CN110438062A - A kind of extraction purification and identification method of moso bamboo shoot high activity mitochondria - Google Patents
A kind of extraction purification and identification method of moso bamboo shoot high activity mitochondria Download PDFInfo
- Publication number
- CN110438062A CN110438062A CN201910707028.1A CN201910707028A CN110438062A CN 110438062 A CN110438062 A CN 110438062A CN 201910707028 A CN201910707028 A CN 201910707028A CN 110438062 A CN110438062 A CN 110438062A
- Authority
- CN
- China
- Prior art keywords
- mitochondria
- moso bamboo
- bamboo shoot
- gene
- centrifugation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/04—Plant cells or tissues
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the extraction purifications and identification method of a kind of moso bamboo shoot high activity mitochondria.The present invention provides a kind of method for extracting moso bamboo shoot mitochondria, include the following steps: for moso bamboo shoot to be successively homogenized, differential centrifugation and sucrose density gradient centrifugation are to get to purified mitochondria；The differential centrifugation is followed successively by 1300-1700g, 5000-7000g and 12000-15000g using centrifugal force.Method of the invention is small to the damage of mitochondria, the mitochondria activity of extraction is high, it is more thorough to the nuclear components other than mitochondria, the separation such as chloroplaset or proplastid component, phenols and polysaccharide, and the mitochondrial RNA (mt RNA) that can extract from the mitochondria of purifying to high quality, this is to subsequent molecular biology experiment, such as PCR reaction, cDNA library construct, the research of mitochondria transcript profile is had laid a good foundation.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of extraction purification of moso bamboo shoot high activity mitochondria and identification
Method.
Background technique
Moso bamboo is the most wide bamboo kind of China's cultivated area, and because the speed of growth is fast, yield is high, and mechanical property is good and deep by blueness
It looks at.Moso bamboo shoot is the young of moso bamboo, and bamboo shoots growth is the initial stage of Bamboo Growth and the important base that moso bamboo fast-growing is become a useful person
Plinth.Moso bamboo shoot is in the dormant stage in winter, and bamboo shoot body is little, is embedded in soil, grows up rapidly after the beginning of spring, breaks through the soil, big
The morphological features such as small, color are substantially change.This fast-growth change procedure of moso bamboo shoot needs a large amount of energy branch
It holds, and the main place of important organelle and ATP intracellular generation that mitochondria is metabolized as plant energy i (in vivo), in the process
Undoubtedly carry critical effect.Therefore, the moso bamboo shoot mitochondria for extracting high activity, high-purity breaks research moso bamboo shoot
Suspend mode, the energetic supersession regulatory mechanism for starting fast-growth are most important.
Currently, it is thin in humans and animals tissue to focus mostly on to the research of mitochondria extraction and related breathing metabolism, energetic supersession
It is less to the research of vegetable material in born of the same parents.And from existing research method, the isolated mitochondria overwhelming majority is thick
The mitochondria of extraction, containing nucleus is come from, the pollution of chloroplaset or proplastid etc., this brings follow-up study very big dry
It disturbs.Mitochondria includes itself distinctive genome and hereditary information as organelle relatively independent in plant cell.Therefore,
The mitochondria for isolating and purifying and identifying high activity, high-purity, the extraction to mitochondrial RNA (mt RNA), the building of cDNA library and from transcription
Level research mitochondrial mechanism is very necessary, and is directed to moso bamboo shoot high activity mitochondria extraction purification at this stage
And the method for identification does not have been reported that also.
Summary of the invention
In order to improve a kind of method for extraction and purification of moso bamboo shoot high activity high pure mitochondria, the present invention provides following technology
Scheme:
A purpose of the invention is to provide a kind of method for extracting moso bamboo shoot mitochondria.
Method provided by the invention includes the following steps: for moso bamboo shoot to be successively homogenized, differential centrifugation and sucrose density
Gradient centrifugation to get arrive purified mitochondria；
The differential centrifugation is followed successively by 1300-1700g, 5000-7000g and 12000-15000g using centrifugal force.
In the above method, the differential centrifugation includes the following steps:
1) filtrate elder generation 1300-1700g is centrifuged 5-15min after filtering, and collects supernatant；
2) the supernatant 5000-7000g for again collecting the step 1) is centrifuged 10-15min, collects supernatant；
3) the supernatant 12000-15000g for again collecting the step 2) is centrifuged 10-15min, collects precipitating, obtains thick
Mention mitochondria.
Above-mentioned homogenate is to mix moso bamboo shoot and grinding buffer solution (according to the ratio of every 200mL grinding buffer solution 150g sample
Example), it is protected from light and is placed in 4 DEG C of refrigerator overnights, then be homogenized, obtain slurries；
Above-mentioned homogenization conditions are revolving speed 18000r/min, time 2min, and during which every booting 5s suspends 3s.
Wherein, grinding buffer solution formula: 1.25M NaCl, 0.3M sucrose, 50mM Tris-HCl, 5mM EDTA, 2mM
EGTA, 0.5%PVP-40,0.5%BSA, 15mM beta -mercaptoethanol, PH are adjusted to 8.0.
In the above method, the differential centrifugation includes the following steps:
1) filtrate elder generation 1500g is centrifuged 5-15min after filtering, and collects supernatant；
2) the supernatant 6000g for again collecting the step 1) is centrifuged 10-15min, collects supernatant；
3) the supernatant 15000g for again collecting the step 2) is centrifuged 10-15min, collects precipitating, is slightly mentioned line grain
Body；
Or, the step 1) and the step 2) repeat 2-3 times.
Or, further including filtering the product of the homogenate between the homogenate and the differential centrifugation, filtrate is collected
Step.
It is above-mentioned be filtered into will the obtained slurries of homogenate using sterilized double layer filtered through gauze twice, collect filtrate for the later period from
The heart.
In the above method, the sucrose density gradient centrifugation includes the following steps: to suspend the mitochondria that slightly mentions, and obtains
Slightly propose mitochondrial suspension；40% sucrose solution of quality volumn concentration, quality volume hundred are sequentially added into centrifuge tube again
Divide 23% sucrose solution of content and the thick mitochondrial suspension to carry out sucrose density gradient centrifugation, collects molten in 23% sucrose
The solution (upper and lower two layers of mitochondria solution) of boundary layer, the mitochondria being layered after purification above and below liquid；
The condition of the sucrose density gradient centrifugation are as follows: 20,000g is centrifuged 40-50min.
The buffer used suspend as washing buffer；Washing buffer formula of liquid: 0.35M sucrose, 50mM Tris-HCl,
25mM EDTA, PH are adjusted to 8.0.MTE buffer formulation: 400mM mannitol, 50mM Tris-HCl, 20mM EDTA, MTE buffering
Liquid solvent is distilled water, and PH is adjusted to 8.0.
The solvent of 40% and 23% sucrose solution is MTE buffer.MTE buffer formulation: 400mM mannitol, 50mM
Tris-HCl, 20mM EDTA, PH are adjusted to 8.0.
Further include following steps after the sucrose density gradient centrifugation in the above method: by the sucrose density gradient from
The mitochondria being layered after purification that the heart is collected is centrifuged 15-25min through 18,000g, collects precipitating, obtains purified mitochondria.
In the above method, the centrifugation is low-temperature centrifugation.
Each step carries out under cryogenic in the above method.
Another object of the present invention is to provide a kind of method for preparing moso bamboo shoot mitochondria active and that purifying is high.
Method provided by the invention, includes the following steps:
1) method of said extracted purifying moso bamboo shoot mitochondria, obtains purified mitochondria；
2) purified mitochondria is therefrom chosen by mitochondria dyeing identification and the amplification identification of mitochondria characterizing gene
Mitochondria dyeing colour developing and contain only mitochondrial feature atp8 gene and without containing moso bamboo karyogene or moso bamboo chloroplast gene
Mitochondria is active and with high purity mitochondria.
In the method for above-mentioned second purpose, the mitochondria dyeing is accredited as with janus green B method or Rhodamine 123 method
The purified mitochondria is dyed, the mitochondria of mitochondria dyeing colour developing is chosen；
Or, the mitochondria characterizing gene amplification is accredited as the primer with amplification mitochondria feature atp8 gene, amplification hair
The primer of bamboo karyogene actin and the primer of amplification moso bamboo chloroplast gene spbB carry out PCR to the purified mitochondria respectively
Amplification is chosen and contains only mitochondrial feature atp8 gene and the mitochondria without containing moso bamboo karyogene or moso bamboo chloroplast gene.
In the method for above-mentioned second purpose, the janus green B method is dyed using janus green B dye liquor, the dyeing
Condition is that room temperature dyes 25-35min；In an embodiment of the present invention, room temperature dyes 30min.
Or, the Rhodamine 123 method is dyed using Rhodamine 123 dye liquor, the dyeing condition is 30 DEG C and is protected from light dyeing 4-
6min；In an embodiment of the present invention, it is protected from light dyeing 5min for 30 DEG C.
Janus green B dye liquor is that quality volumn concentration is 0.4% janus green B dye liquor, prepares janus green B dye liquor
Solvent be tap water.
Rhodamine 123 dye liquor is 1mM Rhodamine 123 dye liquor, and the solvent for preparing Rhodamine 123 dye liquor is distilled water.
Or, 2 institute of primer single strand dna as shown in sequence 1 and sequence of the amplification mitochondria feature atp8 gene
The single strand dna composition shown；
Or, shown in the primer single strand dna as shown in sequence 3 and sequence 4 of the amplification moso bamboo karyogene actin
Single strand dna composition；
Or, 6 institute of primer single strand dna as shown in sequence 5 and sequence of the amplification moso bamboo chloroplast gene spbB
The single strand dna composition shown.
It is also the scope of protection of the invention by mitochondria prepared by the above method.
Said extracted moso bamboo shoot mitochondria method is preparing the application in moso bamboo shoot mitochondria active and that purifying is high
It is also the scope of protection of the invention.
Above-mentioned active and with high purity mitochondria is purified mitochondria dyeing colour developing, and PCR detection can only identify
Chondriogen and without the pollution of karyogene and chloroplast gene.
Application of the above-mentioned mitochondria in moso bamboo shoot molecular biology research is also the scope of protection of the invention；Including
Such as PCR reaction, cDNA library building, mitochondria transcript profile.
The present invention is directed to isolates and purifies deficiency existing for the method for mitochondria at present, and lacks further living to mitochondria
Property and the status identified of purity, by change reagent, utilize differential centrifugation, sucrose density gradient centrifugation, adjustment and refinement
Centrifugation number and time, optimization mitochondria activity dye liquor concentration and dyeing time, extraction simultaneously identify mitochondrial RNA (mt RNA) quality, with thin
Born of the same parents device specific gene PCR identifies the processes such as mitochondria purity, provides complete set and is reliably directed to moso bamboo shoot mitochondria
Extraction, purifying, activity identification, the method for Purity.Method of the invention is small to the damage of mitochondria, and the mitochondria of extraction is living
Property it is high, it is more thorough to the nuclear components other than mitochondria, the separation such as chloroplaset or proplastid component, phenols and polysaccharide, and
Can extract the mitochondrial RNA (mt RNA) to high quality from the mitochondria of purifying, this to subsequent molecular biology experiment, as PCR reaction,
CDNA library building, the research of mitochondria transcript profile etc. are had laid a good foundation.The moso bamboo shoot mitochondria obtained through this method is dense
Degree is big, and activity and purity are very high, can effectively remove the pollution of the core component and proplastid component other than mitochondria, extract high-purity
The mitochondrial RNA (mt RNA) of degree, high quality, for the further investigation in terms of moso bamboo shoot mitochondrial respiratory and energetic supersession.
Detailed description of the invention
Fig. 1 is that sucrose density gradient centrifugation purifies winter bamboo shoot mitochondria.
Fig. 2 is the identification of moso bamboo winter bamboo shoot mitochondria activity；(A) the winter bamboo shoot line grain of optical microphotograph sem observation janus green B dyeing
Body；(B) the winter bamboo shoot mitochondria of confocal laser scanning microscope Rhodamine 123 dyeing.
Fig. 3 is moso bamboo winter bamboo shoot mitochondria Purity；(A) the RNA agarose gel electrophoresis figure of winter bamboo shoot and winter bamboo shoot mitochondria；
(B) the organelle-specificity gene of agarose gel electrophoresis detection PCR amplification.
Fig. 4 is that sucrose density gradient centrifugation purifies spring bamboo mitochondria.
Fig. 5 is the identification of spring shoot of Phyllostachys pubescens mitochondria activity；(A) the spring bamboo line grain of optical microphotograph sem observation janus green B dyeing
Body；(B) the spring bamboo mitochondria of confocal laser scanning microscope Rhodamine 123 dyeing.
Fig. 6 is spring shoot of Phyllostachys pubescens mitochondria Purity；(A) the RNA agarose gel electrophoresis figure of spring bamboo and spring bamboo mitochondria.
(B) the organelle-specificity gene of agarose gel electrophoresis detection PCR amplification.
Fig. 7 is the identification of moso bamboo winter bamboo shoot low-purity mitochondria.
Fig. 8 is the identification of spring shoot of Phyllostachys pubescens low-purity mitochondria.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Method therefor is conventional method unless otherwise instructed in following embodiments, and the percent concentration is especially said such as nothing
Bright is mass/volume (W/V) percent concentration.The materials, reagents and the like used in the following examples, unless otherwise specified,
Commercially obtain.Low-temperature centrifugation in following embodiments is centrifuged under the conditions of 4 DEG C such as without temperature is indicated.
The solute and its concentration of following grinding buffer solutions are as follows: 1.25M NaCl, 0.3M sucrose, 50mM Tris-HCl, 5mM
EDTA, 2mM EGTA, 0.5% (for quality than volume, unit is g/mL) PVP-40,0.5% (for quality than volume, unit is g/mL)
BSA, 15mM beta -mercaptoethanol, grinding buffer solution solvent are distilled water, and PH is adjusted to 8.0.
The solute and its concentration of following washing buffers are as follows: 0.35M sucrose, 50mM Tris-HCl, 25mM EDTA, washing
Buffer solvent is distilled water, and PH is adjusted to 8.0.
The preparation method of following 40% sucrose solutions: 40g sucrose is dissolved in 100mL MTE buffer, obtains 40% sugarcane
Sugar juice.
The preparation method of following 23% sucrose solutions: 23g sucrose is dissolved in 100mL MTE buffer, obtains 23% sugarcane
Sugar juice.
Above-mentioned MTE buffer formulation: 400mM mannitol, 50mM Tris-HCl, 20mM EDTA, MTE buffer solvent are
Distilled water, PH are adjusted to 8.0.
It is due to there is cytochrome oxidase in mitochondria with janus green B dye marker mitochondria in following embodiments
System, it makes dyestuff remain the state of oxidation and be in blue-green, and dyestuff is reduced in colourless in peripheral cell matter.Because thin
Born of the same parents' chromo-oxidase is just able to maintain enzyme activity in active mitochondria, therefore janus green B dyes detectable mitochondria and lives
Property.
In following embodiments, with Rhodamine 123 fluorescent marker mitochondria, to detect the membrane potential of mitochondria.Due to having
Active mitochondria has membrane potential and issues fluorescence under the irradiation of laser, therefore Rhodamine 123 fluorescent marker can detecte
Mitochondria activity.
The janus green B dye liquor of quality volumn concentration 0.4%: janus green B (molecular formula: C is taken30H31N6Cl it) is dissolved in
Tap water obtains the dye liquor of 0.4% (g:ml, mass volume ratio).
The Rhodamine 123 dye liquor of 1mM: Rhodamine 123 (molecular formula: C is taken21H17ClN2O3) be dissolved in distilled water and obtain concentration and be
The fluorescence dye liquor of 1mM.
In following embodiments, RNA is extracted to be carried out using the kit of TaKaLa company, and cDNA reversion uses Beijing Quan Shijin
The kit of company carries out.
Embodiment 1, the extraction purification of moso bamboo winter bamboo shoot high activity mitochondria and identification
One, the extraction purification of moso bamboo winter bamboo shoot high activity mitochondria
1, grinding homogenate
Fresh bamboo winter bamboo shoot are peelled off into crust, after cutting off the older part in lower part, remaining winter bamboo shoot are cut into small fourth, are weighed appropriate
Winter bamboo shoot and grinding buffer solution mixing (according to the ratio of every 200mL grinding buffer solution 150g sample), are protected from light and are placed in 4 DEG C of refrigerator mistakes
Night obtains the grinding buffer solution containing sample；
Grinding buffer solution containing sample is poured into high-speed organization grinder be homogenized (revolving speed 18000r/min, when
Between be 2min, during which every booting 5s pause 3s prevents motor overheating), obtain slurries.
Twice, which completes on ice, receives for above-mentioned slurries sterilized double layer gauze (hole size is 1mm × 1mm) filtering
Collect filtrate.
2, differential centrifugation slightly mentions mitochondria
Above-mentioned filtered filtrate is sub-packed in 50mL centrifuge tube, through multiple differential centrifugation (1500g low-temperature centrifugation
5min is repeated twice, and collects supernatant；6000g low-temperature centrifugation 10min, is repeated twice, and collects supernatant；15000g low-temperature centrifugation
After 15min), precipitating is collected, obtains and slightly mentions mitochondria；
Mitochondria slightly is mentioned with the suspension of 10mL washing buffer, obtains thick mitochondrial suspension；
3, discontinuous sucrose density gradient centrifugation purifies mitochondria
It is above-mentioned that 40% sucrose solution of 18ml, 23% sucrose solution of 10ml and 10ml are sequentially added to 38mL thin wall centrifugal tube
Thick mitochondrial suspension after trim, carries out low temperature ultracentrifugation (ultracentrifuge 20,000g are centrifuged 45min at 4 DEG C)；
As a result as shown in Figure 1, collecting the solution in boundary layer above and below 23% sucrose solution, (upper and lower two layers of mitochondria is molten
Liquid, as shown in fig. 1), draw the mitochondria being layered after purification.
4, low temperature ultracentrifugation
The mitochondria being layered after purification that above-mentioned 3 obtain is drawn in new 38mL thin wall centrifugal tube, it is slow to fill it up with washing
Fliud flushing, after trim, low temperature ultracentrifugation (ultracentrifuge 18,000g are centrifuged 20min at 4 DEG C) collects precipitating, obtains purifying line
Plastochondria.
With washing buffer suspension purified mitochondria, purified mitochondria suspension is obtained.
Two, the activity identification of moso bamboo winter bamboo shoot high activity mitochondria
It is high to obtain moso bamboo winter bamboo shoot using following method identification 1) or 2) for the purified mitochondria suspension that above-mentioned one is obtained
Active mitochondria:
1) janus green B method identifies mitochondria activity
By the janus green B dye liquor of quality volumn concentration 0.4% and above-mentioned one obtained purified mitochondria suspension
Mixing, room temperature dye 30min, and optical microphotograph is under the microscope.
As a result as shown in Figure 2 A, apparent blue-green is presented through janus green B dyeing in the mitochondria of high activity.
2) Rhodamine 123 method identifies mitochondria activity
The Rhodamine 123 dye liquor of 1mM is mixed with the purified mitochondria suspension that above-mentioned one obtains, 30 DEG C are protected from light dyeing
5min is observed under laser confocal microscope.
As a result as shown in Figure 2 B, the mitochondria of high activity issues apparent yellow-green fluorescence through Rhodamine 123 dyeing.
Three, mitochondria Purity
The lookup moso bamboo karyogene actin in NCBI, the CDS sequence of chondriogen atp8, chloroplast gene spbB, if
Count specific primer.
Actin-F:ATGGCTGAAGAGGATATCCAG (sequence 3) actin-R:CTAGAAACACTTCATATGGAC (sequence
Column 4)
Atp8-F:ATGCCTCAACTTGATAAATT (sequence 1) atp8-R:TTAGATTATGCTTCCTTGCC (sequence 2)
SpbB-F:ATGGGTTTGCCTTGGTATCGT (sequence 5) spbB-R:TCAGACTGCCTGTCTCCTTGT (sequence
6)
Extract moso bamboo winter bamboo shoot and the above-mentioned one obtained RNA (Fig. 3 A) of purified mitochondria suspension respectively with kit, instead
It is transcribed into cDNA, then using cDNA as template, PCR amplification is carried out to actin, atp8, spbB, and examined with agarose gel electrophoresis
Survey the band of amplification gene.
As a result as shown in Figure 3B, actin (1131bp), atp8 (468bp), spbB are amplified in moso bamboo winter bamboo shoot sample
(1527bp) gene band, and the band of mitochondrial atp8 gene is only expanded in moso bamboo winter bamboo shoot mitochondrial samples after purification
(468bp) shows very thorough to the separation of nucleus, chloroplaset or proplastid etc. in the moso bamboo winter bamboo shoot mitochondria of this method extraction
Bottom has obtained the very high mitochondria of purity.
Comparative example 1:
Under identical experiment operating process, when differential centrifugation is following steps, DNA purity is lower:
Differential centrifugation: 2000g low-temperature centrifugation 10min is repeated twice, and collects supernatant；15000g low-temperature centrifugation 15min is received
Collection precipitating.
The mitochondria purity extracted by PCR method identification, as a result as shown in fig. 7, being amplified in moso bamboo winter bamboo shoot sample
Actin (1131bp), atp8 (468bp), spbB (1527bp) gene band, and moso bamboo winter bamboo shoot mitochondrial samples after purification
In equally amplify actin (1131bp), atp8 (468bp), spbB (1527bp) gene band, show this method extract hair
The separation of nucleus, chloroplaset or proplastid etc. is not thorough in bamboo winter bamboo shoot mitochondria, obtained mitochondria purity is low.
Embodiment 2, the extraction purification of spring shoot of Phyllostachys pubescens high activity mitochondria and identification
One, the extraction purification of spring shoot of Phyllostachys pubescens high activity mitochondria
1, grinding homogenate
Fresh bamboo spring bamboo is peelled off into crust, after cutting off the older part in lower part, remaining spring bamboo is cut into small fourth, is weighed appropriate
Spring bamboo and grinding buffer solution mixing (according to the ratio of every 200mL grinding buffer solution 150g sample), are protected from light and are placed in 4 DEG C of refrigerator mistakes
Night obtains the grinding buffer solution containing sample；
Grinding buffer solution containing sample is poured into high-speed organization grinder and carries out that (revolving speed 18000r/min, time is
2min, during which every booting 5s suspends 3s, prevents motor overheating), twice with sterilized double layer filtered through gauze, the process is on ice for slurries
It completes, collects filtrate；
2, differential centrifugation slightly mentions mitochondria
Filtrate is sub-packed in 50mL centrifuge tube, through multiple differential centrifugation (1500g low-temperature centrifugation 15min, is repeated twice,
Collect supernatant；6000g low-temperature centrifugation 15min, is repeated twice, and collects supernatant；15000g low-temperature centrifugation 15min) after, it is heavy to collect
It forms sediment, obtains and slightly mention mitochondria；
Mitochondria slightly is mentioned with the suspension of 10mL washing buffer, obtains thick mitochondrial suspension；
3, discontinuous sucrose density gradient centrifugation purifies mitochondria
It is above-mentioned that 40% sucrose solution of 18ml, 23% sucrose solution of 10ml and 10ml are sequentially added to 38mL thin wall centrifugal tube
Thick mitochondrial suspension after trim, carries out low temperature ultracentrifugation (ultracentrifuge 20,000g are centrifuged 45min at 4 DEG C)；
As a result as shown in figure 4, drawing the mitochondria being layered after purification.
4, low temperature ultracentrifugation
The mitochondria being layered after purification that above-mentioned 3 obtain is drawn in new 38mL thin wall centrifugal tube, it is slow to fill it up with washing
Fliud flushing, after trim, low temperature ultracentrifugation (ultracentrifuge 18,000g are centrifuged 20min at 4 DEG C) collects precipitating, obtains purifying line
Plastochondria.
With washing buffer suspension purified mitochondria, purified mitochondria suspension is obtained.
Two, the activity identification of spring shoot of Phyllostachys pubescens high activity mitochondria
The purified mitochondria suspension that above-mentioned one is obtained obtains spring shoot of Phyllostachys pubescens height using following method identification 1) or 2)
Active mitochondria:
1) janus green B method identifies mitochondria activity
0.4% janus green B dye liquor is mixed with the purified mitochondria suspension that above-mentioned one obtains, room temperature dyeing
30min, optical microphotograph is under the microscope.
As a result as shown in Figure 5A, apparent blue-green is presented through janus green B dyeing in the mitochondria of high activity.
2) Rhodamine 123 method identifies mitochondria activity
The Rhodamine 123 dye liquor of 1mM is mixed with the purified mitochondria suspension that above-mentioned one obtains, 30 DEG C are protected from light dyeing
5min is observed under laser confocal microscope.
As a result as shown in Figure 5 B, the mitochondria of high activity issues apparent yellow-green fluorescence through Rhodamine 123 dyeing.
Three, mitochondria Purity
The lookup moso bamboo karyogene actin in NCBI, the CDS sequence of chondriogen atp8, chloroplast gene spbB, if
Count specific primer.
Actin-F:ATGGCTGAAGAGGATATCCAG actin-R:CTAGAAACACTTCATATGGAC
Atp8-F:ATGCCTCAACTTGATAAATT atp8-R:TTAGATTATGCTTCCTTGCC
SpbB-F:ATGGGTTTGCCTTGGTATCGT spbB-R:TCAGACTGCCTGTCTCCTTGT
Extract RNA (Fig. 6 A), the reverse transcription cDNA of spring shoot of Phyllostachys pubescens and purified mitochondria suspension respectively with kit, so
Afterwards using cDNA as template, PCR amplification is carried out to actin, atp8, spbB, and detect amplification gene with agarose gel electrophoresis
Band.
As a result as shown in Figure 6B, actin, atp8, spbB gene band are amplified in spring shoot of Phyllostachys pubescens sample, and purifying
The band that mitochondrial atp8 gene is only expanded in spring shoot of Phyllostachys pubescens mitochondrial samples afterwards shows the spring shoot of Phyllostachys pubescens that this method is extracted
It is very thorough to the separation of nucleus, chloroplaset or proplastid etc. in mitochondria, obtain the very high mitochondria of purity.
Comparative example 2:
Under identical experiment operating process, when differential centrifugation is following steps, DNA purity is lower:
Differential centrifugation: 3000g low-temperature centrifugation 10min is repeated twice, and collects supernatant, and 15000g low-temperature centrifugation 15min is received
Collection precipitating.
The mitochondria purity extracted by PCR method identification, as a result as shown in figure 8, being amplified in spring shoot of Phyllostachys pubescens sample
Actin (1131bp), atp8 (468bp), spbB (1527bp) gene band, and moso bamboo winter bamboo shoot mitochondrial samples after purification
In equally amplify actin (1131bp), atp8 (468bp), spbB (1527bp) gene band, show this method extract hair
The separation of nucleus, chloroplaset or proplastid etc. is not thorough in bamboo spring bamboo mitochondria, obtained mitochondria purity is low.
SEQUENCE LISTING
<110>Beijing Forestry University
<120>a kind of extraction purification and identification method of moso bamboo shoot high activity mitochondria
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
atgcctcaac ttgataaatt 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
ttagattatg cttccttgcc 20
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
atggctgaag aggatatcca g 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
ctagaaacac ttcatatgga c 21
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
atgggtttgc cttggtatcg t 21
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<400> 6
tcagactgcc tgtctccttg t 21
Claims (10)
1. a kind of method for extracting moso bamboo shoot mitochondria, include the following steps: for moso bamboo shoot to be successively homogenized, differential centrifugation and
Sucrose density gradient centrifugation to get arrive purified mitochondria；
The differential centrifugation is followed successively by 1300-1700g, 5000-7000g and 12000-15000g using centrifugal force.
2. according to the method described in claim 1, it is characterized by:
The differential centrifugation includes the following steps:
1) filtrate elder generation 1300-1700g is centrifuged 5-15min after filtering, and collects supernatant；
2) the supernatant 5000-7000g for again collecting the step 1) is centrifuged 10-15min, collects supernatant；
3) the supernatant 12000-15000g for again collecting the step 2) is centrifuged 10-15min, collects precipitating, is slightly mentioned line
Plastochondria.
3. according to the method described in claim 2, it is characterized by:
The differential centrifugation includes the following steps:
1) filtrate elder generation 1500g is centrifuged 5-15min after filtering, and collects supernatant；
2) the supernatant 6000g for again collecting the step 1) is centrifuged 10-15min, collects supernatant；
3) the supernatant 15000g for again collecting the step 2) is centrifuged 10-15min, collects precipitating, is slightly mentioned mitochondria；
Or, the step 1) and the step 2) repeat 2-3 times；
Or, further including the step of being filtered the product of the homogenate, collect filtrate between the homogenate and the differential centrifugation.
4. according to the method in claim 2 or 3, it is characterised in that:
The sucrose density gradient centrifugation includes the following steps: to suspend the mitochondria that slightly mentions, and is slightly proposed mitochondria suspension
Liquid；40% sucrose solution of quality volumn concentration, 23% sucrose of quality volumn concentration are sequentially added into centrifuge tube again
Solution and the thick mitochondrial suspension carry out sucrose density gradient centrifugation, collect in boundary layer above and below 23% sucrose solution
Solution, the mitochondria being layered after purification；
The condition of the sucrose density gradient centrifugation are as follows: 20,000g is centrifuged 40-50min.
5. according to the method described in claim 4, it is characterized by:
Further include following steps after the sucrose density gradient centrifugation: dividing what the sucrose density gradient centrifugation was collected after purification
The mitochondria of layer is centrifuged 15-25min through 18,000g, collects precipitating, obtains purified mitochondria.
6. any method in -5 according to claim 1, it is characterised in that:
The centrifugation is low-temperature centrifugation.
7. a kind of method for preparing moso bamboo shoot mitochondria active and that purifying is high, includes the following steps:
1) any the method for claim 1-6, obtains purified mitochondria；
2) purified mitochondria is therefrom chosen into line grain by mitochondria dyeing identification and the amplification identification of mitochondria characterizing gene
Body dyeing develops the color and contains only mitochondrial feature atp8 gene and the line grain without containing moso bamboo karyogene or moso bamboo chloroplast gene
Body is active and with high purity mitochondria.
8. according to the method described in claim 7, it is characterized by:
The mitochondria dyeing, which is accredited as, dyes the purified mitochondria with janus green B method or Rhodamine 123 method, chooses line
The mitochondria of plastochondria dyeing colour developing；
Or, the mitochondria characterizing gene amplification is accredited as the primer with amplification mitochondria feature atp8 gene, amplification moso bamboo core
The primer of gene actin and the primer of amplification moso bamboo chloroplast gene spbB carry out PCR amplification to the purified mitochondria respectively,
It chooses and contains only mitochondrial feature atp8 gene and the mitochondria without containing moso bamboo karyogene or moso bamboo chloroplast gene.
9. according to the method described in claim 8, it is characterized by:
The janus green B method is dyed using janus green B dye liquor, and the dyeing condition is that room temperature dyes 25-35min；
Or, the Rhodamine 123 method is dyed using Rhodamine 123 dye liquor, the dyeing condition is 30 DEG C and is protected from light dyeing 4-6min；
Or, shown in the primer single strand dna as shown in sequence 1 and sequence 2 of the amplification mitochondria feature atp8 gene
Single strand dna composition；
Or, single-stranded shown in the primer single strand dna as shown in sequence 3 and sequence 4 of the amplification moso bamboo karyogene actin
DNA molecular composition；
Or, shown in the primer single strand dna as shown in sequence 5 and sequence 6 of the amplification moso bamboo chloroplast gene spbB
Single strand dna composition.
10. by the mitochondria of any the method preparation of claim 1-9；
Or, any the method for claim 1-6 is preparing the application in moso bamboo shoot mitochondria active and that purifying is high；
Or application of the mitochondria in moso bamboo shoot molecular biology research.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910707028.1A CN110438062B (en) | 2019-08-01 | 2019-08-01 | Method for extracting, purifying and identifying high-activity mitochondria of moso bamboo shoots |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910707028.1A CN110438062B (en) | 2019-08-01 | 2019-08-01 | Method for extracting, purifying and identifying high-activity mitochondria of moso bamboo shoots |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438062A true CN110438062A (en) | 2019-11-12 |
| CN110438062B CN110438062B (en) | 2021-06-01 |
Family
ID=68432862
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910707028.1A Active CN110438062B (en) | 2019-08-01 | 2019-08-01 | Method for extracting, purifying and identifying high-activity mitochondria of moso bamboo shoots |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438062B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996158A (en) * | 2020-07-20 | 2020-11-27 | 北京大学 | Method for efficiently enriching plant mitochondria through protoplast |
| CN112229949A (en) * | 2020-09-24 | 2021-01-15 | 北京林业大学 | Kit and method for determining moso bamboo shoot histiocyte mitochondrial respiration |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063020A (en) * | 2015-09-16 | 2015-11-18 | 陕西省杂交油菜研究中心 | Method for extracting mtDNA (MiTochondrial DeoxyriboNucleic Acid) by virtue of root tissues of rape CMS (Cytoplasmic Male Sterility) system |
| CN105462995A (en) * | 2016-01-14 | 2016-04-06 | 山东省海洋生物研究院 | Barnea dilatata mitochondrial COI gene amplification primer |
| WO2017018382A1 (en) * | 2015-07-24 | 2017-02-02 | ロート製薬株式会社 | Cell evaluation method, high-performance cell or drug screening method, and pharmaceutical composition |
| CN108728396A (en) * | 2018-06-12 | 2018-11-02 | 华中农业大学 | A kind of isolation and purification method of citrus pulp mitochondria |
| US20190022018A1 (en) * | 2017-07-19 | 2019-01-24 | Hangzhou UMotor Biotech Co., LTD. | Biomembrane, Closed Structure with Biomembrane Characteristics or Cellular Compartment Derived from Natural Sources and/or Self-Assembly Techniques, Preparation Method and Applications Thereof |
-
2019
- 2019-08-01 CN CN201910707028.1A patent/CN110438062B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017018382A1 (en) * | 2015-07-24 | 2017-02-02 | ロート製薬株式会社 | Cell evaluation method, high-performance cell or drug screening method, and pharmaceutical composition |
| CN105063020A (en) * | 2015-09-16 | 2015-11-18 | 陕西省杂交油菜研究中心 | Method for extracting mtDNA (MiTochondrial DeoxyriboNucleic Acid) by virtue of root tissues of rape CMS (Cytoplasmic Male Sterility) system |
| CN105462995A (en) * | 2016-01-14 | 2016-04-06 | 山东省海洋生物研究院 | Barnea dilatata mitochondrial COI gene amplification primer |
| US20190022018A1 (en) * | 2017-07-19 | 2019-01-24 | Hangzhou UMotor Biotech Co., LTD. | Biomembrane, Closed Structure with Biomembrane Characteristics or Cellular Compartment Derived from Natural Sources and/or Self-Assembly Techniques, Preparation Method and Applications Thereof |
| CN108728396A (en) * | 2018-06-12 | 2018-11-02 | 华中农业大学 | A kind of isolation and purification method of citrus pulp mitochondria |
Non-Patent Citations (3)
| Title |
|---|
| T.AP REES ET AL.: ""Role and Location of NAD Malic Enzyme in Thermogenic Tissues of Araceae"", 《ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS》 * |
| 于婷乔等: ""一种有效分离沙冬青线粒体基因组DNA的方法"", 《中国细胞生物学学报》 * |
| 龙绛雪等: ""油菜线粒体DN A提取纯化方法研究"", 《中南林业科技大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996158A (en) * | 2020-07-20 | 2020-11-27 | 北京大学 | Method for efficiently enriching plant mitochondria through protoplast |
| CN112229949A (en) * | 2020-09-24 | 2021-01-15 | 北京林业大学 | Kit and method for determining moso bamboo shoot histiocyte mitochondrial respiration |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438062B (en) | 2021-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Johnson et al. | Genetic variation of alcohol dehydrogenase in Drosophila melanogaster | |
| CN1997740B (en) | Reagents and methods for isolation of purified RNA | |
| Bourett et al. | Reef coral fluorescent proteins for visualizing fungal pathogens | |
| CN107299054A (en) | The control system and control method of DNA sequencing device | |
| CN103215251B (en) | A kind of method being separated chloroplast DNA | |
| CN110438062A (en) | A kind of extraction purification and identification method of moso bamboo shoot high activity mitochondria | |
| Lang et al. | Purification of mitochondrial and plastid DNA | |
| US20110201085A1 (en) | Nucleic acid extraction from complex matrices | |
| CN106167787B (en) | Method for preparing xylem protoplast of betula luminifera and transient transformation | |
| CN107400668B (en) | Extraction method of tussah microsporidian template DNA and application of tussah microsporidian template DNA in molecular diagnosis | |
| CN102443564B (en) | Method for extracting nucleuses of pear pollen tube | |
| CN105950740A (en) | LAMP (loop-mediated isothermal amplification) kit for early diagnosis of candida krusei and special primer | |
| CN104988240B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs16287910 | |
| Zhang et al. | Modified CTAB method for extracting genomic DNA from wheat leaf | |
| CN111019940A (en) | Extracting solution for directly extracting whole blood genome DNA and extracting method thereof | |
| CN107151666A (en) | The extracting method of microbial DNA in a kind of water body | |
| CN102943308A (en) | Echinococcus granulosus developmental-stage secretory protein expression gene chip | |
| CN101148664B (en) | Method for extracting solid-state fermentation microorganism total DNA | |
| CN107400719B (en) | Tussah microsporidian detection primers and application thereof | |
| CN110885817A (en) | Sesbania mitochondria and effective method for extracting DNA thereof | |
| CN108118099B (en) | Marine toxigenic microalgae detection kit and detection method based on hyper-branched rolling-circle amplification marker | |
| CN102154522A (en) | Primer and method for detecting bombyx mori cytoplasmic polyhedrosis virus (BmCPV) | |
| CN114075596A (en) | Method for detecting target microbial genome RNA based on high-throughput sequencing technology | |
| CN101215559A (en) | Method for separating and purifying arthraspira cyanobacteria plasmid | |
| RU2799411C1 (en) | Method of isolating total rna from human intervertebral discs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |