CN110438095B

CN110438095B - Synthesis and application of novel nano reaction container

Info

Publication number: CN110438095B
Application number: CN201910703448.2A
Authority: CN
Inventors: 门冬; 张先恩; 张玉威; 周娟
Original assignee: Wuhan Institute of Virology of CAS
Current assignee: Wuhan Institute of Virology of CAS
Priority date: 2019-07-31
Filing date: 2019-07-31
Publication date: 2023-09-05
Anticipated expiration: 2039-07-31
Also published as: CN110438095A

Abstract

The invention provides a novel functional nano reaction vessel, which comprises shell proteins csoS1 and csoS4A/B/D capable of forming the nano reaction vessel. The functional nano reaction container provided by the invention has at least one of the following advantages: the container can be efficiently expressed and self-assembled into nano empty shells with different sizes in a prokaryotic expression system, the exogenous fluorescent protein molecule mCherry and superoxide dismutase can be effectively packaged by coupling ribulose-1, 5-biphosphate carboxylase to improve the stability of the fluorescent protein molecule mCherry and superoxide dismutase, a coupling related enzymatic reaction system can effectively catalyze and generate specific metabolites such as volatile metabolites including 1, 2-propanediol, ethanolamine and the like or certain active metabolic intermediate metabolites such as NADH and the like, and the catalytic protection related anaerobic reaction is carried out in aerobic bacteria, so that the genetic characteristics of the fluorescent protein molecule mCherry and superoxide dismutase are stable, and the technical support is provided for the application of metabolic engineering and synthetic biology of the compound.

Description

Synthesis and application of novel nano reaction container

Technical Field

The invention relates to a functional nanometer reaction container for artificial synthesis, in particular to synthesis and application of a novel nanometer reaction container.

Background

The nano material is widely used in the fields of clinical diagnosis, medicine analysis, energy, catalysis, environment and the like due to the advantages of small size, large specific surface area, easy modification, unique physical and chemical properties, good biocompatibility and the like. Currently, there are many kinds of nanomaterials, such as liposomes, different polymer nanostructures, protein structures, ribonucleic acid nanoparticles, carbon materials, and inorganic nanomaterials, such as Mesoporous Silica (MSNP), superparamagnetic iron oxide nanomaterials (SPIONs), quantum Dots (QDs), gold nanoparticles (AuNPs), etc. The application of the biological nano material gradually becomes a hot spot, and the search of the nano material with good biocompatibility can be used for the fields of biological imaging, drug delivery, enzymatic catalysis, gene therapy and the like, and is a target of struggle among researchers.

Natural biological nanomaterials are typically nano-container structures that are self-assembled in vivo from one or more protein subunits to form a size of about 10-200nm, generally have a regular tetrahedron, regular octahedron, regular dodecahedron, or regular icosahedron symmetry, and perform complex and ordered vital activities. This bottom-up self-assembly system provides a natural paradigm for nanotechnology development: such as the common ferritin cage structure, DNA binding proteins (Dps) derived from starved cells, virus and virus-like nanoparticles (VNP), bacterial Microstructure (BMC) commonly distributed in microscopic algae and certain specialized autotrophic bacteria, and the like. Compared with the nano container formed by the self-assembly mode of the inorganic nano material commonly used in the assembly, the biological nano container has a highly symmetrical assembly body, and forms a stable regular polyhedron structure by self-assembly of fixed single subunits or different subunits. And the external surface, interface or internal surface of the nano container can be modified by means of genetic engineering or chemical modification, etc., so that the formation of protein structure can not be affected. And these functional ligands are uniformly distributed on the surface of the nano-container in a fixed number and orientation. The protein nano-containers can be prepared in one step in a mature prokaryotic or eukaryotic expression system, and the preparation method is simple in process and low in cost. No special material instrument is needed, and the product can be obtained in a short time. In biomedical applications, protein nanocontainers also have high biocompatibility and are able to cross biological barriers. It is because of these characteristics of natural biological nanomaterials that biological nanomaterials will be ideal building units in assembly to build multifunctional nanoreaction platforms, develop and develop more and better nanoreaction systems.

Disclosure of Invention

In view of the above, the invention provides a nano-reaction container based on carboxylation component source, and preparation and application thereof, wherein the nano-reaction container can be efficiently and completely expressed in a prokaryotic expression system in a soluble way and self-assembled into empty shells of nano-reaction containers with different sizes.

The present invention provides a nanoreaction vessel comprising shell proteins csoS1 and csoS4A/B capable of forming a nanoreaction vessel. The nanometer reaction container has simple components, and can be formed by self-assembly of related proteins in bacteria.

In one embodiment of the invention, the nanoreaction vessel further comprises a shell-associated protein csoS2.

In one embodiment of the invention, the nanoreaction vessel consists of capsid proteins csoS1, csoS4A/B and capsid related protein csoS2.

In one embodiment of the invention, the nanoreaction vessel further comprises a csoS1D protein that maintains the stable structure of the shell.

In one embodiment of the invention, the nanoreaction vessel consists of capsid proteins csoS1, csoS4A/B, capsid related protein csoS2 and csoS1D protein that maintains the stable structure of the capsid.

In one embodiment of the invention, the nanoreaction vessel further comprises ribulose-1, 5-bisphosphate carboxylase (RuBisCO). The ribulose-1, 5-bisphosphate carboxylase is wrapped inside the cavity of the nano-reaction container.

In one embodiment of the present invention, the nanoreaction vessel is capable of efficiently packaging a functional nanoreaction vessel of an exogenous cargo molecule. The exogenous cargo molecule may be "waste" generated during cellular metabolism, or a metabolic microenvironment component involved in the production of certain anaerobic, anoxic, or toxic metabolic intermediates: such as microalgae or certain energy-converting autotrophic bacteria, are widely present in the body and participate in the fixation and conversion of CO ₂ Ribulose-1, 5-bisphosphate carboxylase RuBisCO @ _EC _4.1.1.39 ) Carbonic anhydrase csoSCA @ _EC _4.2.1.1) Or in particular metabolic enzymatic reaction systems in microorganisms with particular metabolic properties, such as in particular Salmonella (Salmonella enterica), pdu enzymatic reaction system components involved in the metabolic process of 1, 2-propanediol, such as PduCDE @, are present _EC _4.2.1.28 )、PduP( _EC1.2.1.3 ) Etc., as well as certain Eut enzymatic reaction system multienzyme components involved in ethanolamine metabolic pathways also present in E.coli: eutT% _EC _2.5.1.17 )、EutD( _EC _2.3.1.8 )、EutG( _EC _1.1.1.1 ) And the like, or substances having a remarkable effect on the human body or cells, such as ribulose-1, 5-bisphosphate (RuBP), cobalamin, superoxide dismutase (SOD), reduced coenzyme I (NADH), and the like, which are analogues of cyanocobalamin B12.

In one embodiment of the invention, the method is carried out by mCherry% _MK046076 ) SOD as exogenous cargo molecule and is linked to RuBisCO _EC _4.1.1.39 ) Big subunit cbbl [ ] _PMM0550 ) And further packaged inside the cavity of the nanoreaction vessel.

In one embodiment of the invention, the nanoreaction vessel consists of ribulose-1, 5-bisphosphate carboxylase (RuBisCO), fluorescent protein mCherry, superoxide dismutase (SOD) capsid proteins csoS1 and csoS 4A/B.

In one embodiment of the invention, the nanoreaction vessel consists of ribulose-1, 5-bisphosphate carboxylase (RuBisCO), fluorescent protein mCherry, superoxide dismutase (SOD) capsid proteins csoS1, csoS4A/B and capsid protein csoS 2.

In one embodiment of the present invention, the nanoreaction vessel comprises ribulose-1, 5-bisphosphate carboxylase (RuBisCO), fluorescent protein mCherry, superoxide dismutase (SOD) capsid protein csoS1, csoS4A/B, capsid protein csoS2 and csoS1D protein maintaining a stable structure.

In one embodiment of the present invention, the nanoreaction vessel consists of ribulose-1, 5-bisphosphate carboxylase (RuBisCO), fluorescent protein mCherry, superoxide dismutase (SOD), capsid proteins csoS1, csoS4A/B, capsid protein csoS2 and csoS1D protein maintaining a stable structure.

In one embodiment of the invention, the nanoreaction vessel comprises or consists of the following components: ribulose-1, 5-bisphosphate carboxylase (RuBisCO), coenzyme B12 dependent diol dehydratase PduCDE, NAD ⁺ Dependent propanal dehydrogenase PduP, capsid proteins csoS1, csoS4A/B and capsid related protein csoS2.

In one embodiment of the invention, the nanoreaction vessel comprises or consists of the following components: ribulose-1, 5-bisphosphate carboxylase (RuBisCO), coenzyme B12 dependent diol dehydratase PduCDE, NAD ⁺ Dependent propanal dehydrogenase PduP, capsid proteins csoS1, csoS4A/B, capsid related protein csoS2 and csoS1D protein maintaining stable structure.

In one embodiment of the invention, the nanoreaction vessel comprises or consists of the following components: ribulose-1, 5-bisphosphate carboxylase (RuBisCO), alcohol dehydrogenase, acetaldehyde dehydrogenase, capsid proteins csoS1, csoS4A/B and capsid related protein csoS2.

In one embodiment of the invention, the nanoreaction vessel comprises or consists of the following components: ribulose-1, 5-bisphosphate carboxylase (RuBisCO), alcohol dehydrogenase, acetaldehyde dehydrogenase, capsid proteins csoS1, csoS4A/B, capsid related protein csoS2 and csoS1D protein maintaining stable structure.

In one embodiment of the invention, the nanoreaction vessel is a functional nanoreaction vessel synthesized in vitro.

In one embodiment of the invention, the nanoreactor composition is derived from the relevant component encoding the α -carboxylation entity in the model strain marine protogreen algae (Prochlorococcus MED 4).

In another aspect, the invention also provides an expression vector capable of expressing the relevant components required for the in vitro self-assembly of the various nano-reaction vessels.

Exemplary expression vectors are pTrcHisC, pBV221, pTrcHisA, pET-28a (+), pET-28b (+), pET100/D-TOPO, pETDuet-1, pET-37b (+), pQE-70, pColdIII, pBad/Myc-HisC, pBad/HisB, pTrcHis2C, pRSET-CFP, pRSET-BFP, pGFPuv, pBluescriptIISK (+), pKD46, pTYB1, pinPointXa-2, pTWIN1, pET-5a (+), pKD4, pRSETC, pBad33 and the like.

In another aspect, the invention provides an expression system comprising the expression vector and/or capable of expressing the nanoreaction vessel related components described above.

In a specific embodiment of the invention, the expression system is a prokaryotic expression system, preferably the expression system is an E.coli expression system.

In one embodiment of the invention, the expression system comprises a prokaryotic expression vector pETDuet-1.

The invention provides a preparation method of the nano reaction container, which comprises the following steps:

and introducing the gene combination contained in the nano reaction container into an expression vector and/or an expression system for expression through gene recombination.

Illustratively, the expression vector is a prokaryotic expression vector and the expression system is a prokaryotic expression system.

In one embodiment of the present invention, the preparation method of the nano-reaction container specifically includes the following steps: by gene recombination, related genes of the components of the nano reaction container are introduced into a prokaryotic expression vector pETDuet-1 for expression.

Illustratively, the related genes of the nanoreaction vessel include capsid proteins csoS1 and csoS4A/B, and optionally, capsid related protein csoS2 and/or csoS1D protein that maintains a stable structure.

The invention also provides the synthesized nano reaction container, and/or the expression vector and/or the application of the expression system in packaging exogenous cargo molecules.

Illustratively, the nanoreaction vessel comprises the capsid proteins csoS1, csoS4A/B and ribulose-1, 5-bisphosphate carboxylase (RuBisCO), and optionally, the capsid related protein csoS2 and/or the csoS1D protein that maintains a stable structure. The exogenous cargo molecule is fluorescent protein mCherry-SOD.

When the nano reaction container is self-assembled in vitro (for example, in engineering bacteria such as escherichia coli), the fluorescent protein mCherry is effectively packaged in the cavity by taking ribulose-1, 5-bisphosphate carboxylase as a connecting molecule, so that the functional nano reaction container is formed.

The nano reaction container provided by the invention has at least one of the following advantages: the nano reaction container provided by the invention can be efficiently expressed and self-assembled into nano reaction containers with different sizes in a prokaryotic expression system, has stable genetic characteristics, can effectively package exogenous cargo molecules such as fluorescent protein mCherry-SOD and the like to form a functional nano reaction container, and provides technical support for realizing synthesis of the functional nano reaction container in bacteria and application of the functional nano reaction container in biology.

Drawings

FIG. 1 is a schematic diagram showing the distribution of related genes for constructing a nanoreaction vessel in model strain marine protogreen algae in the embodiment of the invention.

Wherein csoS1D represents a dimer of a capsid protein, is trimerizable, and participates in maintaining the stable structure of carboxylated bodies (Proceedings of the National Academy of Sciences 109.2.2 (2012): 478-483.); csoS1 represents a shell-like surface protein which can be hexamed to form a carboxylated constituent unit; cbbl represents the large subunit of ribulose-1, 5-bisphosphate carboxylase; cbbs represent the small subunits of ribulose-1, 5-bisphosphate carboxylase, and fully functional ribulose-1, 5-bisphosphate carboxylase is formed by folding and assembling eight large subunits cbbl, eight small subunits cbbs; csoS2 represents a shell-related protein required for assembly of carboxylation, plays an important role in the assembly process of carboxylation, and researches show that the csoS2 can encode two molecular weight proteins in host bacteria, namely full-length and phosphorylated modified csoS2A and csoS2B with a lacking carboxyl end part, and the two proteins can play an auxiliary role in the assembly process of carboxylation; csoSCA represents carbonic anhydrase, which is wrapped in the cavity of carboxylation body and participates in HCO ₃ ^- With CO ₂ Mutual rotation betweenPerforming chemical treatment; csoS4A/B represents a capsid vertex protein that can be pentameric to form the vertex of a carboxylated regular icosahedron.

Fig. 2A is a schematic structural diagram of an expression vector co-transferred into escherichia coli in the nanoreaction vessel 1 according to an embodiment of the present invention. Wherein, the left side is a schematic diagram of a His-tag marked csoS2 expression vector, namely pCDFDuet-6His-csoS2; the right side is a schematic diagram of an expression vector of pETDuet-ProCB3, and the expression vector is co-transferred into E.coli, so that the nanometer reaction container 1 can be self-assembled in vivo.

Fig. 2B is a schematic structural diagram of the expression vector co-transferred into escherichia coli of the nanoreaction vessel 2 according to the embodiment of the invention. Wherein, the left side is a schematic diagram of a His-tag marked csoS2 expression vector, namely pCDFDuet-6His-csoS2; the right side is a schematic diagram of pETDuet-ProCB5 expression vector, and the vector is co-transferred into E.coli, so that the nano reaction vessel 2 can be self-assembled in vivo.

FIG. 3A-1 is a diagram showing the experimental results of SDS-PAGE of relevant components of the expressed container 1 according to the example of the present invention.

FIGS. 3A-2 are graphs showing the results of SDS-PAGE of relevant components of the expressed container 2 according to the examples of the present invention.

Wherein M represents a standard (Thermol 26616); "eluting" refers to eluting the hybrid protein with a lower concentration imidazole concentration Buffer (40mM imidazole,20mM Tris-HCl,500mM NaCl,pH7.4); the precipitation refers to the precipitation of target protein by using Buffer (1M imidazole,20mM Tris-HCl,500mM NaCl,pH7.4) with higher concentration of imidazole, and is also the composite protein of the nanometer reflecting container obtained by purification.

FIGS. 3B-1 and 3B-2 are graphs showing Western blotting of the synthesized nanoreaction vessel components according to the examples of the present invention.

FIG. 3C is a diagram showing the results of SDS-PAGE analysis of fractions of a. Alpha. -carboxylated species derived from Thiobacillus natto (Thiobacillus neapolitanus, an autotrophic bacteria highly homologous to the nanoreaction vessel source constructed in this experiment) isolated and identified by liquid chromatography mass spectrometry, with reference to the molecular weight correspondence of the fractions and the specific location of the SDS-PAGE bands.

Fig. 4A is a diagram showing the experimental result of a transmission electron microscope after separation and purification of α -carboxylation from wild marine protogreen algae by sucrose density gradient centrifugation and gel exclusion chromatography.

Fig. 4B is a diagram showing experimental results of a transmission electron microscope prepared by purifying two nano-reaction vessels by a nickel column and concentrating by dialysis according to an embodiment of the present invention.

Fig. 4C shows the particle size statistics of two nanoreaction vessels provided in the examples of the present invention.

Fig. 5A is a schematic diagram showing that an in vitro synthesis nanoreaction container provided by an embodiment of the invention has a package of exogenous cargo molecules mCherry and superoxide dismutase (SOD):

Wherein pcbbl-mCherry: refers to a plasmid expressing the fusion protein ribulose-1, 5-bisphosphate carboxylase (RuBisCO) large subunit cbbl and the foreign cargo molecule representing mcherry-SOD; pprcb 5: the expression vector which expresses the synthesized nano reaction vessel constructed by the five protein components is pETDuet-ProCB5; co-transformation: the two plasmids are jointly transferred into E.coli.

FIG. 5B shows a fluorescence distribution diagram of the in vitro synthesized nanoreaction vessel for packaging exogenous cargo molecule mCherry-SOD, and also performing intracellular SOD distribution positioning according to the embodiment of the invention.

Wherein the two figures above show: the mChery-SOD and a nanometer reaction container empty shell ProCB5 synthesized in vivo are co-expressed (+ProCB 5) or non-co-expressed (-ProCB 5) in an E.coli cell, and protein expression and in-vivo bacterial distribution analysis show that mChery can be uniformly distributed in bacterial cytoplasm when the nanometer reaction container empty shell exists or not, fluorescence distribution is uniform and fluorescence intensity is almost consistent, so that mChery can be effectively expressed without being influenced by the nanometer reaction container, and can not be randomly packaged into the cavity of the nanometer reaction container; the following two graphs represent: the mCherry-SOD and RuBisCO large subunit cbbl are fused and expressed to construct a fusion expression component cbbl-mCherry-SOD, and then the fusion expression component cbbl-mCherry-SOD and a nano reaction vessel empty shell ProCB5 are co-transferred into E.coli (+ProCB 5) or are only expressed in E.coli body (-ProCB 5) independently, and the cbbl-mCherry-SOD fusion protein is soluble and aggregated in fluorescence when no nano reaction vessel exists because the cbbl is expressed in bacteria body independently, and obvious fluorescence focus appears at one end or two ends of the bacteria. When the fluorescent protein mCherry is expressed together with the components of the nanometer reaction container synthesized in the body, because the nanometer reaction container has the trend of packing the RuBisCO in the self-assembly process in the bacterial body, the exogenous cargo molecule mCherry-SOD can be effectively packed into the cavity of the nanometer reaction container, so that the fluorescent protein mCherry is uniformly distributed in the cavity of the nanometer container and is aggregated in high density, and obvious fluorescence intensity attenuation phenomenon can occur, namely as shown in the lower graph of FIG. 5B, thereby further proving that the exogenous cargo molecule mCherry-SOD is packed into the nanometer container.

FIG. 5C is a graph showing experimental results of the in vitro synthesis of a nanoreaction vessel for packaging an exogenous cargo molecule mCherry-SOD and maintaining its stability according to an embodiment of the invention.

FIG. 6A is a schematic diagram showing the metabolic process of packaging 1, 2-propanediol in an in vitro synthesized nanoreactor according to an embodiment of the invention;

fig. 6B is a diagram showing the verification of the results of the metabolic process of packaging 1, 2-propanediol in an in vitro synthesized nanoreactor according to an embodiment of the invention:

wherein, wild type-LB: representing wild-type strain BL21 (DE 3), cultured overnight with enrichment medium LB; wild-type-base: representing wild-type strain BL21 (DE 3), cultured overnight with basal medium rich in propylene glycol; container-base: representative expression functional nanocapsules comprising a 1, 2-propanediol metabolic process were cultured overnight in a basal medium enriched with propanediol.

FIG. 7A is a schematic diagram showing an in vitro synthesis nanoreaction vessel with packaged ethanolamine metabolic process according to an embodiment of the invention;

fig. 7B is a diagram showing the verification of the results of the metabolic process of the packaged ethanolamine in the in vitro synthesis nanoreaction vessel according to the embodiment of the invention:

wherein, wild type-LB: representing wild-type strain BL21 (DE 3), cultured overnight with enrichment medium LB; wild-type-base: representing wild-type strain BL21 (DE 3), cultured overnight with a basal medium enriched with ethanolamine hydrochloride as the sole carbon source and nitrogen source; container-base: representative expression functional nanocapsules containing ethanolamine metabolic processes were cultured overnight in basal medium enriched with ethanolamine hydrochloride as the sole carbon source, nitrogen source.

Fig. 8 is a diagram showing experimental results of an anaerobic reaction process performed in aerobic bacteria in an in vitro synthesis nano reaction vessel protection provided by an embodiment of the present invention.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

In particular, as used herein, "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended, and does not exclude additional, unrecited elements or method steps. Any expression herein of "comprising", especially when describing a method, use or product of the invention, is to be understood to include those products, methods and uses consisting essentially of and consisting of the recited components or elements or steps. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.

The terms and expressions which have been employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Therefore, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

For a clearer description of the present application, reference will now be made in detail to the following examples, which are illustrative of the present application and are not to be construed as limiting the application.

The carboxylation of the marine protogreen algae (Prochlorococcus MED 4) derived from the model strain will be described in detail below.

In the application, the shell proteins csoS4A/B represent the independent shell proteins csoS4A, the independent shell proteins csoS4B or the shell proteins csoS4A and csoS4B; mCherry-SOD means that fluorescent protein mCherry and superoxide dismutase (SOD) are expressed together in fusion. SOD was fused to the carboxy terminus of fluorescent protein mCherry by both genetic modification means.

EXAMPLE 1 preparation of the hollow shell of the nanoreactor vessel

In this example two nanoreaction vessels are provided, labeled vessel 1 and vessel 2, respectively.

Container 1: the capsid component comprises capsid proteins csoS1 and csoS4A/B.

The specific operation steps are as follows:

synthesizing coding genes of capsid proteins csoS1 (PMM 0549) and csoS4A/B (PMM 0554/PM 0555) of model strain marine protogreen algae (Prochlorococcus MED) (NC_ 005072.1), wherein the related gene distribution of the model strain marine protogreen algae is shown in figure 1; the synthesized gene fragment is guided into an engineering prokaryotic expression vector pETDuet-1 through a molecular cloning means to construct a prokaryotic expression vector pETDuet-ProCB3. Meanwhile, a His-Tag tagged capsid related protein csoS2 (PMM 0552) gene fragment was constructed, and the prokaryotic expression vector was pCDFDuet-6His-csoS2. The two plasmids pETDuet-1 and pETDuet-ProCB3 are co-transferred into E.coli, related components are soluble and co-expressed, and self-assembly occurs, so that a nano reaction vessel 1 with a certain size is formed. A schematic diagram of the vector construction and cotransformation is shown in FIG. 2A. The primers required for vector construction were as follows:

F-csoS2：catgccatgggttcaacaaaaacaagtagagag

R1-csoS2-L：tttggatccttaacttcctcctcctccagaaccaccaccacctcttgcaccacctg

R2-csoS2-L：tttggatccttaatgatgatgatgatgatgacttcctcctcctccag

After co-transferring the two plasmids into E.coli, plating and growing for 18h, picking single colony, and then expanding culture to logarithmic phase (OD ₆₀₀ =0.6 or so), adding inducer 100 μm IPTG into the culture medium, inducing expression for 10h at 25 ℃, collecting the thalli, re-suspending the thalli with Loading buffer (20 mM Tris-HCl,500mM NaCl,10mM imidazole,pH 7.4), ultrasonic crushing or pressure crushing, purifying with 5ml pre-packed nickel column of GE company, washing buffer (20 mM Tris-HCl,500mM NaCl,40mM imidazole,pH 7.4) to wash out the hybrid protein, finally Washing buffer (20 mM Tris-HCl,500mM NaCl,500mM imidazole,pH7.4) to elute the target protein, concentrating, dialyzing overnight, and obtaining purified sample. SDS-PAGE of the samples shows the results of FIG. 3A-1; the Western blotting experiment results of the samples are shown in FIG. 3B-1. As can be seen in FIGS. 3A-1 and 3B-1, each component of the container 1 is effectively expressed in a soluble manner.

The results of observation of the obtained sample by transmission electron microscopy are shown in the left side ProCB3 of fig. 4B. As can be seen from fig. 4B, proCB3 shows that the nano-reaction vessel 1 formed by the expression assembly has a uniform morphology and good dispersibility. Statistical analysis shows that the particle Size of the nano-reaction container 1 is about size=28.06±2.93nm (n=50), namely, the shell proteins csoS1, csoS4A/B, csoS2 can self-assemble into nano-reaction containers of about 28nm, and the statistical result of the Size is shown as ProCB3 in fig. 4C.

Container 2: the shell components comprise shell proteins csoS1, csoS4A/B, shell related protein components csoS2 and csoS1D, and the specific operation is as follows:

as shown in FIG. 1, the synthetic model strain marine protogreen algae (Prochlorococcus MED) (NC_ 005072.1) coat proteins csoS1 (PMM 0549), csoS4A/B (PMM 0554/PM 0555), csoS2 (PMM 0552), and csoS1D (PMM 0547) encode genes, and at the same time, the respective Ribosome Binding Sites (RBSs) are reserved to simulate the expression of the genes in host bacteria; the gene segment synthesized in series is led into an engineering prokaryotic expression vector pETDuet-1 through a molecular cloning means to construct a prokaryotic expression vector pETDuet-ProCB5. Meanwhile, a His-Tag tagged capsid related protein csoS2 (PMM 0552) expression vector was constructed, named pCDFDuet-6His-csoS2. Finally, the two plasmids are co-transferred into E.coli, and related components are soluble and co-expressed and self-assembled to form a nano reaction container 2 with a certain size. A schematic diagram of the vector construction and cotransformation is shown in FIG. 2B. The primer and container 1 required for constructing the csoS2 prokaryotic expression vector serving as the shell-related protein component modified by His-Tag in FIG. 2B. The primers required for constructing the prokaryotic expression vector pETDuet-ProCB5 are as follows:

H-csoS2-F:ttggtcaaaaggactaaacaatttttattggagaaag

H-csoS2-R:ttgcaaataagcatgatttaacctcttgcaccacctg

LP-ProCB-F:ttagtccttttgaccaaggaaatcgcc

LP-ProCB-R:atcatgcttatttgcaaggtattgaaaccac

After co-transferring the two plasmids into E.coli, plating and growing for 18h, picking single colony, and then expanding culture to logarithmic phase (OD ₆₀₀ =about 0.6), 200 μm IPTG as an inducer was added to the medium, and expression was induced at 20 ℃ for 16h. Then, the bacterial cells were collected, resuspended in Loading buffer (20 mM Tris-HCl,500mM NaCl,30mM imidazole,pH 8.0), sonicated or pressure-broken, purified using 5ml pre-packed nickel column from GE company, washing buffer (20 mM Tris-HCl,500mM NaCl,100mM imidazole,pH8.0) to wash out the heterologous protein, and finally Washing buffer (20 mM Tris-HCl,500mM NaCl,1M imidazole,pH 8.0) to elute out the target protein, and after concentration, dialyzed overnight to obtain the purified sample. SDS-PAGE of the samples shows the results of FIGS. 3A-2; the Western blotting experiment results of the samples are shown in FIG. 3B-2. As can be seen in FIGS. 3A-2 and 3B-2, the components of container 2 are effectively expressed in a soluble manner.

The results of observation of the above samples by a transmission electron microscope are shown in the right side ProCB5 of fig. 4B. As can be seen from ProCB5 in fig. 4B, the nanoreaction vessel 2 formed by expression assembly has a uniform morphology and good dispersibility. Statistical analysis shows that the particle size of the nano-reaction vessel 2 is about dsize=13.9±1.6nm (n=100), namely, the shell proteins csoS1, csoS4A/B, csoS1D, csoS2 can self-assemble into nano-reaction vessels of about 14nm, and the dimension statistical result is shown as ProCB5 in fig. 4C.

Example 2 Synthesis of a nanoreaction vessel for packaging exogenous cargo molecule mCherry-SOD

In this example, the application of the nano-reaction container to package the foreign cargo molecule mCherry-SOD is provided. In this case, the container 2 of example 1 is taken as an example.

In order to ensure that the nano-reaction container can better package exogenous cargo molecules, a ribulose-1, 5-bisphosphate carboxylase (RuBisCO) large subunit is introduced into the nano-reaction container and used as a connecting molecule to connect exogenous cargo molecules. The nanometer reaction container packages exogenous cargo molecules into the inner cavity of the constructed and synthesized nanometer reaction container through ribulose-1, 5-biphosphate carboxylase large subunit.

The exogenous cargo molecule can be involved in the fixation and conversion of CO ₂ Ribulose-1, 5-bisphosphate carboxylase RuBisCO @ _EC _4.1.1.39 ) Carbonic anhydrase csoSCA @ _EC _4.2.1.1 ) Or there are Pdu enzymatic reaction components participating in the metabolic process of 1, 2-propanediol and Eut enzymatic reaction multienzyme components participating in the metabolic pathway of ethanolamine, such as PduCDE _EC _4.2.1.28 )、PduP( _EC1.2.1.3 ) And EutT (E) _C _2.5.1.17 )、EutD( _EC _2.3.1.8 )、EutG( _EC _1.1.1.1 ) Etc., or substances having a remarkable effect on the human body or cells, such as ribulose-1, 5-bisphosphate (RuBP), cobalamin, reduced coenzyme I (NADH), reduced coenzyme II (NADPH), catalase [ ], analogues of cyanocobtype vitamin B12 _EC _1.11.1.6 CAT), superoxide dismutase _EC _1.15.1.1 SOD), etc., are either specific metabolic intermediates in certain bacterial specific metabolic processes or are certain enzymatically reactive molecular components that are sensitive to oxygen concentration or redox. Wherein superoxide dismutase (SOD) is a type of metalloenzyme which exists in living body and can effectively remove superoxide radical, and is present in the bodyIn all organisms of oxygen respiration, recent researches show that the cause, occurrence and development of a plurality of diseases are closely related to the metabolic disorder of the free radicals of the organisms, while SOD is a main protective enzyme capable of timely scavenging superoxide radicals in the organisms, so that the SOD plays an increasingly important role in preventing and treating certain diseases caused by oxygen radical injury, such as tumors, diabetes, cardiovascular diseases, various skin diseases and the like. Although the current methods and sources for obtaining SOD in vitro are many, the in vitro preservation is always a problem to be solved because of the poor oxidation-reduction sensitivity, especially the poor thermal stability. For this reason, we tried to package exogenous cargo molecule superoxide dismutase (SOD) in an in vivo self-assembly process using the nanoreaction vessel we constructed, and further verify its in vitro thermal stability. The method comprises the following steps:

The related genes of the capsid proteins csoS1, csoS4A/B, the capsid related protein csoS2 and the csoS1D protein which maintain stable structures in the model strain marine protogreen algae (Prochlorococcus MED) are synthesized in series in vitro, and after sequencing and comparison are correct, conventional cloning is carried out to obtain the amplified product. The amplified product was introduced into the engineered prokaryotic expression vector pETDuet-1 in the form of a gene cluster to construct the vector plasmid pETDuet-ProCB5. Wherein, the designed primer is as follows:

ProCB-F：gctctagaaagttaatttaatagaaaaaaaagaaccctaatc

ProCB-R：ataagaatgcggccgcttaattagattcccagtaatc

H-csoS2-F ttggtcaaaaggactaaacaatttttattggagaaag (same as in example 1)

H-csoS2-R ttgcaaataagcatgatttaacctcttgcaccacctg (same as in example 1)

LP-pETDuet-F:ttagtccttttgaccaaggaaatcgcc

LP-pETDuet-R:atcatgcttatttgcaaggtattgaaaccac

The method comprises the following specific steps: and (3) taking the Prochlorococcus marinus subsp.MED4 coding nanometer reaction vessel empty shell related component csoS1-csoS4A/B-csoS2-csoS1D obtained by synthesis as a template, performing PCR amplification by using primers ProCB-F and ProCB-R, amplifying a gene fragment A of csoS1-csoS4A/B-csoS2-csoS1D with tandem gene clusters distributed under the same operon, and recovering and purifying. The competent cell BL21 (DE 3) was transformed by double-restriction of XbaI and NotI into fragment A, and ligating it with the pETDuet vector after double-restriction of XbaI and NotI using T4 ligase at 4℃overnight to obtain plasmid pETDuet-ProCB5.

Taking the constructed plasmid pETDuet-ProCB5 as a template, and carrying out PCR amplification by using primers LP-pETDuet-F and LP-pETDuet-R to obtain an amplification product B; amplifying by using a primer H-csoS2-F/R to obtain a gene sequence for encoding 6His-csoS2, and recovering by gel to obtain an amplified product C. The amplified product B and the amplified product C were ligated by using a homologous recombinase kit (ClonExpress Entry One Step Cloning Kit) from Vazyme Biotech company, transferred into competent cells BL21 (DE 3), plated for 18h, and single colonies were picked up, which were BL21 expression strains containing the expression vector pETDuet-ProCB5-6His-csoS 2.

An expression vector pCDFDuet-cbbl-mCherry-SOD and pCDFDuet-mCherry (as a control) capable of expressing an exogenous cargo molecule was constructed. The specific method comprises the following steps: first, a cbbl @ was synthesized _PMM0550 )、mCherry( _MK046076 ) The gene sequence of I and superoxide dismutase (SOD, genebank-D13387.1), the primer H-cbbl-mCherry-SOD-F/R (mCherry-F/R) is used for amplification to obtain a single fragment sequence of cbbl-mCherry-SOD/mCherry, then the primer H-pCDFDuet-F/R is used for amplification of pCDFDuet-1 to obtain a plasmid template, the plasmid template is connected overnight by using a homologous recombinase kit (ClonExpress Entry One Step Cloning Kit) of Biotech company, BL21 (DE 3) is transformed, single colony is picked up, and an engineering vector pCDFDuet-cbbl-mCherry-SOD/DFDuet-mCherry for stably expressing the cbbl-mCherry is obtained by sequencing. The schematic of vector construction is shown in FIG. 5A. Wherein, the primer sequences used are as follows:

H-cbbl-mCherry-SOD-F:aggagatataccatgggcatgagtaagaagtatgac

H-cbbl-mCherry-SOD-R:agctcgaattcggatcctcaggcgcccttgtagatc

mCherry-F:tttctcgagttatcgtctggcattgtcaggc

mCherry-R:tttggatccggaggaggaggaagtggtggaggtggaagcagtg

LP-pCDFDuet-F:gcccatggtatatctccttattaaag

LP-pCDFDuet-R:ggatccgaattcgagctcgg

The two constructed vectors pETDuet-ProCB5-6His-csoS2 and pCDFDuet-cbbl-mCherry-SOD/pCDFDuet-mCherry are respectively co-transferred into escherichia coli BL21 (DE 3), a resistance screening plate is coated, the plates are cultured overnight at 37 ℃, and the single colony is selected to obtain an expression strain for stably expressing the two plasmids, and is also a functional nano reaction container which can be stably expressed and formed by orderly self-assembly. Then inoculating the strain into 5ml of fresh LB culture medium again, shaking the strain to about the logarithmic phase OD600 = 0.6 at 37 ℃, adding an inducer IPTG = 0.5mM concentration, and inducing at 20 ℃ overnight; the following day, cells were collected, and 1ml of cells were purified using 1xPBS (KH ₂ PO ₄ 2mM，Na ₂ HPO ₄ 8mM,NaCl 136mM,KCl 2.6mM,pH 7.4) repeatedly cleaning for three times, adding 100ul of 1xPBS, re-suspending, adding 50ul of 80% (volume ratio) glycerol, uniformly mixing, taking 2ul of the mixture, dripping the mixture onto a pre-cleaned glass slide, adding a cover glass, and preserving the glass slide at 4 ℃ in a dark place. Then fluorescence imaging analysis is carried out on the packaged exogenous cargo molecule cbbl-mCherry-SOD/mCherry by using a Nikon two-photon confocal microscope; wherein the experimental construction is shown in fig. 5A; the experimental results are shown in FIG. 5B.

As can be seen from fig. 5B, when the self-assembled component of the nonfunctional nano-reaction vessel is expressed (-ProCB 5/+procb5), the fluorescent protein mCherry is uniformly distributed in cytoplasm, and no polarization phenomenon exists, but when the related components of the functional nano-reaction vessel are contained, along with the self-assembly formation of the nano-reaction vessel, the nano-reaction vessel can be packaged and fused with mCherry-SOD expressed at the C-terminal end of the cbbl gene according to the interaction with the large subunit cbbl of ribulose-1, 5-bisphosphate carboxylase, and finally the exogenous cargo molecule mCherry-SOD is packaged into the empty shell of the nano-reaction vessel formed by self-assembly, so that obvious single polarization or dual polarization phenomenon exists in the cell. The reason is that the empty shell of the self-assembled nano reaction container is packed into the inner cavity of the self-assembled nano reaction container, so that the empty shell is aggregated in the inner cavity of the nano reaction container in high density, polarization phenomenon occurs, and the fluorescence intensity is obviously weakened, thereby proving that the nano reaction container constructed by the application can pack exogenous cargo molecules mCherry-SOD.

In order to verify that the nano reaction container for self-assembling and packaging mCherry-SOD in vivo has the effect of protecting superoxide dismutase (SOD) and improving the stability of the SOD, we try to place the nano container obtained by in vitro purification at 80 ℃ in water bath for different time treatment, and measure the enzyme activity change of the modified SOD and free SOD by using a classical pyrogallol autoxidation method; the method comprises the following specific steps: purifying to obtain nanometer empty shell containing superoxide dismutase (SOD) and purifying to obtain free SOD enzyme, weighing 0.1g (accuracy is 0.001 g), and placing into the following reaction system: 50mM phosphate buffer, pH8.0, 50mM pyrogallol, 1mM EDTA-disodium salt, two superoxide dismutase (SOD) types were measured at 25℃as the starting enzyme activities, and the changes in enzyme activities after treatment in a water bath environment at 80℃for various times were measured, and the results are shown in FIG. 5C. For free SOD enzyme, the enzyme activity is rapidly reduced to less than 40% after the free SOD enzyme is treated in a water bath at 80 ℃ for 10min, compared with the free SOD, the free SOD enzyme can be effectively packaged into the empty shell of the nano reaction container, and the empty shell of the nano container has certain substrate selectivity and can also serve as a physical barrier to prevent free oxygen molecules from contacting with the SOD, so that the enzyme activity of the SOD enzyme packaged into the nano container can be maintained to be more than 50% even after 50min of heat treatment. Therefore, the nano container can be used as a protective agent of sensitive enzyme molecules, and the stability of the nano container is improved.

Example 3 nanoreactor Synthesis to catalyze Metabolic reactions of volatile 1, 2-propanediol

1, 2-propanediol is a metabolic intermediate with obvious volatility and obvious toxicity to bacterial growth process, wild type 1, 2-propanediol resistant strain usually converts 1, 2-propanediol into propanal by a double enzyme component, namely glycol dehydratase firstly, and then propanal is converted into propionyl CoA by one step by using propanal dehydrogenase and reducing CoA, wherein propionyl CoA is a common intermediate in bacterial metabolic process and can be safely released into bacterial cytoplasm to participate in related metabolic process; this example is accomplished by combining the presence of a Pdu enzymatic reaction system component involved in the metabolic process of 1, 2-propanediol with Salmonella (Salmonella enterica) in vivo,not only coenzyme B12 dependent glycol dehydratase-PduCDE _EC _4.2.1.28 ) And NAD ⁺ Dependent propanal dehydrogenase-PduP _EC1.2.1.3 ) The double components are connected to the large subunit cbbl of ribulose-1, 5-bisphosphate carboxylase, and then the components of the enzymatic reaction system are packaged in a hollow shell by the nano reaction container synthesized in the bacterial body described in the embodiment, so that the nano reaction container participating in the metabolic process of the volatile metabolic intermediate 1, 2-propanediol can be synthesized in engineering bacteria E.coli; the method utilizes the nano reaction container to provide a protein protection empty shell, thereby avoiding the loss of volatile metabolites, reducing the toxic effect on bacteria, effectively increasing carbon sources required by the growth of bacteria, promoting the growth and metabolism of bacteria, and providing a new way for realizing the functional transformation of escherichia coli (the schematic diagram is shown in figure 6A):

The specific operation process is as follows: first, coding sequences of a double enzyme component PduCDE (GeneID: 1253561-3) and a PduP (GeneID: 1253572) coding for a 1, 2-propanediol metabolic process are artificially synthesized, a single fragment sequence of the PduCDE-P is amplified by using a primer H-PduCDE-P-F/R, then pCDFDuet-cbbl is amplified by using a primer H-pCDFDuet-F/R to obtain a plasmid template, the plasmid template is connected overnight by using a homologous recombinase kit (ClonExpress Entry One Step Cloning Kit) of Biotech company, BL21 (DE 3) is transformed, single colonies are picked, and an engineering vector pCDFDuet-cbbl-PduCDE-P which stably expresses the PduCDE-P is obtained by sequencing. Wherein, the primer sequences used are as follows:

LP-pCDFDuet-F: gcccatggtatatctccttattaaag (same as in example 2)

LP-pCDFDuet-R ggatccgaattcgagctcgg (same as in example 2)

LP-PduCDE-P-F:aaggagatataccatgggcatgagatcgaaaagatttg

LP-PduCDE-P-R:agctcgaattcggatccttagcgaatagaaaagccg

The two constructed vectors pETDuet-ProCB5-6His-csoS2 and pCDFDuet-cbbl-PduCDE-P are co-transferred into escherichia coli BL21 (DE 3), coated with a resistance screening plate, cultured overnight at 37 ℃, and the next day, a single colony is selected to obtain an expression strain which stably expresses the two plasmids, and is also a functional nano reaction vessel which can stably express and generate catalytic conversion volatile metabolite 1, 2-propanediol formed by ordered self-assembly.

In order to verify the function of the nano reaction container for packaging the 1, 2-propylene glycol enzymatic reaction system, the function of converting and degrading toxic metabolic intermediate 1, 2-propylene glycol can be obtained by measuring the change of the growth curve of the expression strain of the functional nano reaction container under basic culture rich in 1, 2-propylene glycol. The specific operation process is that the functional nanometer reaction vessel expression strain which can stably express and orderly self-assemble to form the catalytic conversion volatile metabolite 1, 2-propanediol, the wild type BL21 (DE 3) strain, and a basic culture medium (50 mM propanol, 5mM MgSO4, 150mM VB12,0.5mM essential amino acid and the like) rich in 1, 2-propanediol and an LB culture medium are selected as a control, are cultured at 37 ℃ overnight, and the growth curves of the functional nanometer reaction vessel expression strain are respectively measured, and the result is shown in figure 6B.

In fig. 6B, wild-type-LB: representing the wild-type strain BL21 (DE 3), cultured overnight with enrichment medium LB. The bacteria grow well; wild-type-base: representing the wild type strain BL21 (DE 3), using a basic culture medium rich in propylene glycol for overnight culture, wherein the bacterial growth is obviously inhibited and almost stopped due to toxicity of propylene glycol and non-degradation of the wild type strain; container-base: representative expression functional nanocapsules comprising a 1, 2-propanediol metabolic process were cultured overnight in a basal medium enriched with propanediol. As shown in the experimental result of FIG. 6B, the functional nano-container has the capability of converting and degrading the toxic substances, so that the bacteria grow again after a short time adaptation, and the nano-reaction container synthesized in the bacteria has the capability of converting 1, 2-propanediol.

Example 4 nanoreactor Synthesis to catalyze Metabolic reactions of volatile Ethanolamine

Ethanolamine is also a volatile metabolic intermediate, and a specific catalytic process formed in certain bacteria such as E.coli or Salmonella, can survive in media containing only ethanolamine as the sole carbon and nitrogen source. The whole process is similar to the above description in the metabolic process of 1, 2-propanediol in salmonella, and through the enzymatic reactions, the release loss of volatile gas acetaldehyde and the toxic influence on cell metabolism are reduced, meanwhile, bacteria are promoted to continue growing in a barren environment, and most importantly, the bacteria can be promoted to adapt to different environments better by adding the source of the NDAH metabolic pathway into cytoplasm. It is thus the case that this example attempted to encode an alcohol dehydrogenase (EutABC, geneID: 1253979-81) -which catalyzes the conversion of ethanolamine to acetaldehyde; and encodes acetaldehyde dehydrogenase (EutE, geneID: 1253985) -a double enzyme component capable of catalyzing acetaldehyde to produce acetyl-CoA, packaging into the cavity of the nano-reaction container constructed as above, and performing functional verification to obtain a functional nano-reaction container capable of catalyzing ethanolamine metabolism and promoting bacterial growth, wherein the design schematic diagram is shown in fig. 7A;

The experimental design method is the same as the construction of a functional nano container for packaging the 1, 2-propylene glycol metabolic process, the carrier construction steps are the same as above, and the primers used in the experiment are as follows:

LP-pCDFDuet-F: gcccatggtatatctccttattaaag (same as in example 2)

LP-pCDFDuet-R ggatccgaattcgagctcgg (same as in example 2)

LP-EutABC-E-F:aaggagatataccatgggcatgaacactcgccagctac

LP-EutABC-E-R:agctcgaattcggatccttatacaatgcgaaacgc

Through similar functional verification, the growth trend analysis of the wild type escherichia coli strain and the modified strain containing the constructed synthetic functional nano-reaction container is known by utilizing the enrichment medium LB and the basic medium which only contains a small amount of growth factors necessary for bacterial growth and contains ethanolamine hydrochloride and sodium succinate (pH adjustment): only engineered strains in nanoreaction vessels containing ethanolamine metabolic reactions can grow normally in barren ethanolamine-containing basal media. The specific experimental results are shown in fig. 7B. The experimental result shown in fig. 7B proves that the empty shell of the nano reaction container can effectively pack the enzymatic cascade reaction system, and the adaptation capability of the modified strain is effectively enhanced by providing a relatively stable and selective permeable ion molecule and isolating the corresponding volatile gas molecule release mode, so that a new idea is provided for realizing the diversified application of the engineering strain such as escherichia coli.

Example 5 nanoreactor Synthesis to protect anaerobic reaction Process in aerobic bacteria

In nature, denitrification is the main way for nitrogen to return to the atmosphere again, and plays an important role in the environmental treatment of soil, water and sewage, especially in the denitrification repair of aquaculture water. Denitrification is also known as denitrification or nitrate respiration, i.e. the reduction of nitrate or nitrite to gaseous nitrides (mainly N ₂ A small amount is N ₂ O) process. The denitrification process mainly comprises four reactions of NO ₃ ^- →NO ₂ ^- →NO→N ₂ O→N ₂ The four-step reaction bacteria are respectively completed by four enzymes of nitrate reductase, nitrite reductase, nitric oxide reductase and nitrous oxide reductase. Among them, nitrate reductase (NAR) is a rate-limiting enzyme, a membrane-bound nitrate reductase protein, sensitive to inhibition by oxygen molecules, preferentially expressed under anaerobic conditions and acting only in anaerobic conditions, however, its large-scale and high-efficiency application in the field of biological denitrification is limited due to the slow growth rate of anaerobic bacteria. To this end, we have attempted to catalyze nitrate reductase processes that can only be performed in anaerobic environments, namely catalyzing NO ₃ ^- →NO ₂ ^- The transition process is shifted into a nano reaction container cavity with anaerobic and oxygen isolation capability synthesized in the escherichia coli body, and technical exploration is provided for realizing the high-efficiency denitrification biological denitrification process. The idea is to fusion express the gene encoding nitrate reductase (NAR-EC1.6.6.1) at one end of cbbl, to fuse the enzyme into the cavity of the synthetic nano-reaction container in the escherichia coli, and to further verify the growth rate of the nano-reaction container expression strain packaging the enzymatic molecule in the basic culture medium rich in nitrate and the degradation rate of nitrate into nitrite to verify whether the nano-reaction container can effectively provide anaerobic environment and protect the effective progress of the anaerobic enzymatic reaction process.

The specific operation steps are as follows, the experimental design method is the same as the construction of a functional nano container for packaging the 1, 2-propanediol metabolic process, the carrier construction steps are the same as above, and the primers used in the experiment are as follows:

LP-pCDFDuet-F: gcccatggtatatctccttattaaag (same as in example 2)

LP-pCDFDuet-R ggatccgaattcgagctcgg (same as in example 2)

LP-NAR-F:aaggagatataccatgagtaacggcattgtg

LP-NAR-R:agctcgaattcggatccctacatcggcaatgttttc

Through similar functional verification, the basic culture medium which contains a small amount of growth factors necessary for bacterial growth and is also rich in nitrate substances is utilized, and the analysis of the growth trend and the degradation proportion of the nitrate substances of the transformed strain containing the constructed synthetic functional nano reaction container is known. The specific experimental results are shown in fig. 8. Under the static culture condition, the bacterial strain enters a logarithmic phase after 4 hours after inoculation, and enters a decay phase after about 20 hours. The initial nitrite in the culture medium is completely degraded in about 10 hours, and the nitrite added in 20 hours is completely degraded in 36 hours, which proves that the strain packed with the functional nano container has stronger denitrification capability in each growth period. The experimental results shown in fig. 8 prove that the empty shell of the nano reaction container can effectively protect the anaerobic enzymatic reaction, and the strict anaerobic reaction in the aerobic bacteria body can be effectively carried out by providing a relatively stable, anaerobic and oxygen-isolated microenvironment. And a new idea is provided for realizing the diversified application of the engineering strain of the escherichia coli.

The nano reaction container provided by the application can be efficiently expressed and self-assembled into nano empty shells with different sizes in a prokaryotic expression system, can be used for effectively packaging exogenous fluorescent protein molecules mCherry through coupling ribulose-1, 5-biphosphate carboxylase (RuBisCO), can be used for effectively catalyzing and generating specific metabolites such as volatile metabolites such as 1, 2-propanediol and ethanolamine or certain active metabolic intermediate metabolites such as NADH (NADH) by coupling related enzymatic reaction systems, can provide a relatively stable anaerobic and oxygen-isolation microenvironment to promote an anaerobic process to be effectively carried out in aerobic bacteria, has stable genetic characteristics, and provides technical support for the application of the functional nano reaction container in the aspects of metabolic engineering and synthetic biology of compounds.

The foregoing description of the preferred embodiments of the application is not intended to be limiting, but rather is to be construed as including any modifications, equivalents, and alternatives falling within the spirit and principles of the application.

Sequence listing

<110> institute of martial arts virus of national academy of sciences

<120> Synthesis and application of novel nanoreaction vessel

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 33

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> F-csoS2

<400> 1

catgccatgg gttcaacaaa aacaagtaga gag 33

<210> 2

<211> 56

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> R1-csoS2-L

<400> 2

tttggatcct taacttcctc ctcctccaga accaccacca cctcttgcac cacctg 56

<210> 3

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> R2-csoS2-L

<400> 3

tttggatcct taatgatgat gatgatgatg acttcctcct cctccag 47

<210> 4

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> H-csoS2-F

<400> 4

ttggtcaaaa ggactaaaca atttttattg gagaaag 37

<210> 5

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> H-csoS2-R

<400> 5

ttgcaaataa gcatgattta acctcttgca ccacctg 37

<210> 6

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-ProCB-F

<400> 6

ttagtccttt tgaccaagga aatcgcc 27

<210> 7

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-ProCB-R

<400> 7

atcatgctta tttgcaaggt attgaaacca c 31

<210> 8

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> ProCB-F

<400> 8

gctctagaaa gttaatttaa tagaaaaaaa agaaccctaa tc 42

<210> 9

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> ProCB-R

<400> 9

ataagaatgc ggccgcttaa ttagattccc agtaatc 37

<210> 10

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-pETDuet-F

<400> 10

ttagtccttt tgaccaagga aatcgcc 27

<210> 11

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-pETDuet-R

<400> 11

atcatgctta tttgcaaggt attgaaacca c 31

<210> 12

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> H-cbbl-mCherry-SOD-F

<400> 12

aggagatata ccatgggcat gagtaagaag tatgac 36

<210> 13

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> H-cbbl-mCherry-SOD-R

<400> 13

agctcgaatt cggatcctca ggcgcccttg tagatc 36

<210> 14

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mCherry-F

<400> 14

tttctcgagt tatcgtctgg cattgtcagg c 31

<210> 15

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mCherry-R

<400> 15

tttggatccg gaggaggagg aagtggtgga ggtggaagca gtg 43

<210> 16

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-pCDFDuet-F

<400> 16

gcccatggta tatctcctta ttaaag 26

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-pCDFDuet-R

<400> 17

ggatccgaat tcgagctcgg 20

<210> 18

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-PduCDE-P-F

<400> 18

aaggagatat accatgggca tgagatcgaa aagatttg 38

<210> 19

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-PduCDE-P-R

<400> 19

agctcgaatt cggatcctta gcgaatagaa aagccg 36

<210> 20

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-EutABC-E-F

<400> 20

aaggagatat accatgggca tgaacactcg ccagctac 38

<210> 21

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP- EutABC-E-R

<400> 21

agctcgaatt cggatcctta tacaatgcga aacgc 35

<210> 22

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP-NAR-F

<400> 22

aaggagatat accatgagta acggcattgt g 31

<210> 23

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> LP- NAR-R

<400> 23

agctcgaatt cggatcccta catcggcaat gttttc 36

Claims

1. A nanoreaction vessel comprising shell proteins csoS1 and csoS4A/B capable of forming a nanoreaction vessel;

also included are capsid related protein csoS2 and csoS1D protein that maintains the capsid stabilizing structure;

Also comprises RuBisCO, a ribulose-1, 5-bisphosphate carboxylase;

further comprises: one or more of exogenous cargo molecule mCherry-SOD, pdu enzymatic reaction system component, ethanolamine metabolism double enzyme component and nitrate reductase;

the nanometer reaction container is a functional nanometer reaction container synthesized in vitro;

the components of the nanometer reaction container are derived from model strain marine protogreen chlorella strainProchlorococcus MED4。

2. The nanoreaction vessel of claim 1, wherein the Pdu enzymatic reaction system components comprise coenzyme B12-dependent diol dehydratase Pdu cde and NAD ⁺ A dependent propanal dehydrogenase PduP; the ethanolamine-metabolizing dual enzyme component includes an alcohol dehydrogenase and an acetaldehyde dehydrogenase.

3. An expression vector capable of expressing the nanoreaction vessel of claim 1 or 2.

4. An expression system comprising the expression vector of claim 3;

the expression system is an escherichia coli expression system.

5. The method for preparing a nanoreaction vessel as claimed in claim 1 or 2, wherein the preparation step comprises: and introducing the genes contained in the nano reaction container into an expression vector and/or an expression system for expression through gene recombination.

6. The use of the nanoreaction vessel according to claim 1 or 2, and/or the expression vector according to claim 3, and/or the expression system according to claim 4, and/or the nanoreaction vessel prepared by the preparation method according to claim 5, for catalyzing a 1, 2-propanediol metabolic reaction, for catalyzing an ethanolamine metabolic reaction, or for protecting an anaerobic reaction in an aerobic cell.