CN110438016A - A kind of Metarhizium anisopliae bacterial strain and its application - Google Patents

A kind of Metarhizium anisopliae bacterial strain and its application Download PDF

Info

Publication number
CN110438016A
CN110438016A CN201910836022.4A CN201910836022A CN110438016A CN 110438016 A CN110438016 A CN 110438016A CN 201910836022 A CN201910836022 A CN 201910836022A CN 110438016 A CN110438016 A CN 110438016A
Authority
CN
China
Prior art keywords
metarhizium anisopliae
bacterial strain
green
metarhizium
preservation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910836022.4A
Other languages
Chinese (zh)
Inventor
占智高
刘卓荣
关丽梅
况文东
王金昌
靳亮
李鹏
邱小忠
张婷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
INSTITUTE OF MICROBIOLOGY JIANGXI ACADEMY OF SCIENCES
Original Assignee
INSTITUTE OF MICROBIOLOGY JIANGXI ACADEMY OF SCIENCES
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSTITUTE OF MICROBIOLOGY JIANGXI ACADEMY OF SCIENCES filed Critical INSTITUTE OF MICROBIOLOGY JIANGXI ACADEMY OF SCIENCES
Priority to CN201910836022.4A priority Critical patent/CN110438016A/en
Publication of CN110438016A publication Critical patent/CN110438016A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/145Fungal isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N13/00Treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of Metarhizium anisopliae bacterial strain and its application, a kind of Metarhizium anisopliae bacterial strain of the invention, the bacterial strain is Metarhizium anisopliae;The entitled Metarhizium anisopliae Metarhizium anisopliae JXAS-03 of preservation;It is preserved in China typical culture collection center, preservation address is Wuhan City, Hubei Province Hongshan District Bayi Road Wuhan University China typical culture collection center;Preservation date: on 08 14th, 2019;Deposit number: CCTCC M 2019626.Bacterial strain of the invention has stronger killing ability to mole cricket class pest, provides a new material for the prevention and treatment of mole cricket class pest.

Description

A kind of Metarhizium anisopliae bacterial strain and its application
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of Metarhizium anisopliae bacterial strain and its application.
Background technique
Gryllotalpa spp Orthoptera Gryllotalpidae insect, popular name mole cricket, ground draw mqb, and common mainly has Oriental burmeister, North China mole cricket Mqb etc..Mole cricket mainly passes through adult and saps a gallery under soil, Plant species eaten root and tender stem, and leads to the root and soil of plant indirectly It is detached from, causes plant seedlings withered.Mole cricket is liked in soft, tunneling in wetland.Mole cricket is omnivorous insect, several All crops, especially crop seeding and seedling raising phase are endangered, nursery failure or the underproduction are often resulted in, are a kind of important subterranean pest-insects, How to prevent and treat is a problem in the urgent need to address.
The method of prevention and treatment mole cricket mainly has at present: (1) light trap: mole cricket has apparent phototaxis, using black light lamp, Larger in relative humidity, wind speed is small, no moonlight, the sultry dusk rained fastly, can trap a large amount of mole cricket;(2) horsehit is fresh Grass trapping: the organic matters compost such as mole cricket team horsehit has very strong taxis, stacks ground or organic matter place abundant, mole cricket in muck Mqb is just clustered in this, is also often a common method in mole cricket prevention and treatment using muck plus poison trapping, such as Lv Jie patent: one (the patent No.: 201310583677.8) described in the formula of the organic fertilizer of kind prevention mole cricket;(3) chemical pesticide period poison bait: Mole cricket has stronger chemotaxis, and to half-mature millet is boiled, soya-bean cake or wheat bran have very strong hobby, utilize these materials Poison is smeared, mole cricket can be trapped and killed,;(4) Extracts from Plant Recourses is trapped and killed: as yellow big patent (patent No.: 201711094609.X;A kind of mole cricket killing agent being not likely to produce drug resistance) described in, Li Yong pivot stores, and the extracts such as borneol are mixed Close mole cricket insecticide made of object;Biological control: currently without using bacterium, the natural pathogenic microorganism of the mole crickets such as fungi or virus The report for preventing and treating mole cricket.Physical method prevention and treatment, not only needs to put into a large amount of black light lamp, higher cost, and effect is general.Chemistry Pesticide poison bait, control efficiency is pretty good, but be easy to cause environmental pollution, and endangers to the health care belt of humans and animals.Separation identification There is higher killing ability to mole cricket, and to the natural pathogenic microorganism of person poultry harmless, biological control is carried out to mole cricket, is one Good selection.
Summary of the invention
The object of the present invention is to provide the Metarhizium anisopliae bacterial strains that a kind of pair of mole cricket class pest has stronger infection ability JXAS-03 and its application in insect biological control, especially mole cricket biological control.
Technical scheme is as follows: a kind of Metarhizium anisopliae bacterial strain of the invention, and the bacterial strain is chafer Green muscardine fungus;The entitled Metarhizium anisopliae Metarhizium anisopliae JXAS-03 of preservation;It is preserved in Chinese Typical Representative training Object collection is supported, preservation address is in Wuhan City, Hubei Province Hongshan District Bayi Road Wuhan University China typical culture collection The heart;Preservation date: on 08 14th, 2019;Deposit number: CCTCC M2019626.
Further, for Metarhizium anisopliae JXAS-03 on PDA plate, initial stage vegetative growth stage is white, small-sized silk Shape fungi, radially toward outgrowth, the later period, which produces spore stage thallus, becomes green or yellow green, and the most central idol of bacterium colony is dotted White.
Further, the ITS sequence of the Metarhizium anisopliae is as shown in SEQ ID NO:1.
The Metarhizium anisopliae microbial inoculum of Metarhizium anisopliae preparation of the present invention.
Further, active constituent is at least one of following (a) (b) (c):
(a) fermentation culture medium or spore suspension of Metarhizium anisopliae described in claim 1;
(b) the ultrasound cracking supernatant of claim 1 gained Metarhizium anisopliae cell;
(c) the ultrasound cracking precipitating of claim 1 gained Metarhizium anisopliae cell.
The preparation method of Metarhizium anisopliae microbial inoculum of the present invention, includes the following steps:
(1) on the PDA plate that bacterial strain single bacterium is fallen within to the chloramphenicol containing 25 μ g/ml, temperature is 25-30 DEG C, cultivates 3-14 It rinses spore with 0.05% Tween-80, muscardine spore suspension microbial inoculum is made until generating green spores;
(2) it or by the single colonie picking in (1), is inoculated into the LB culture solution of the chloramphenicol containing 25 μ g/ml, temperature is 25-30 DEG C, stirring rate 100-250rpm, shaking table culture 3-10 days, the fermentation culture medium of the green muscardine fungus is prepared;
(3) by after the fermentation culture medium ultrasonication in (2), 3000-5000rpm/min is centrifuged lysate, and precipitating is Green muscardine fungus cell ultrasound cracking precipitating;Supernatant is green muscardine fungus ultrasound cracking supernatant.
Metarhizium anisopliae bacterial strain of the present invention is preparing the application in biological insecticides.
The utility model has the advantages that bacterial strain of the invention has stronger killing ability to mole cricket class pest, and can be in mole cricket population Epidemic disease is caused, provides a new material for the prevention and treatment of mole cricket class pest.
The invention has the following advantages that
(1) Metarhizium anisopliae of the present invention is separated from the Oriental burmeister bombys batryticatus of natural infection death, should Bacterial strain is that mole cricket lives and infects in the natural environment, has stronger virulence to mole cricket.
(2) present invention is needed compared to period poison bait method etc. using chemical pesticide, and Metarhizium anisopliae is right to person poultry harmless Plant growth does not also damage, and is a kind of environmentally friendly biological insecticides, agrees with very much China's Ecological Civilization Construction, green The requirement of agricultural development.
Detailed description of the invention
Fig. 1 is the bombys batryticatus phenotypic map that Oriental burmeister of the invention infects Metarhizium anisopliae death;
Fig. 2 is Metarhizium anisopliae colonial morphology figure of the invention;
Fig. 3 is Metarhizium anisopliae JXAS-03ITS sequence comparison result figure in ncbi database of the invention.
Specific embodiment
The present invention is further illustrated by the following examples.It should be understood that these embodiments are explainations of the invention And citing, and the range that the invention is not limited in any way.
Embodiment 1
A kind of Metarhizium anisopliae bacterial strain of the invention, the bacterial strain are Metarhizium anisopliae;The entitled cockchafer of preservation Sub- green muscardine fungus Metarhizium anisopliae JXAS-03;It is preserved in China typical culture collection center, preservation address It is Wuhan City, Hubei Province Hongshan District Bayi Road Wuhan University China typical culture collection center;Preservation date: 08 month 2019 14 days;Deposit number: CCTCC M 2019626.
For Metarhizium anisopliae JXAS-03 on PDA plate, initial stage vegetative growth stage is white, and small-sized filamentous fungi is in Radial past outgrowth, the later period, which produces spore stage thallus, becomes green or yellow green, and the most central idol of bacterium colony is dotted white.
The nucleotide sequence of the Metarhizium anisopliae is as shown in SEQ ID NO:1.
The Metarhizium anisopliae microbial inoculum of Metarhizium anisopliae preparation of the present invention.Its active constituent is following (a) (b) At least one of (c):
(a) fermentation culture medium or spore suspension of Metarhizium anisopliae described in claim 1;
(b) the ultrasound cracking supernatant of claim 1 gained Metarhizium anisopliae cell;
(c) the ultrasound cracking precipitating of claim 1 gained Metarhizium anisopliae cell.
The preparation method of Metarhizium anisopliae microbial inoculum of the present invention, includes the following steps:,
(1) on the PDA plate that bacterial strain single bacterium is fallen within to the chloramphenicol containing 25 μ g/ml, temperature is 30 DEG C, is cultivated 3 days, until Green spores are generated, spore is rinsed with 0.05% Tween-80, muscardine spore suspension microbial inoculum is made;
(2) it or by the single colonie picking in (1), is inoculated into the LB culture solution of the chloramphenicol containing 25 μ g/ml, temperature 30 DEG C, shaking table culture 10 days, the fermentation culture medium of the green muscardine fungus was prepared in stirring rate 250rpm;
(3) by after the fermentation culture medium ultrasonication in (2), 5000rpm/min is centrifuged lysate, and precipitating is green muscardine fungus Cell ultrasound cracking precipitating;Supernatant is green muscardine fungus ultrasound cracking supernatant.
Metarhizium anisopliae bacterial strain of the present invention is preparing the application in biological insecticides.
Embodiment 2
Embodiment 2 the difference from embodiment 1 is that: the preparation method of Metarhizium anisopliae microbial inoculum of the present invention, including Following steps:
In step (1), on PDA plate that bacterial strain single bacterium is fallen within to the chloramphenicol containing 25 μ g/ml, temperature is 25 DEG C, training It supports 14 days, until generating green spores, rinses spore with 0.05% Tween-80, muscardine spore suspension microbial inoculum is made;
In step (2), or by the single colonie picking in (1), it is inoculated into the LB culture solution of the chloramphenicol containing 25 μ g/ml In, temperature is 25 DEG C, stirring rate 100rpm, and shaking table culture 3 days, the fermentation culture medium of the green muscardine fungus is prepared;
In step (3), after the fermentation culture medium ultrasonication in (2), 3000rpm/min is centrifuged lysate, precipitating As green muscardine fungus cell ultrasound cracking precipitating;Supernatant is green muscardine fungus ultrasound cracking supernatant.
Embodiment 3
Embodiment 3 the difference from embodiment 1 is that: the preparation method of Metarhizium anisopliae microbial inoculum of the present invention, including Following steps:
In step (1), on PDA plate that bacterial strain single bacterium is fallen within to the chloramphenicol containing 25 μ g/ml, temperature is 28 DEG C, training It supports 10 days, until generating green spores, rinses spore with 0.05% Tween-80, muscardine spore suspension microbial inoculum is made;
In step (2), or by the single colonie picking in (1), it is inoculated into the LB culture solution of the chloramphenicol containing 25 μ g/ml In, temperature is 28 DEG C, stirring rate 150rpm, and shaking table culture 8 days, the fermentation culture medium of the green muscardine fungus is prepared;
In step (3), after the fermentation culture medium ultrasonication in (2), 4000rpm/min is centrifuged lysate, precipitating As green muscardine fungus cell ultrasound cracking precipitating;Supernatant is green muscardine fungus ultrasound cracking supernatant.
Test example 1
The separation of 1 Metarhizium anisopliae is identified
Fig. 1 is the bombys batryticatus phenotypic map that Oriental burmeister of the invention infects Metarhizium anisopliae death.Note: Oriental burmeister is golden After the infection of tortoise green muscardine fungus, bombys batryticatus extremity portion place greening is visible from white hypha body longer in vivo elsewhere.Figure Scale on 1 is scale bar.
Oriental burmeister was collected in Yichun City Yifeng County in 2018, and took back laboratory and carry out separation identification research.First Bombys batryticatus sample take pictures with camera to save picture;Later, with the tweezers of disinfection, before one for removing Oriental burmeister sample Limb carries out 3 cleanings with aqua sterilisa, removes residual ethanol solution after ethanol solution surface sterilization 15 seconds of 75%;With sterilized After the mortar of bacterium grinds the forelimb, after adding 1 milliliter of water and mixing, 100 microlitres of lapping liquid coating PDA plates is taken, are placed in 27 Degree Celsius, it is cultivated in the constant temperature and humidity incubator of relative humidity 80%.After growing clone, single bacterium is picked up with oese and is fallen within newly Culture medium flat plate on cross purifying, continuous purification several times after, with tweezers from monoclonal clamping parts mycelium lysate After cracking (Lysis Buffer for Microorganism to Direct PCR), takes part lysate as template, use ITS1/ITS4 primer pair is expanded, and PCR product is served the raw work in sea and is sequenced.ITS sequence is as shown in Figure 3.ITS sequence exists It is found after being compared on NCBI BLAST database, it is the most similar as shown in table 1 to Metarhizium anisopliae, therefore be by this Strain Designation Metarhizium anisopliae JXAS-03 strain.The entitled Metarhizium anisopliae Metarhizium anisopliae JXAS-03 of preservation; It is preserved in China typical culture collection center, preservation address is Wuhan City, Hubei Province Hongshan District China, Bayi Road Wuhan University allusion quotation Type culture collection;Preservation date: on 08 14th, 2019;Deposit number: CCTCC M 2019626.
The form of 2 Metarhizium anisopliaes
Fig. 2 is Metarhizium anisopliae colonial morphology figure of the invention;Metarhizium anisopliae JXAS-03 is on PDA plate, just Phase vegetative growth stage is white, small-sized filamentous fungi, radially toward outgrowth, the later period produce spore stage thallus become green or Yellow green, the most central idol of bacterium colony are dotted white.
Fig. 3 is Metarhizium anisopliae JXAS-03ITS sequence comparison result figure in ncbi database of the invention.
>ITS sequences CCCTTCCCGTACGGGGAACCTGCGGAGGGATCATTACCGAGTTATCCAACTCC CATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTTAATAAGTATC TTCTGAGTGGTTTAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG CGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTA TTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGG CTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGGTCTCGCCGTGGCCCTCCTCTGCGCAGTAGTAAAGCAC TCGCAACAGGAGCCCGGCGCGGTCCACTGCCGTAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGAC TACCCGCTGAACTTAAGCATATCAATGGGCGGGGGAAGGGATGGC
Illustrate: sequence alignment result shows, all gold in the Metarhizium anisopliae and current database of this patent separation Tortoise green muscardine fungus ITS different and most like HZ1 strains has 96.42% similitude.
Oriental burmeister killing ability measures in 3 rooms Metarhizium anisopliae bacterial strain JXAS-03
Metarhizium anisopliae bacterial strain JXAS-03 inoculation is lined on PDA plate, is placed in 27 degrees Celsius, relative humidity It is cultivated in 80% constant temperature and humidity incubator, covers with entire plate to fungi, it, will with 0.05% Tween-80 solution washing plate Fungal spore rinses, and is filtered to remove the fungus sporophore of bulk after collection conidium with filter paper.With cell count instrument meter After number conidial suspension concentration, it is 1 × 10 that conidium, which is diluted to concentration with 0.05% Tween-80 solution,5, 1 × 106, 1×107Spore/mL solution.Three repetitions of each concentration, 10 mole cricket adults of each repeating groups.Spore suspension handles mole cricket Mqb adult uses infusion method, i.e., each mole cricket adult is pressed into spore suspension liquid level or less with tweezers and maintained 3 seconds. 0.05% Tween-80 is as blank control.Treated, and mole cricket adult is put in 27 degrees Celsius, the constant temperature and humidity of relative humidity 80% It is cultivated in incubator, takes out and record dead bombys batryticatus quantity daily, calculate the death rate of each concentration, data are as follows: chafer Mole cricket killing ability test result is as shown in table 1 in the room Metarhizium Strains JXAS-03:
Table 1
Spore suspension concentration (spore/mL) Death rate % (Mean Death number/10)
1*105 43.3% (4.33/10)
1*106 60% (6/10)
1*107 83.3% (8.33/10)
As shown in table 1, Metarhizium anisopliae bacterial strain JXAS-03 of the invention is stronger to indoor mole cricket killing ability.
The basic principles, main features and advantages of the present invention have been shown and described above.The technology of the industry Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this The principle of invention, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, the present invention Claimed range is delineated by the appended claims, the specification and equivalents thereof from the appended claims.
Sequence table
<110>institute of microbiology, In Jiangxi Science institute
<120>a kind of Metarhizium anisopliae bacterial strain and its application
<130> 2019
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 560
<212> DNA
<213>artificial sequence (nucleotide sequence of Metarhizium anisopliae ITS)
<400> 1
cccttcccgt acggggaacc tgcggaggga tcattaccga gttatccaac tcccatacct 60
ttaattgttg cttcggcggg acttcgcgcc cgccggggac ccaaaccttc tgaatttttt 120
aataagtatc ttctgagtgg tttaaaaaaa atgaatcaaa actttcaaca acggatctct 180
tggttctggc atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt 240
cagtgaatca tcgaatcttt gaacgcacat tgcgcccgtc agtattctgg cgggcatgcc 300
tgttcgagcg tcattacgcc cctcaagtcc cctgtggact tggtgttggg gatcggcgag 360
gctggttttc cagcacagcc gtcccttaaa ttaattggcg gtctcgccgt ggccctcctc 420
tgcgcagtag taaagcactc gcaacaggag cccggcgcgg tccactgccg taaaaccccc 480
caacttttta tagttgacct cgaatcaggt aggactaccc gctgaactta agcatatcaa 540
tgggcggggg aagggatggc 560

Claims (7)

1. a kind of Metarhizium anisopliae bacterial strain, it is characterised in that: the bacterial strain is Metarhizium anisopliae;The entitled cockchafer of preservation Sub- green muscardine fungus Metarhizium anisopliae JXAS-03;It is preserved in China typical culture collection center, preservation address It is Wuhan City, Hubei Province Hongshan District Bayi Road Wuhan University China typical culture collection center;Preservation date: 08 month 2019 14 days;Deposit number: CCTCC M 2019626.
2. Metarhizium anisopliae bacterial strain according to claim 1, it is characterised in that: Metarhizium anisopliae JXAS-03 is in PDA On plate, initial stage vegetative growth stage is white, and small-sized filamentous fungi, radially toward outgrowth, the later period produces spore stage thallus Become green or yellow green, the most central idol of bacterium colony is dotted white.
3. Metarhizium anisopliae bacterial strain according to claim 1, it is characterised in that: the ITS of the Metarhizium anisopliae Sequence is as shown in SEQ ID NO:1.
4. the Metarhizium anisopliae microbial inoculum of Metarhizium anisopliae preparation described in claim 1.
5. Metarhizium anisopliae microbial inoculum according to claim 4, active constituent is at least one in following (a) (b) (c) Kind:
(a) fermentation culture medium or spore suspension of Metarhizium anisopliae described in claim 1;
(b) the ultrasound cracking supernatant of claim 1 gained Metarhizium anisopliae cell;
(c) the ultrasound cracking precipitating of claim 1 gained Metarhizium anisopliae cell.
6. the preparation method of the Metarhizium anisopliae microbial inoculum of claim 4 or 5, it is characterised in that include the following steps:
(1) on the PDA plate that bacterial strain single bacterium is fallen within to the chloramphenicol containing 25 μ g/ml, temperature is 25-30 DEG C, culture 3-14 days, directly To green spores are generated, spore is rinsed with 0.05% Tween-80, muscardine spore suspension microbial inoculum is made;
(2) it or by the single colonie picking in (1), is inoculated into the LB culture solution of the chloramphenicol containing 25 μ g/ml, temperature 25-30 DEG C, shaking table culture 3-10 days, the fermentation culture medium of the green muscardine fungus was prepared in stirring rate 100-250rpm;
(3) by after the fermentation culture medium ultrasonication in (2), 3000-5000rpm/min is centrifuged lysate, and precipitating is green deadlock Bacterium cell ultrasound cracking precipitating;Supernatant is green muscardine fungus ultrasound cracking supernatant.
7. Metarhizium anisopliae bacterial strain described in claim 1 is preparing the application in biological insecticides.
CN201910836022.4A 2019-09-05 2019-09-05 A kind of Metarhizium anisopliae bacterial strain and its application Pending CN110438016A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910836022.4A CN110438016A (en) 2019-09-05 2019-09-05 A kind of Metarhizium anisopliae bacterial strain and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910836022.4A CN110438016A (en) 2019-09-05 2019-09-05 A kind of Metarhizium anisopliae bacterial strain and its application

Publications (1)

Publication Number Publication Date
CN110438016A true CN110438016A (en) 2019-11-12

Family

ID=68439264

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910836022.4A Pending CN110438016A (en) 2019-09-05 2019-09-05 A kind of Metarhizium anisopliae bacterial strain and its application

Country Status (1)

Country Link
CN (1) CN110438016A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112646735A (en) * 2021-01-21 2021-04-13 慕恩(广州)生物科技有限公司 Metarhizium anisopliae, microbial insecticide, preparation method and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102776130A (en) * 2012-08-03 2012-11-14 中国热带农业科学院环境与植物保护研究所 Metarhizium anisopliae and application thereof
CN105705013A (en) * 2013-11-08 2016-06-22 诺维信生物农业公司 Compositions and methods for treating pests
CN105918355A (en) * 2016-04-29 2016-09-07 山东胜伟园林科技有限公司 Special green muscardine fungus insecticide for preventing and treating Pleonomus canaliculatus, and preparation method thereof
CN107022355A (en) * 2017-05-04 2017-08-08 扬州臻微生物技术有限公司 A kind of biologic ferment soil conditioner and preparation method thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102776130A (en) * 2012-08-03 2012-11-14 中国热带农业科学院环境与植物保护研究所 Metarhizium anisopliae and application thereof
CN105705013A (en) * 2013-11-08 2016-06-22 诺维信生物农业公司 Compositions and methods for treating pests
CN105918355A (en) * 2016-04-29 2016-09-07 山东胜伟园林科技有限公司 Special green muscardine fungus insecticide for preventing and treating Pleonomus canaliculatus, and preparation method thereof
CN107022355A (en) * 2017-05-04 2017-08-08 扬州臻微生物技术有限公司 A kind of biologic ferment soil conditioner and preparation method thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112646735A (en) * 2021-01-21 2021-04-13 慕恩(广州)生物科技有限公司 Metarhizium anisopliae, microbial insecticide, preparation method and application

Similar Documents

Publication Publication Date Title
CN109112087B (en) Paenibacillus terrae YC16-08 and application thereof
CN102776130B (en) Metarhizium anisopliae and application thereof
CN108018242B (en) A kind of serratia marcescens and its separation method and application
CN105039167B (en) A kind of beauveria bassiana DSXJ 07 and its application
CN113308385B (en) Isaria javanicus strain DMC01 and application thereof in prevention and treatment of locusta migratoria in east Asia
CN110106093A (en) A kind of Strain of Beauveria bassiana and its application
CN113373065B (en) Isaria javanicus strain DMC01 and application thereof in prevention and treatment of pine caterpillars
CN107502581A (en) One plant of Serratia bacterial strain
CN102021122A (en) High-efficiency insecticidal fungus and applications thereof
El-Hindi Safe approach to the Biological Control of the Tomato Leafminer Tuta absoluta by entomopathogenic fungi Beauveria bassiana isolates from Gaza Strip
CN104109649B (en) Serratia marcescens NlM280 and the application as insecticide
CN114214220A (en) Bacillus thuringiensis and application thereof in promoting plant growth
CN105695344B (en) The cultural method of Isaria Microsclerotia and its application
CN112391294A (en) Aspergillus oryzae and application thereof in prevention and treatment of yellow-striped rice borers
CN107502570B (en) One plant of Biocontrol Bacillus subtilis BJ-1 and its application
CN106135294A (en) A kind of Novel ball beauveria bassiana granule
CN101375689B (en) Black oyster mushroom extract as well as preparation method and application thereof
CN110438016A (en) A kind of Metarhizium anisopliae bacterial strain and its application
CN105274007B (en) One plant of Metarhizium anisopliae var. Anisopliae MaTS02 and its application in terms of preventing and treating Bemisia tabaci
CN116004396B (en) Metarrhizium anisopliae FHGIW2, application thereof and prepared pesticide
CN103981108A (en) Beauveria bassiana for preventing radysia odoriphaga and application thereof
CN111808888A (en) Chinese fir endophytic fungi fermentation filtrate and extract thereof, and preparation method and application of Chinese fir endophytic fungi fermentation filtrate and extract
CN109971658A (en) A kind of aspergillus fungi bacterial strain and its application
CN106591153B (en) One plant of Metarhizium Strains and its application to carpocapsa pononella highly pathogenicity
CN113481108B (en) Nutritional matrix for stimulating growth of nematode-trapping fungi on trunk, and preparation method and application method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20191112