CN110438013B - Chaetomium maderaceum and application thereof - Google Patents
Chaetomium maderaceum and application thereof Download PDFInfo
- Publication number
- CN110438013B CN110438013B CN201910745629.1A CN201910745629A CN110438013B CN 110438013 B CN110438013 B CN 110438013B CN 201910745629 A CN201910745629 A CN 201910745629A CN 110438013 B CN110438013 B CN 110438013B
- Authority
- CN
- China
- Prior art keywords
- chaetomium
- compounds
- compound
- leaching
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/165—Heterorings having nitrogen atoms as the only ring heteroatoms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The invention belongs to the technical field of application of microorganisms and natural products thereof, and particularly relates to a Chaetomium fortunei strain and application thereof. The invention prepares cytochalasin compounds by a biological fermentation method by using chaetomium fortunei, and the prepared cytochalasin compounds are used for preparing anti-human liver cancer HepG2 and human non-small cell lung cancer A549 tumor medicaments, and the result shows that the compounds have certain inhibitory activity on human non-small cell lung cancer A549 cells and human liver cancer HepG2, have better application effect, can induce apoptosis of human non-small cell lung cancer cells, and have good application prospect.
Description
Technical Field
The invention belongs to the technical field of application of microorganisms and natural products thereof, and particularly relates to a Chaetomium fortunei strain and application thereof.
Background
According to the latest live report of the world health organization, tumors, namely cancers, are the second leading cause of death in the world, malignant tumors are common diseases and frequently encountered diseases threatening human health, the number of new malignant tumor cases is about 1800 ten thousand in 2018 worldwide, and the number of death cases is up to 960 ten thousand.
Due to the characteristics of various chemical structures, wide activity and the like, microbial metabolites can interact with various specific targets in cells, and are one of important sources for finding targeted specific drugs or drug lead compounds. The research and development work of finding the antitumor drug with better curative effect and more applicability by digging the active ingredients of natural products or modifying part of the structure of the natural products has great significance.
Cytochalasin is a fungus polyamino acid hybrid secondary metabolite with remarkable biological functions and is also a highly substituted isoindolone derivative. The typical structural characteristics of the compound have a tricyclic framework structure, wherein, on an isoindolone framework, the abundance of the types and the diversity of the structures of cytochalasin are determined by the difference of the types of amino acids on the polyketone framework, the types of macrocycles, the number of carbon atoms and the substituent groups on the macrocycles according to the combination of a large ring and the isoindolone framework. Researches show that the compounds have wide biological activities of resisting tumors, bacteria, viruses and the like.
Disclosure of Invention
The invention aims to provide a strain of Chaetomium fortunei and also provides application of the Chaetomium fortunei in preparing an anti-tumor medicament.
In order to achieve the purpose, the strain used by the invention is a strain separated from desert soil in Xinjiang and Tian City, the classification name of the strain is Chaetomium madrasense CLC375, and the strain is preserved in China center for type culture Collection, and the preservation address is as follows: wuhan, Wuhan university; the preservation date is as follows: 7, month and 3 in 2019, and the preservation number is CCTCC M2019517.
The invention also provides the application of the above Chaetomium fortunei in preparing anti-tumor drugs, and when in application, the Chaetomium fortunei is used for preparing cytochalasin compounds by a biological fermentation method, wherein the structural formula of the cytochalasin compounds is as follows:
when in use, the method specifically comprises the following steps:
(1) activating strains: inoculating the Chaetomium fortunei to an SDAY plate culture medium, and culturing for 5-7 d at 25-30 ℃ to obtain an activated strain;
(2) fermentation culture: inoculating the activated strain obtained in the step (1) into a rice solid culture medium, and performing static culture at 25 ℃ for 28 days to obtain a fermentation product;
(3) leaching with ethyl acetate: leaching the fermentation product obtained in the step (2) with ethyl acetate, concentrating the leaching liquor under reduced pressure, and recovering ethyl acetate to obtain a crude extract;
(4) and (3) crude extract column chromatography separation: and (4) mixing the crude extract obtained in the step (3) with dichloromethane: performing gradient elution with methanol volume ratio of 100:1, 50:1, 10:1 and 1:1 respectively, detecting by thin layer chromatography to obtain 6 fractions numbered Fr.1-Fr.6, separating by silica gel column chromatography or sephadex column chromatography to obtain crude product, and purifying by semi-preparative reverse phase high performance liquid chromatography to obtain the cytochalasin compounds.
Specifically, the preparation of the rice culture medium in the step (2): sterilizing 50-70g rice and 100mL water at 121 deg.C under high pressure for 25-30 min.
Specifically, the ethyl acetate leaching process in the step (3) is as follows: adding 300mL of ethyl acetate into each part of fermented product, stirring the fermented product into particles by using a glass rod, fully contacting a solvent with the fermented product, standing for 12-16 h, filtering, leaching for three times, combining leaching liquor for three times, and concentrating the leaching liquor under reduced pressure to obtain crude extract.
Specifically, the tumor refers to human liver cancer HepG2 or human non-small cell lung cancer A549, and the cytochalasin compounds can induce apoptosis of human non-small cell lung cancer cells while preparing the anti-tumor agent.
The invention has the following beneficial effects:
the invention prepares cytochalasin compounds by a biological fermentation method and by using the chaetomium fortunei, and the prepared cytochalasin compounds are used for preparing anti-human liver cancer HepG2 and human non-small cell lung cancer A549 tumor medicaments.
Drawings
FIG. 1 is a graph comparing experimental ECD and calculated ECD for Compound 1(Chaetomadrasin A) prepared in example 1;
FIG. 2 is a graph comparing the experimental ECD and calculated ECD of Compound 2(Chaetomadrasin B) prepared in example 1;
FIG. 3 is a graph of apoptosis induction of Compound 1(Chaetomadras A) prepared in example 1;
FIG. 4 is an activity diagram of MTT method for detecting RAW264.7 cells;
FIG. 5 is a graph showing that the NO content released from RAW264.7 cells is detected by the NO kit;
FIG. 6 is a colony morphology of Chaetomium madrasense.
Detailed Description
The invention will be further illustrated with reference to specific examples, without however restricting the scope of the invention thereto. The Chaetomium fortunei used in the following examples was isolated from desert soil in Xinjiang and Tian and deposited under the taxonomic name Chaetomium madrasense CLC375 and deposited in the China center for type culture Collection at the deposit address: wuhan, Wuhan university; the preservation date is as follows: 7, month and 3 in 2019, and the preservation number is CCTCC M2019517.
The specific separation and screening method is as follows: adopting a dilution plate method: mixing about 1g air dried soil sample with 10mL sterilized 0.1% sterilized agar water, shaking for 5min, standing, sequentially diluting the upper suspension without impurities by 10 times and 100 times, and spreading on a Martin medium (peptone 5g, glucose 10g, KH) containing 30 μ g/mL streptomycin2PO4 1 g，MgSO4·7H20.5g of O, 20g of agar and 1000mL of distilled water, namely 3mL of 1% tiger red sodium salt mother liquor), performing inverted culture at room temperature, after fungus grows out (3-5 d), selecting possible single ascomycete colonies, culturing the single ascomycete colonies on a PDA (personal digital assistant) culture medium plate, performing microscopic examination to select required strains after fruiting bodies are formed, and inoculating the obtained strains in a corn flour culture medium (CMA: 30g of corn flour, 20g of agar powder and 1000mL of distilled water), adding a proper amount of sterilized wheat straws and filter paper strips on the surface of the flat plate, culturing at room temperature, regularly observing, and observing, measuring and recording item by item according to various morphological research character indexes (culture shape, ascocarp morphological structure, accessory silk morphological structure, ascocarp morphological structure, ascospore morphological structure, existence of bud holes and implantation positions).
Morphological characteristics: no aerial hyphae exist on the CMA culture medium or sparse light yellow aerial hyphae exist in partial areas; the ascocarp is surface-grown without colored exudates, the initial stage under reflected light is olive green, the formed spore angle is black, the ascocarp is oval, ellipsoid or nearly ellipsoid and provided with an orifice, the diameter is about 149-; the terminal accessory thread is waved, bent or slightly spirally curled, is light brown, has unobvious separation, has dense wart-like processes on the surface, and has the width of 2-3.5 μm near the base; the asco stick is rod-shaped and has a handle, 68-90 multiplied by 11-16 mu m, 8 ascospores are produced internally, and the asco wall is easy to digest; the ascospore is lemon-shaped, two sides are flat, one side is provided with a bulge, the olive is brown or brown when the olive is mature, a plurality of oil drops are arranged in the olive, the oil drops are 9-11.5(-14) multiplied by 7.5-9(-10) multiplied by 6-7.5 mu m, and the olive has a single top growing bud hole. The colony morphology is shown in FIG. 6.
Physiological and biochemical identification: adopting a pseudo-dextrin reaction: immature ascospores were added to Melzer's reagent Meerzel's reagent, and the ascospores changed from colorless or light color to yellowish-brown or reddish-brown.
The 18sDNA sequence of the strain is shown in a sequence table:
GTATAGACCTACCTGATCCGAGGTCACCTGGTTAAGATTGATGGTGTTCGCCGGCGG GCGCCGGCCGGGCCTACAGAGCGGGTGACGAAGCCCCATACGCTCGAGGACCGGACGC GGTGCCGCCGCTGCCTTTCGGGCCCGCCCCCCGGAAGCGGGGGGCGAGAGCCCAACAC ACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAG GGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTA TCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTA ACTGATTTAGTCAAGTACTCAGACTGCAATCTTCAGACAAGAGTTCGTTTGTGTGTCTTC GGCGGGCGCGGGCCCGGGGGCGGATGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAA GCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAA TGATCCTT。
example 1
The cytochalasin compounds are prepared by the following steps:
(1) activating strains: inoculating Chaetomium maidrasene (Chaetomium madrasense) to an SDAY plate culture medium, and culturing at 30 ℃ for 5 days to obtain an activated strain;
(2) fermentation culture: inoculating the activated strain obtained in the step (1) into a rice solid culture medium (60g of rice, 100m L water, and autoclaving at 121 ℃ for 30min), and standing at 25 ℃ for 28d to obtain a fermented product;
(3) leaching with ethyl acetate: adding 300mL of ethyl acetate into the fermented product obtained in the step (2), stirring the fermented product into particles by using a glass rod, fully contacting an ethyl acetate solvent with the fermented product, standing for 12 hours, filtering, repeating the leaching method for three times, combining leaching liquor obtained in the three times, concentrating the leaching liquor under reduced pressure, and recovering the ethyl acetate to obtain 200g of crude extract;
(4) and (3) crude extract column chromatography separation: and (4) mixing the crude extract obtained in the step (3) with dichloromethane: gradient elution is carried out when the volume ratio of methanol is 100:1, 50:1, 10:1 and 1:1 respectively, and detection is carried out by thin layer chromatography to obtain 6 flow portions which are numbered as Fr.1-Fr.6.
Wherein the flow portion Fr.4 is subjected to normal phase silica gel column chromatography (petroleum ether and acetone in a volume ratio of 50:1-10:1 are used as eluent) to obtain 8 components (Fr.4.1-Fr.4.8).
Wherein Fr.4.5 is subjected to Sephadex LH-20 column chromatography to obtain 5 components (Fr.4.5.1-Fr.4.5.5); purifying the obtained component Fr.4.5.3 by a semi-preparative reversed-phase high-performance liquid method, which comprises the following steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (50:50), the flow rate is 2mL/min, the detection wavelength is 220,254, and the retention time is 15.02 min; after purification 39.5mg of Compound 6 (purity 99.8%) was obtained, which was named Chaetoglobosin Vb。
The Fr.4.6 obtained is subjected again to normal phase silica gel column chromatography with dichloromethane in a volume ratio of 50:1 to 10: 1: methanol as eluent to obtain 7 components (Fr.4.6.1-Fr.4.6.7); performing sephadex column chromatography on the obtained component Fr.4.6.2, eluting with methanol as solvent, and purifying with semi-preparative reverse phase high performance liquid chromatography, which comprises the following steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (50:50), the flow rate of 2mL/min, the detection wavelength of 220 and the 254 retention time of 23.62 min; after purification, 16.5mg of compound 3 (purity 99.8%) was obtained and named Chaetoglobosin G.
Performing sephadex column chromatography on the obtained component Fr.4.6.3, eluting with methanol as solvent, and purifying with semi-preparative reverse phase high performance liquid chromatography, which comprises the following steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (50:50), the flow rate is 2mL/min, the detection wavelength is 220,254, the retention time is 22.9min, and 33.9 min; after purification, 4.5mg of compound 4 (99.8% pure) was obtained, named Isochaetoglobosin D and 8.6mg of compound 1 (99.8% pure), named chaetomorasin a, respectively.
Subjecting the obtained component Fr.4.6.4 to Sephadex column chromatography, eluting with methanol as solvent, and purifying with semi-preparative reverse phase high performance liquid chromatography, which comprises the following steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (45:55), the flow rate is 2mL/min, the detection wavelength is 220,254, and the retention time is 27.80 min; after purification, 2.0mg of compound 7 (purity 99.8%) was obtained, which was named Cytoglobosin A.
The fraction fr.5 obtained is subjected to normal phase silica gel column chromatography with a volume ratio of 10:1 of dichloromethane: performing isocratic elution by using methanol as an eluent, performing sephadex column chromatography, eluting by using methanol as a solvent, and purifying by using a semi-preparative reverse phase high performance liquid phase, wherein the method comprises the following specific steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (35:65), the flow rate is 2mL/min, the detection wavelength is 220,254, and the retention time is 37.50 min; after purification 1.6mg of Compound 8 (purity 99.8%) was obtained, which was named Cytoglobosin Ab。
The obtained fraction Fr.6 is subjected to ODS reverse phase silica gel column chromatography, and gradient elution with 20-100% by volume of methanol and water is performed to obtain 5 fractions Fr.6.1-Fr.6.5.
Performing sephadex column chromatography on the obtained Fr.6.1, eluting with methanol as solvent, and purifying with semi-preparative reverse phase high performance liquid chromatography, which comprises the following steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (45:55), the flow rate is 2mL/min, the detection wavelength is 220,254, and the retention time is 27.02 min; after purification 3.5mg of compound 5 (99.8% pure) was obtained, named Armochaeetologlobin U.
Performing sephadex column chromatography on the obtained Fr.6.2, eluting with methanol as a solvent, and purifying by using a semi-preparative reverse phase high performance liquid chromatography, wherein the method comprises the following specific steps: YMC (10mm × 250mm, 5 μm) is selected as a chromatographic column, and the mobile phase is acetonitrile: the water volume ratio (30:70), the flow rate is 2mL/min, the detection wavelength is 220,254, and the retention time is 30.7 min; after purification, 5.2 mg of compound 2 (purity 99.8%) was obtained and named chaetomorapsin B.
The structural formulas of the compounds 1 to 8 are as follows:
the invention also identifies the structures of two compounds 1(Chaetomadrasin A) and 2(Chaetomadrasin B) with higher antitumor activity:
The hydrogen spectrum and carbon spectrum data of compound 1(Chaetomadrasin A) and compound 2(Chaetomadrasin B) are shown in the following Table 1.
Table 1. hydrogen and carbon spectra data for compound 1 and compound 2.
aMeasured in CDCl3.bMeasured in DMSO-d6.
EXAMPLE 2 inhibition of human cancer cell lines by Compounds 1-8
The antitumor activity evaluation is carried out by adopting an MTT colorimetric method:
respectively selecting human non-small cell lung cancer cell A549 and human liver cancer cell HepG2 in logarithmic growth phase, respectively paving the cells on a 96-well plate (3 multiplied by 105/cm2), respectively adding 0-20 mu M compound sample or positive control (cis-platinum) to treat the cells for 48 hours after the cells adhere to the walls, and simultaneously setting a solvent blank control group. After 48 hours, 10. mu.l of MTT solution (concentration: 5. mu.g/mL) was added to each well, followed by incubation for 4 hours, and then the culture solution was carefully discarded, 100. mu.L of DMSO was added to each well, and shaking was performed for 10min to sufficiently dissolve formazan crystals. The absorbance (OD) at 570nm was then determined using a microplate reader with a reference wavelength of 630nm and Reed&The Muench method calculates the half Inhibitory Concentration (IC)50) Wherein the cell survival rate (%) ═ (OD)570-OD630)Sample (I)/(OD570-OD630)Control。
All statistics are expressed in x ± SD and at least 3 independent experiments were performed. Data were processed using Graph prism5.0 and significant differences in mean values were examined using one-way ANOVA Newman-keuls.
The results show that the compounds 1-8 have certain inhibitory activity on human non-small cell lung cancer A549 cells and human liver cancer HepG2 cells.
TABLE 2 cytotoxic Activity of Compounds 1-8 against 2 tumor cell lines (IC)50,μM)。
| Compound (I) | | HepG2 | |
| 1 | 3.79±0.80 | 8.67±0.61 | |
| 2 | 4.65±0.55 | 19.40±1.32 | |
| 3 | 8.26±1.06 | ＞20 | |
| 4 | 10.25±1.68 | 6.25±0.21 | |
| 5 | 7.33±2.23 | 5.32±0.56 | |
| 6 | ＞20 | 15.29±2.65 | |
| 7 | 6.35±0.94 | 12.35±1.78 | |
| 8 | 12.54±0.85 | 8.23±0.15 | |
| Cis-platinum | 2.48±0.74 | 3.14±0.06 |
EXAMPLE 3 apoptosis-inducing Effect of Compound 1 (Chaetomorapsin A) on human non-Small cell Lung cancer A549 cells
The Annexin V FITC/PI apoptosis detection kit is used for detecting the apoptosis rate of the tumor cells, and the detection is carried out by adopting flow cytometry.
The results are shown in fig. 3, compound 1 (chaetomorapsin a) can induce apoptosis of a549 cells, and is in positive dose correlation, and the apoptosis rate is 11.27 at 20 μ M.
Example 4 in vitro anti-inflammatory assay: building of LPS (lipopolysaccharide) induced macrophage model
MTT method for detecting viability of RAW264.7 cells
The principle is as follows: the MTT method is also called MTT colorimetric method, and is a method for detecting cell survival and growth. The detection principle is that succinate dehydrogenase in mitochondria of living cells can reduce exogenous MTT into water-insoluble blue-purple crystalline Formazan (Formazan) and deposit the blue-purple crystalline Formazan in the cells, and dead cells do not have the function. Dimethyl sulfoxide (DMSO) can dissolve formazan in cells, and its light absorption value is measured at 490nm wavelength, which can indirectly reflect living cell number. Within a certain range of cell number, MTT crystals are formed in an amount proportional to the cell number.
The experimental method comprises the following steps: RAW264.7 cells in the logarithmic growth phase were seeded in a 96-well plate (1X 104 cells/well), incubated in an incubator for 24 hours, the supernatant was aspirated by a pipette, the compound samples were diluted in equal gradients of 200-25. mu. mol/L at 4 concentrations, and the blank control group was given DMEM medium with 6 duplicate wells per concentration group. Then, after incubation in an incubator for 24 hours, 10. mu.L of MTT solution was added to each well, incubation was continued for 4 hours, the supernatant was aspirated and discarded by a pipette gun, DMSO solution was added to dissolve, after several minutes of dark reaction, the wavelength of an enzyme-labeling instrument was set to 490nm, and the absorbance value was measured.
And (3) test results:
as shown in FIG. 4, when Compound 6(Chaetoglobosin V)bCha Vb) concentration reaches 200 mu mol/L, cytotoxicity is generated to RAW264.7 cells, and cell activity is obviously reduced. Therefore, 25-100. mu. mol/L was selected as the experimental dose group for Compound 6.
2. Nitric oxide kit for detecting NO content released by RAW264.7 cells (nitrate reductase method)
The principle is as follows: NO is active chemically and is rapidly converted into NO by metabolism in vivo2-And NO3-The method utilizes the specificity of nitrate reductase to react NO3-Reduction to NO2-The concentration was measured by the color depth.
The experimental method comprises the following steps: RAW264.7 cells in a logarithmic growth phase are inoculated in a 24-well plate (1 multiplied by 105 cells/well), incubated in an incubator for 24 hours, a pipette aspirates supernatant, 25, 50 and 100 mu mol/L compound sample solutions are respectively added, a blank control group is given with DMEM medium, 1 mu g/mL LPS is given after 1 hour of drug pretreatment, and 4 duplicate wells are arranged in each group except the blank group. After incubation in the incubator for 24 hours, the culture supernatant was collected and the NO content was calculated according to the following formula in the kit instructions.
And (3) test results:
as shown in FIG. 5, the NO content in normal cells was low, but the content was significantly increased after LPS stimulation. Compared with LPS group, each dose of compound 6(Cha Vb) significantly reduced the LPS-induced intracellular NO content of RAW264.7 (P < 0.001). Table 3 below shows the inhibition rate of NO release in the anti-inflammatory test result of compound 6(Cha Vb), and it can be seen from table 3 that compound 6 has a significant effect on inhibiting NO, and the inhibition effect of compound 6 on NO gradually increases with the increase of the compound concentration, indicating that compound 6 has a better anti-inflammatory effect.
TABLE 3 anti-inflammatory assay results for Compound 6(Cha Vb).
| Group of | Amount of NO released (μmol/L) | Inhibition ratio of NO Release amount (%) |
| 0 | 59.2 | |
| LPS | 146.1 | |
| Compound 6 (25. mu.M) + LPS | 113.7 | 22 |
| Compound 6 (50. mu.M) + LPS | 110.6 | 24 |
| Compound 6 (100. mu.M) + LPS | 86.2 | 41 |
Further, the inventors compared the anti-inflammatory properties of compound 6(Cha Vb) and compound 3(Cha G) according to the above-described nitrate reductase method.
The result shows that the NO inhibition rate of the compound is gradually increased along with the increase of the compound concentration, and the NO release inhibition rate of the compound 6 is 13 to 30 percent higher than that of the compound 3 under the same concentration condition, which indicates that the compound 6 has better application value.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above examples, and any other modifications without departing from the scope of the present invention should be replaced by equivalents, and all such modifications are included in the scope of the present invention.
SEQUENCE LISTING
<110> yellow river science and technology institute
<120> a strain of Chaetomium maderaceum and application thereof
<130> none
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 539
<212> DNA
<213> Chaetomium madrasense
<400> 1
gtatagacct acctgatccg aggtcacctg gttaagattg atggtgttcg ccggcgggcg 60
ccggccgggc ctacagagcg ggtgacgaag ccccatacgc tcgaggaccg gacgcggtgc 120
cgccgctgcc tttcgggccc gccccccgga agcggggggc gagagcccaa cacacaagcc 180
gtgcttgagg gcagcaatga cgctcggaca ggcatgcccc ccggaatacc agggggcgca 240
atgtgcgttc aaagactcga tgattcactg aattctgcaa ttcacattac ttatcgcatt 300
tcgctgcgtt cttcatcgat gccggaacca agagatccgt tgttgaaagt tttaactgat 360
ttagtcaagt actcagactg caatcttcag acaagagttc gtttgtgtgt cttcggcggg 420
cgcgggcccg ggggcggatg ccccccggcg gccgtgaggc gggcccgccg aagcaacaag 480
gtacgataaa cacgggtggg aggttggacc cagagggccc tcactcggta atgatcctt 539
Claims (5)
1. A strain of Chaetomium fortunei is characterized in that the college taxonomic name of the strain is Chaetomium fortuneiChaetomium madrasense CLC375, deposited in China center for type culture Collection, with the deposition address: wuhan, Wuhan university; the preservation date is as follows: 7, month and 3 in 2019, wherein the deposit number is as follows: CCTCC M2019517.
2. The use of chaetomium madder in the preparation of an antitumor agent according to claim 1, wherein chaetomium madder is used to prepare cytochalasin-like compounds by a biofermentation method, wherein the cytochalasin-like compounds are:
when in use, the method specifically comprises the following steps:
(1) activating strains: inoculating the Chaetomium fortunei to an SDAY plate culture medium, and culturing for 5-7 days at 25-30 ℃ to obtain an activated strain;
(2) fermentation culture: inoculating the activated strain obtained in the step (1) into a rice culture medium, and performing static culture at 25-30 ℃ for 24-28 days to obtain a fermentation product;
(3) leaching with ethyl acetate: leaching the fermentation product obtained in the step (2) with ethyl acetate, and concentrating the leaching liquor to obtain a crude extract;
(4) and (3) crude extract column chromatography separation: and (4) mixing the crude extract obtained in the step (3) with dichloromethane: performing gradient elution with methanol volume ratio of 100:1, 50:1, 10:1 and 1:1 respectively, detecting by thin layer chromatography to obtain 6 fractions numbered Fr.1-Fr.6, separating by silica gel column chromatography or sephadex column chromatography to obtain crude product, and purifying by semi-preparative reverse phase high performance liquid chromatography to obtain the cytochalasin compounds.
3. The use according to claim 2, wherein the preparation of the rice medium in step (2): sterilizing 50-70g rice and 100m L water at 121 deg.C under high pressure for 25-30 min.
4. The use according to claim 2, wherein the ethyl acetate leach in step (3) is carried out as follows: adding 300mL of ethyl acetate into each part, stirring, standing for 12-16 h, filtering, repeating the leaching method for three times, combining leaching liquor obtained in the three times, and concentrating the leaching liquor under reduced pressure to obtain a crude extract.
5. The use of claim 2, wherein the tumor is human liver cancer HepG2 or human non-small cell lung cancer A549.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910745629.1A CN110438013B (en) | 2019-08-13 | 2019-08-13 | Chaetomium maderaceum and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910745629.1A CN110438013B (en) | 2019-08-13 | 2019-08-13 | Chaetomium maderaceum and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438013A CN110438013A (en) | 2019-11-12 |
| CN110438013B true CN110438013B (en) | 2021-03-26 |
Family
ID=68435067
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910745629.1A Active CN110438013B (en) | 2019-08-13 | 2019-08-13 | Chaetomium maderaceum and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438013B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114869882B (en) * | 2022-06-15 | 2024-04-19 | 黄河科技学院 | Application of homomycin in preparing antitumor drug |
| CN115181057B (en) * | 2022-07-20 | 2023-07-07 | 黄河科技学院 | Preparation method and application of chaetomium globosum compound |
| CN116283727A (en) * | 2023-03-13 | 2023-06-23 | 中国科学院海洋研究所 | Chaetoglobosin compound and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101591288A (en) * | 2009-06-26 | 2009-12-02 | 中国科学院海洋研究所 | Cytochalasin compounds and its production and use |
-
2019
- 2019-08-13 CN CN201910745629.1A patent/CN110438013B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101591288A (en) * | 2009-06-26 | 2009-12-02 | 中国科学院海洋研究所 | Cytochalasin compounds and its production and use |
Non-Patent Citations (2)
| Title |
|---|
| Armochaetoglasins A–I: Cytochalasan alkaloids from fermentation broth of Chaetomium globosum TW1-1 by feeding L-tyrosine;Weixi Gao et al.;《Phytochemistry》;20181231;第156卷;第106-115页 * |
| Nine new cytochalasan alkaloids from Chaetomium globosum TW1-1 (Ascomycota, Sordariales);Chunmei Chen et al.;《Scientific Reports》;20160107;第6卷;18711，第1-8页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438013A (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110526858B (en) | Cytochalasin compound, preparation method and application thereof | |
| CN110438013B (en) | Chaetomium maderaceum and application thereof | |
| CN107298671B (en) | Selenolonic acid H from penicillium oxalicum and application thereof in preparing medicine for resisting human colon cancer | |
| CN107353274B (en) | Selenolonic acid I from penicillium oxalicum and application thereof in preparation of human esophageal cancer resistant medicine | |
| CN107298672B (en) | Application of seclenic acid I derived from penicillium oxalicum in preparation of anti-human colon cancer drugs | |
| CN112592350B (en) | Polyketide lithocarpin E-G and preparation method and application thereof | |
| CN109336873B (en) | Compound lithocarolsA-F, preparation method thereof and application thereof in preparation of antitumor drugs | |
| CN109232513B (en) | Compound litocarpinols, preparation method thereof and application thereof in preparation of antitumor drugs | |
| Sadorn et al. | Phenolic glucosides and chromane analogs from the insect fungus Conoideocrella krungchingensis BCC53666 | |
| CN105384727A (en) | Tetramic acid compound and preparation method thereof, and application of tetramic acid compound in preparing anti-tumor and anti-viral drugs | |
| CN113444064B (en) | Xanthone compound, bacterial strain, preparation method and application | |
| CN108570025B (en) | Oxygen-containing five-membered ring pimarane diterpenoid compound, preparation method and application thereof | |
| Mayser et al. | Production of indole pigments by Candida glabrata | |
| CN114716312B (en) | Labdane diterpene compound and preparation method and application thereof | |
| Chen et al. | Phomopsischalins A–C, polycyclic-fused cytochalasins from the endophytic fungus Phomopsis sp. shj2 and their abilities to induce lysosomal function | |
| CN114213428B (en) | Indole alkaloid compound and preparation method and application thereof | |
| Kim et al. | An antifungal and plant growth promoting metabolite from a sterile dark ectotrophic fungus | |
| CN108264462B (en) | Piniane diterpenoid compound containing four-membered rings and anti-tumor application thereof | |
| CN115650854B (en) | Integrin derivative, its preparation method and application in alpha-glucosidase inhibiting medicine | |
| Di Lecce et al. | Bioactive specialized metabolites produced by the emerging pathogen Diplodia olivarum | |
| Chowdhury et al. | Isolation and partial characterization of bioactive components of Endophytic fungi Penicillium singorense, isolated from two Indian medicinal plants: Calotropis procera and Catharanthus roseus | |
| CN114605430B (en) | Macrocyclic dilactone compound, and preparation method and application thereof | |
| CN104059038A (en) | Sesquiterpene compounds and application thereof | |
| CN112694406B (en) | Preparation method and application of two dimeric hexyl itaconic acid derivatives | |
| El-Khawaga et al. | Identification and bioactive potential of endophytic fungi isolated from Calotropis procera (Ait.) R. Br |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |