CN110452863B

CN110452863B - Application of ornithine cyclohexane enzyme in improving yield of iturin A produced by bacillus amyloliquefaciens

Info

Publication number: CN110452863B
Application number: CN201910685439.5A
Authority: CN
Inventors: 陈守文; 蔡冬波; 许玉享; 杨勇; 马昕; 高林; 王瑞; 任晓红; 丁才夫
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2019-07-27
Filing date: 2019-07-27
Publication date: 2021-08-27
Anticipated expiration: 2039-07-27
Also published as: CN110452863A

Abstract

The invention belongs to the field of gene and biological fermentation, and discloses application of ornithine cyclohexane enzyme in improving yield of iturin A produced by bacillus amyloliquefaciens. The invention takes the plasmid pHY300PLK as the basis, and successfully strengthens the expression of genes in the bacillus amyloliquefaciens LX-12 by constructing an over-expression vector pHY-ocd of ornithine cyclohexane Ocd from corynebacterium glutamicumocdAnd obtaining the Bacillus amyloliquefaciens engineering bacteria LX-12/pHY-ocd. Compared with the control bacterium LX-12/pHY300, the IturinA yield of the engineering strain LX-12/pHY-ocd is at least improved by over 37 percent.

Description

Application of ornithine cyclohexane enzyme in improving yield of iturin A produced by bacillus amyloliquefaciens

Technical Field

The invention belongs to the field of gene and biological fermentation, and particularly relates to application of ornithine cyclohexane enzyme in improving yield of iturin A produced by bacillus amyloliquefaciens.

Background

Iturin A is a lipopeptide secondary metabolite mainly synthesized by bacillus subtilis and bacillus amyloliquefaciens, the molecular structure of the Iturin A comprises a peptide chain consisting of seven amino acid residues and a beta-amino fatty acid side chain, the amino acid components comprise asparagine (Asn), glutamine (D-Gln), serine (L-Ser), proline (L-Pro) and tyrosine (D-Tyr), and the Iturin A can inhibit the propagation and growth of plant fungal diseases, so the Iturin A has important application value in the field of plant biological control. At present, lipopeptide antibiotics are mainly applied to the fields of agricultural biological control, medicine, oil exploitation, food preservation, environmental control, cosmetics and the like.

Proline in bacillus is mainly converted from glutamic acid through the gene cluster proABC, and ornithine cyclohexane Ocd derived from corynebacterium glutamicum can catalyze the synthesis of proline from ornithine.

There is no report of increasing iturin a using ornithine cyclohexanase of corynebacterium glutamicum. The invention realizes the effective improvement of the Iturin A yield for the first time by the intensified expression of the ornithine cyclohexane Ocd, and provides a new strategy for the construction of the high-yield strain of the Iturin A.

Disclosure of Invention

The invention aims to provide application of ornithine cyclohexane enzyme in improving the yield of iturin A produced by bacillus amyloliquefaciens, and the yield of iturin A can be improved by over-expressing the ornithine cyclohexane enzyme in the bacillus amyloliquefaciens.

In order to achieve the purpose, the invention adopts the following technical measures:

the use of an ornithine cyclohexane enzyme for increasing the yield of iturin a produced by bacillus amyloliquefaciens comprises increasing the yield of iturin a by transferring an ornithine cyclohexane enzyme derived from corynebacterium glutamicum into bacillus amyloliquefaciens in a manner conventional in the art.

In the above applications, preferably, the sequence of the ornithine cyclohexane enzyme is shown in SEQ ID No. 1;

in the above-mentioned application, it is preferable that the ornithine cyclohexane enzyme gene is inserted into the plasmid pHY300PLK to obtain sufficient plasmid pHY-ocd, and then transformed into Bacillus amyloliquefaciens;

in the above application, preferably, the bacillus amyloliquefaciens is bacillus amyloliquefaciens LX-12, CCTCC NO: m2015234.

In the above-mentioned applications, preferably, the fermentation medium formulation used in the application process comprises: 50-90g/L of soybean meal, 30-70g/L of corn starch and KH₂PO₄ 1.0-2.0g/L，MgSO₄·7H₂O 0.50-1.0g/L、FeSO₄·7H₂O 0.10-0.30g/L、MnSO₄·H₂O 0.01-0.03g/L，pH6.2～7.2。

the invention can greatly improve the yield of iturin A by transferring the ornithine cyclohexane enzyme plasmid of corynebacterium glutamicum into bacillus amyloliquefaciens to express, and the inventor tries to improve the yield of iturin A by intensively expressing ocd gene for the first time, thereby providing a new strategy for improving the yield of iturin A. Compared with a control strain transformed with an empty plasmid, namely the Bacillus amyloliquefaciens LX-12/pHY300, the Iturin A yield of the Bacillus amyloliquefaciens LX-12/pHY-ocd constructed by the invention is improved by at least 37 percent, thereby providing guidance and theoretical basis for the large-scale production of the subtilin A in the future.

Drawings

FIG. 1 is an agarose gel photograph of the ocd gene fragment obtained in step (1) of example 1;

wherein, Lane 1 is DNA marker, Lane 2 is ocd gene fragment.

FIG. 2 is a PCR-verified agarose gel of the colonies of the overexpression plasmid pHY-ocd obtained in step (3) of example 1;

wherein, Lane 1 is DNA marker, Lane 2 is PCR-verified band of over-expression plasmid pHY-ocd.

FIG. 3 is a PCR-verified agarose gel of the colony of the positive transformant LX-12/pHY-ocd obtained in step (4) of example 1;

wherein, Lane 1 is DNA marker, Lane 2 is the band verified by colony PCR of LX-12/pHY-ocd;

the molecular weights of the top and bottom bands in the DNA marker lane are as follows: 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100 bp.

Detailed Description

The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, if not specifically mentioned, are commercially available.

Example 1:

construction of an engineered Strain LX-12/pHY-ocd containing an ornithine cyclohexane enzyme plasmid:

1. designing primers (ocd-F and ocd-R); using Corynebacterium glutamicum ATCC 13032 genome DNA as a template, and amplifying to obtain an ocd gene sequence (1761bp) comprising a restriction enzyme cutting site;

ocd-F：CGGAATCCCTCCCTGCTGTGGAGGGAACCA

ocd-R：GCTCTAGACTTCGTCTTCCTTGCCGGTGCT；

the sequence of the ocd gene is shown as SEQ ID NO. 1.

2. Carrying out double enzyme digestion on the target gene fragment by using EocRI and XbaI restriction enzymes to obtain an enzyme digestion gene fragment (1759bp), and simultaneously carrying out double enzyme digestion on the plasmid pHY300PLK by using the EocRI and the XbaI restriction enzymes to obtain a linear plasmid fragment (4870 bp); wherein, the restriction enzymes EocRI and XbaI are purchased from Beijing Quanjin Biotechnology Limited;

3. subjecting the enzyme-cut gene fragment and the linear plasmid fragment to T₄DNA ligase is used for ligation to obtain a ligation product; the ligation product was transferred to E.coli DH 5. alpha. by calcium chloride transformation, and screened in a medium containing ampicillin resistance at 37 ℃ to obtain transformants, and colony PCR was performed on the transformants selected plasmids (primers pHY-F and pHY-R). If the PCR verification result of the transformant is as follows: an electrophoresis band appears at 2011bp position, which indicates that the over-expression vector is successfully constructed, and the transformant is positiveThe chemostat is named as: the over-expression vector pHY-ocd;

pHY-F：GTTTATTATCCATACCCTTAC

pHY-R：CAGATTTCGTGATGCTTGTC

4. the over-expression vector pHY-ocd is transferred into Bacillus amyloliquefaciens LX-12(CCTCC NO: M2015234) by an electric shock transformation method, a culture medium containing tetracycline resistance is screened at 37 ℃, a transformant is obtained by screening, and colony PCR verification is carried out on a transformant selection plasmid (the used primers are pHY-F and pHY-R). If the PCR verification result of the transformant is as follows: an electrophoretic band appeared at 2011bp, demonstrating that: the over-expression vector pHY-ocd is successfully transferred into the Bacillus amyloliquefaciens LX-12, and at the moment, the transformant is a positive transformant (i.e. the Bacillus amyloliquefaciens LX-12 transferred into the over-expression vector pHY-ocd), namely the engineering strain LX-12/pHY-ocd obtained by the invention; by the same method, the empty plasmid pHY300PLK is transferred into LX-12, and PCR verification is carried out to obtain a control strain, i.e., Bacillus amyloliquefaciens LX-12/pHY 300.

Example 2:

the application of the ornithine cyclohexane enzyme in improving the yield of iturin A produced by bacillus amyloliquefaciens is as follows:

in this example, the ability of the engineered strain LX-12/pHY-ocd to produce iturin A was examined for different fermentation medium formulations (while the 18 medium was inoculated with Bacillus amyloliquefaciens LX-12/pHY300 as a control), and the formulations of the 18 groups of media are specifically shown in Table 1:

TABLE 1 different fermentation medium formulations pH6.9-7.2

The seed liquid is obtained by the following specific steps: activating bacillus amyloliquefaciens, namely inoculating 1 percent of glycerol tube by volume into an LB culture medium containing 5mL, culturing at the temperature of 37 ℃ at 250r/min for 12 hours, then inoculating the activated bacterial liquid into a fermentation culture medium in the table 1 by the inoculation amount of 1 percent of volume, and culturing at the temperature of 37 ℃ at 250r/min for 12 hours to obtain a seed culture solution;

the fermentation comprises the following specific steps: 150mL of the fermentation medium shown in Table 1 was placed in a 500mL Erlenmeyer flask, and the seed culture solution was cultured for 72 hours at an inoculum size of 3% (volume percentage) at a rotation speed of 250r/min and a temperature of 28 ℃ to obtain a fermentation solution.

The inventor adopts a liquid phase detection method to measure the yield of IturinA in the fermentation liquor. The measurement conditions are specifically as follows: taking 1.5mL fermentation liquor in a 2mL centrifuge tube, centrifuging for 15min at 10000r/min, taking 300 mu L supernatant in 1.2mL methanol, shaking up and leaching for 1h, then centrifuging for 15min at 10000r/min, filtering with a 0.22 mu m filter membrane, and then using the sample for HPLC detection.

The HPLC system is Agilent 1260series, the chromatographic column is Lichrospher C18 (specification: 5 μm, 25 cm. times.4.6 mm), the mobile phase is 10mmol/L ammonium acetate/acetonitrile 65:35(V/V), the sample injection amount is 10ul, the detection wavelength is 210nm, and the flow rate is 1.0 mL/min. The yield of IturinA in the production broth was calculated according to the liquid phase method (Table 2).

TABLE 2 yield of iturin A after fermentation of different medium formulations

As can be seen from Table 2, under the same seed fermentation and production fermentation conditions, the Iturin A yield in the bacterial liquid of the production fermentation of the Bacillus amyloliquefaciens LX-12/pHY-ocd of the invention is greatly improved (at least by 37%) compared with that of the Bacillus amyloliquefaciens LX-12/pHY300 of the prior art, which shows that: the technical scheme of the invention has great application value in the aspect of improving the yield of the Bacillus IturinA.

In addition, the applicant further searched for a mechanism that the gene can improve iturin A, and the following components of iturin A: asparagine (Asn), glutamine (D-Gln), serine (L-Ser), proline (L-Pro) and tyrosine (D-Tyr) are respectively added into a fermentation medium in the fermentation process, and the result shows that the yield of the iturin A is not obviously improved, which indicates that the improvement of a single component does not promote the further synthesis of the iturin A.

Sequence listing

<110> university of Hubei

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1749

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctccctgctg tggagggaac cactggccat catcgtgacc cttacatacg cattcggcgt 60

gacctggttg attgccacga tcttgaacaa gttcatgact ctgcgcatca cctccgaagc 120

cgaatatgaa ggcattgacc gcgcagaaca cgcagaatct gcctaccacc tcaattccaa 180

cggaattggg atggcaaccc gcaccaattt cggacctgaa atccccgagg aaaccgtgcc 240

cgacgccgtg caggtgggcg tcgataagca aaaaatcgct gatactcgaa aggcctcaaa 300

atgaccgcaa cctacaccac tgaaaccgcc atcaatttct tgttcttgag cgaaccggac 360

atgatcgcgg ccggagtcaa agacgtcgcg caatgcgtcg atgtcatgga ggaaacgctc 420

gtgctcttgg cgcagggcga ctacaaaatg gccggtttga actccaactc gcatggcgcg 480

atgatcacct tcccggaaaa cccagaattt gaaggcatgc ccaaggacgg ccccgaccgc 540

cgattcatgg cgatgcccgc atacctcggc gggcgattca aaaacaccgg cgtgaagtgg 600

tacggatcca acgcggaaaa caaggcctca ggcttgcctc gctcgatcca caccttcgtc 660

ctcaacgaca cggtcaccgg tgcaccgaag gccatcatgt ccgcgaacct gctgtccgcc 720

taccgcaccg gcgcggttcc cggcgtgggc gtgaagcact tagcggtcgc cgacgcgaca 780

accttggctg tcgtcggacc tggtgtcatg gcgaaaacca tcaccgaagc gtgcatcgca 840

gagcgcccag gaatcaccac catcaagatc aagggacgca gcgaacgcgg catcaacgcc 900

tttgcaacat gggcgttgga aaaattcccc gagatcgaag tggtcgccgt cggatctgaa 960

gaagacgtgg tcaaagacgc cgacatcgtc atcgccgcca ccaccacgga cgccgccggc 1020

tcctccgcct tcccatactt caaaaaagaa tggctcaagc cgggcgcatt gctgctgctt 1080

ccagccgccg gtcgcttcga cgacgcttat ttgcttgacg acgcccgcct cgttgttgac 1140

tacatggggc tctacgaagc ctgggcagaa gaatacggcc cacaggccta ccaactactc 1200

ggcattccag gaacccactg gtacgacctg gcgctgcaag gaaaactcga ccttgcaaag 1260

atttcccaga ttggcgatat ctgctccggc aagctacccg gacgcaccaa cgatgaggaa 1320

atcatcctct attccgtcgg cggcatgcca gtagaagacg tcgcctgggc aacccaagtg 1380

tatgaaaacg ccctggaaaa aggcgtcggc accacattga acctgtggga atcacccgca 1440

ctggcttgag agaagaaaca acaatgaaaa ttgcggtaat cggccttgga tcaaccggct 1500

ccatggcact gtggcactta agtaacatcc caggtgtaga ggccatcggc tttgaacaat 1560

tcggcatctc ccatggctac ggcgcattca caggggagtc ccgactgttt cgcatggcct 1620

accacgaagg cagcacctac gttccgttgc tcaaacgcgc acgagcacta tggtcatcac 1680

tgagcgagat ttccggacgc gaactcttcc acaacttcgg tgtcttaagc accggcaagg 1740

aagacgaag 1749

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cggaatccct ccctgctgtg gagggaacca 30

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctctagact tcgtcttcct tgccggtgct 30

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtttattatc cataccctta c 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtttattatc cataccctta c 21

Claims

1. Use of ornithine cyclohexane enzyme in increasing bacillus amyloliquefaciens (bacillus amyloliquefaciens)Bacillus amyloliquefaciens) The application of the yield of the produced iturin A, wherein the nucleotide sequence of the ornithine cyclohexane enzyme is shown as SEQ ID NO. 1.

2. The use according to claim 1, which comprises inserting the ornithine cyclohexane enzyme gene into the plasmid pHY300PLK to obtain a recombinant plasmid and transforming the recombinant plasmid into Bacillus amyloliquefaciens.

3. The use of claim 1, wherein the bacillus amyloliquefaciens is bacillus amyloliquefaciens LX-12, CCTCC NO: m2015234.

4. Use according to claim 1, in a fermentation medium formulation for use in a process comprising: 50-90g/L of soybean meal, 30-70g/L of corn starch and KH₂PO₄1.0-2.0g/L，MgSO₄•7H₂O 0.50-1. 0g/L、FeSO₄•7H₂O 0.10-0.30 g/L、MnSO₄•H₂O 0.01-0.03 g/L，pH6.2~7.2。