcgactgcc cccacacatt 780

ctctgggcca ccgggttgaa aagcggcagc gagactcccg ggacctcaga gtccgccaca 840

cccgaaagtg ataaaaagta ttctattggt ttagccatcg gcactaattc cgttggatgg 900

gctgtcataa ccgatgaata caaagtacct tcaaagaaat ttaaggtgtt ggggaacaca 960

gaccgtcatt cgattaaaaa gaatcttatc ggtgccctcc tattcgatag tggcgaaacg 1020

gcagaggcga ctcgcctgaa acgaaccgct cggagaaggt atacacgtcg caagaaccga 1080

atatgttact tacaagaaat ttttagcaat gagatggcca aagttgacga ttctttcttt 1140

caccgtttgg aagagtcctt ccttgtcgaa gaggacaaga aacatgaacg gcaccccatc 1200

tttggaaaca tagtagatga ggtggcatat catgaaaagt acccaacgat ttatcacctc 1260

agaaaaaagc tagttgactc aactgataaa gcggacctga ggttaatcta cttggctctt 1320

gcccatatga taaagttccg tgggcacttt ctcattgagg gtgatctaaa tccggacaac 1380

tcggatgtcg acaaactgtt catccagtta gtacaaacct ataatcagtt gtttgaagag 1440

aaccctataa atgcaagtgg cgtggatgcg aaggctattc ttagcgcccg cctctctaaa 1500

tcccgacggc tagaaaacct gatcgcacaa ttacccggag agaagaaaaa tgggttgttc 1560

ggtaacctta tagcgctctc actaggcctg acaccaaatt ttaagtcgaa cttcgactta 1620

gctgaagatg ccaaattgca gcttagtaag gacacgtacg atgacgatct cgacaatcta 1680

ctggcacaaa ttggagatca gtatgcggac ttatttttgg ctgccaaaaa ccttagcgat 1740

gcaatcctcc tatctgacat actgagagtt aatactgaga ttaccaaggc gccgttatcc 1800

gcttcaatga tcaaaaggta cgatgaacat caccaagact tgacacttct caaggcccta 1860

gtccgtcagc aactgcctga gaaatataag gaaatattct ttgatcagtc gaaaaacggg 1920

tacgcaggtt atattgacgg cggagcgagt caagaggaat tctacaagtt tatcaaaccc 1980

atattagaga agatggatgg gacggaagag ttgcttgtaa aactcaatcg cgaagatcta 2040

ctgcgaaagc agcggacttt cgacaacggt agcattccac atcaaatcca cttaggcgaa 2100

ttgcatgcta tacttagaag gcaggaggat ttttatccgt tcctcaaaga caatcgtgaa 2160

aagattgaga aaatcctaac ctttcgcata ccttactatg tgggacccct ggcccgaggg 2220

aactctcggt tcgcatggat gacaagaaag tccgaagaaa cgattactcc atggaatttt 2280

gaggaagttg tcgataaagg tgcgtcagct caatcgttca tcgagaggat gaccaacttt 2340

gacaagaatt taccgaacga aaaagtattg cctaagcaca gtttacttta cgagtatttc 2400

acagtgtaca atgaactcac gaaagttaag tatgtcactg agggcatgcg taaacccgcc 2460

tttctaagcg gagaacagaa gaaagcaata gtagatctgt tattcaagac caaccgcaaa 2520

gtgacagtta agcaattgaa agaggactac tttaagaaaa ttgaatgctt cgattctgtc 2580

gagatctccg gggtagaaga tcgatttaat gcgtcacttg gtacgtatca tgacctccta 2640

aagataatta aagataagga cttcctggat aacgaagaga atgaagatat cttagaagat 2700

atagtgttga ctcttaccct ctttgaagat cgggaaatga ttgaggaaag actaaaaaca 2760

tacgctcacc tgttcgacga taaggttatg aaacagttaa agaggcgtcg ctatacgggc 2820

tggggacgat tgtcgcggaa acttatcaac gggataagag acaagcaaag tggtaaaact 2880

attctcgatt ttctaaagag cgacggcttc gccaatagga actttatgca gctgatccat 2940

gatgactctt taaccttcaa agaggatata caaaaggcac aggtttccgg acaaggggac 3000

tcattgcacg aacatattgc gaatcttgct ggttcgccag ccatcaaaaa gggcatactc 3060

cagacagtca aagtagtgga tgagctagtt aaggtcatgg gacgtcacaa accggaaaac 3120

attgtaatcg agatggcacg cgaaaatcaa acgactcaga aggggcaaaa aaacagtcga 3180

gagcggatga agagaataga agagggtatt aaagaactgg gcagccagat cttaaaggag 3240

catcctgtgg aaaataccca attgcagaac gagaaacttt acctctatta cctacaaaat 3300

ggaagggaca tgtatgttga tcaggaactg gacataaacc gtttatctga ttacgacgtc 3360

gatcacattg taccccaatc ctttttgaag gacgattcaa tcgacaataa agtgcttaca 3420

cgctcggata agaaccgagg gaaaagtgac aatgttccaa gcgaggaagt cgtaaagaaa 3480

atgaagaact attggcggca gctcctaaat gcgaaactga taacgcaaag aaagttcgat 3540

aacttaacta aagctgagag gggtggcttg tctgaacttg acaaggccgg atttattaaa 3600

cgtcagctcg tggaaacccg ccaaatcaca aagcatgttg cacagatact agattcccga 3660

atgaatacga aatacgacga gaacgataag ctgattcggg aagtcaaagt aatcacttta 3720

aagtcaaaat tggtgtcgga cttcagaaag gattttcaat tctataaagt tagggagata 3780

aataactacc accatgcgca cgacgcttat cttaatgccg tcgtagggac cgcactcatt 3840

aagaaatacc cgaagctaga aagtgagttt gtgtatggtg attacaaagt ttatgacgtc 3900

cgtaagatga tcgcgaaaag cgaacaggag ataggcaagg ctacagccaa atacttcttt 3960

tattctaaca ttatgaattt ctttaagacg gaaatcactc tggcaaacgg agagatacgc 4020

aaacgacctt taattgaaac caatggggag acaggtgaaa tcgtatggga taagggccgg 4080

gacttcgcga cggtgagaaa agttttgtcc atgccccaag tcaacatagt aaagaaaact 4140

gaggtgcaga ccggagggtt ttcaaaggaa tcgattcttc caaaaaggaa tagtgataag 4200

ctcatcgctc gtaaaaagga ctgggacccg aaaaagtacg gtggcttcga tagccctaca 4260

gttgcctatt ctgtcctagt agtggcaaaa gttgagaagg gaaaatccaa gaaactgaag 4320

tcagtcaaag aattattggg gataacgatt atggagcgct cgtcttttga aaagaacccc 4380

atcgacttcc ttgaggcgaa aggttacaag gaagtaaaaa aggatctcat aattaaacta 4440

ccaaagtata gtctgtttga gttagaaaat ggccgaaaac ggatgttggc tagcgccgga 4500

gagcttcaaa aggggaacga actcgcacta ccgtctaaat acgtgaattt cctgtattta 4560

gcgtcccatt acgagaagtt gaaaggttca cctgaagata acgaacagaa gcaacttttt 4620

gttgagcagc acaaacatta tctcgacgaa atcatagagc aaatttcgga attcagtaag 4680

agagtcatcc tagctgatgc caatctggac aaagtattaa gcgcatacaa caagcacagg 4740

gataaaccca tacgtgagca ggcggaaaat attatccatt tgtttactct taccaacctc 4800

ggcgctccag ccgcattcaa gtattttgac acaacgatag atcgcaaacg atacacttct 4860

accaaggagg tgctagacgc gacactgatt caccaatcca tcacgggatt atatgaaact 4920

cggatagatt tgtcacagct tgggggtgac tctggtggtt ctactaatct gtcagatatt 4980

attgaaaagg agaccggtaa gcaactggtt atccaggaat ccatcctcat gctcccagag 5040

gaggtggaag aagtcattgg gaacaagccg gaaagcgata tactcgtgca caccgcctac 5100

gacgagagca ccgacgagaa tgtcatgctt ctgactagcg acgcccctga atacaagcct 5160

tgggctctgg tcatacagga tagcaacggt gagaacaaga ttaagatgct ctctggtggt 5220

tctcccaaga agaagaggaa agtctaa 5247

<210> 20

<211> 24

<212> DNA

<213> g5F

<400> 20

atgatcaatc ttccacctgc atca 24

<210> 21

<211> 20

<212> DNA

<213> g5R

<400> 21

gggggatctg gccaaccata 20

<210> 22

<211> 21

<212> DNA

<213> g6F/g7F

<400> 22

aaaagtatga agggcgaagg g 21

<210> 23

<211> 24

<212> DNA

<213> g6R/g7R

<400> 23

gcatagggaa aagaactctg gtca 24

<210> 24

<211> 20

<212> DNA

<213> g8F

<400> 24

gcttgtggtg tgcatcctaa 20

<210> 25

<211> 20

<212> DNA

<213> g8R

<400> 25

tcatccgttg cctcctgaag 20

<210> 26

<211> 21

<212> DNA

<213> g9F

<400> 26

ctcggcttat aggactgcca t 21

<210> 27

<211> 23

<212> DNA

<213> g9R

<400> 27

acagtccagg tgaacactaa gtc 23

Claims

1. A preparation method of a non-chimeric Dmd gene edited pig embryo is characterized in that firstly, a target gene is edited by an ovum cytoplasm microinjection gene editing system in a pig live foaming period to obtain a target gene edited mature ovum; carrying out in-vitro fertilization on the mature ovum edited by the target gene, and then carrying out PCR amplification and sequencing to obtain a non-chimeric target gene edited pig embryo;

wherein the target gene is Dmd gene;

the gene editing system is a CRISPR/Cas9 system or a single-base editor BE3 system;

the CRISPR/Cas9 system includes grnas targeting the porcine Dmd gene and CRISPR/Cas9 mRNA; the gRNA is g1 and/or g4, and the sequences are respectively shown as SEQ ID NO.1 and/or SEQ ID NO. 4; the CRISPR/Cas9mRNA sequence is shown as SEQ ID NO. 5; the sequence of the PCR amplification primer of g1 is shown as SEQ ID NO.6-7, and the sequence of the sequencing primer is shown as SEQ ID NO. 6; the sequence of the PCR amplification primer of g4 is shown as SEQ ID NO.12-13, and the sequence of the sequencing primer is shown as SEQ ID NO. 12;

the single base editor BE3 system comprises gRNA targeting pig Dmd gene and BE3 mRNA; the gRNA is g8, and the sequence is shown in SEQ ID NO. 17; the BE3mRNA sequence is shown in SEQ ID NO. 19; the sequence of the PCR amplification primer of g8 is shown as SEQ ID NO.24-25, and the sequence of the sequencing primer is shown as SEQ ID NO. 25.

2. The method of claim 1, comprising the steps of:

s1, constructing a gene editing system of a targeted pig target gene;

s3, in-vitro fertilization: performing in-vitro fertilization on the mature ovum edited by the target gene;

and S4, carrying out PCR amplification and sequencing to obtain the non-chimeric gene editing pig embryo.

3. The method according to claim 2, wherein the specific method of step S2 is: collecting a cumulus-oocyte complex, performing ovum cytoplasm microinjection culture in the foaming period, and adopting a sectional culture mode of 22h +22 h.

4. The method according to claim 2, wherein the injection amount of step S2 is 40-60 pL.

5. The method according to claim 2, wherein the concentration ratio of mRNA to gRNA in the gene editing system injected in step S2 is 200 ng/. mu.L: 100 ng/. mu.L.

6. A kit for preparing a non-chimeric Dmd gene-edited porcine embryo comprising the gene editing system of claim 1; PCR amplification and sequencing primer; the gene editing system is a CRISPR/Cas9 system or a single-base editor BE3 system, and the sequences of PCR amplification and sequencing primers in the CRISPR/Cas9 system are shown as SEQ ID NO.6-7 and/or SEQ ID NO. 12-13; the sequences of the PCR amplification and sequencing primers in the single-base editor BE3 system are shown in SEQ ID NO. 24-25.