CN110412005B - Dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence - Google Patents
Dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence Download PDFInfo
- Publication number
- CN110412005B CN110412005B CN201910818207.2A CN201910818207A CN110412005B CN 110412005 B CN110412005 B CN 110412005B CN 201910818207 A CN201910818207 A CN 201910818207A CN 110412005 B CN110412005 B CN 110412005B
- Authority
- CN
- China
- Prior art keywords
- dimethoate
- solution
- concentration
- product
- fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
- G01N21/643—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" non-biological material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
- G01N2021/6432—Quenching
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Optics & Photonics (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
Abstract
The invention discloses a dimethoate pesticide detection method based on aptamer controlled carbon point fluorescence, which comprises the steps of preparing a sample liquid A1 product to be detected with known dimethoate concentration; preparing a blank control solution A2 product; respectively scanning and measuring the fluorescence intensity corresponding to the emission peak of the solution at 440 nm by using a fluorescence photometer for an A1 product and an A2 product to obtain fluorescence emission spectra thereof; drawing a standard curve of the dimethoate concentration and the fluorescence intensity variation according to the fluorescence emission spectrum; establishing a regression equation related to the correlation between the concentration of the dimethoate and the fluorescence intensity according to a standard curve; preparing a solution C to be detected with unknown dimethoate concentration; and (3) scanning the product C by using a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the fluorescence intensity difference value of the product C and the product A2, and substituting the difference value into a linear regression equation to obtain the concentration of the dimethoate in the product C. The method has the advantages of convenience in construction, high sensitivity, good specificity and the like.
Description
Technical Field
The invention relates to a dimethoate pesticide detection method, in particular to a dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence.
Background
Because of its good effect of quick killing pests and mites, dimethoate is widely used in crops such as fruits, vegetables and cotton, and is one of the organophosphorus pesticides widely used. However, while the crop yield is increased, the dimethoate and the residue thereof can cause pollution to the environment and seriously threaten the health of human beings. Dimethoate can enter human tissues through skin contact and other ways, so that acute or chronic poisoning can be caused, and death can be caused when serious. Therefore, the research on the efficient and sensitive pesticide residue detection method has important significance for protecting the environmental safety and the human health. In order to achieve detection of dimethoate residue in a sample of agricultural products, a variety of conventional detection methods have been established including Gas Chromatography (GC), High Performance Liquid Chromatography (HPLC), liquid chromatography-mass spectrometry (LC-MS). Although these methods have the advantages of low detection limit, high sensitivity, etc., there still exist some problems, such as time consumption, high cost, cumbersome operation, difficulty, etc.
Disclosure of Invention
The invention aims to provide a dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence. The method uses nontoxic carbon spots as signal molecules and nano silver as a quenching agent, does not need any grafting and modification, and combines the aptamer technology, thereby not only overcoming the traditional defects, but also simply, conveniently and reliably constructing the fluorescent aptamer sensor and improving the specificity and sensitivity of detection. The method has the advantages of convenience in construction, high sensitivity, good specificity and the like, and can be applied to rapid detection of dimethoate residues in agricultural products.
The technical scheme of the invention is as follows: a dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence comprises the following steps:
a: drawing a standard curve of dimethoate concentration and fluorescence intensity variation
A1: preparing a sample solution to be detected with known dimethoate concentration to obtain A1 product;
a2: preparing blank control solution to obtain A2 product;
a3: respectively scanning A1 product and A2 product with a fluorescence photometer to determine F and F as fluorescence intensities corresponding to emission peak at 440 nm0And obtaining a fluorescence emission spectrum thereof;
a4: obtaining a standard curve of the dimethoate concentration and the fluorescence intensity variation according to the fluorescence emission spectrum;
B. establishing a regression equation related to the correlation between the dimethoate concentration and the fluorescence intensity according to the standard curve of the dimethoate concentration and the fluorescence intensity variation;
c: preparing a solution to be detected with unknown dimethoate concentration to obtain a product C;
d: and (3) scanning the product C by using a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the fluorescence intensity difference value of the product C and the product A2, and substituting the fluorescence intensity difference value into a linear regression equation to obtain the concentration of the dimethoate in the product C.
In the dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence, the specific method for drawing the standard curve of dimethoate concentration and fluorescence intensity variation comprises the following steps:
a1: taking a plurality of graduated centrifuge tubes, adding a dimethoate standard solution and a dimethoate aptamer with known concentration into each graduated centrifuge tube, uniformly mixing, incubating, adding a nano-silver AgNPs solution, uniformly mixing, incubating, adding a carbon dot CDs solution and a salt ion solution, and uniformly mixing to obtain a sample solution to be detected, namely A1 product;
a2: taking 1 graduated centrifuge tube, replacing dimethoate standard solution with double distilled water with known concentration, and preparing blank control solution A2 product according to the method of A1;
a3: respectively scanning and measuring the fluorescence intensity corresponding to the emission peak of the solution at 440 nm by using a fluorescence photometer for an A1 product and an A2 product to obtain fluorescence emission spectra thereof;
a4: according to the absorption spectrum, the fluorescence intensity difference between A1 products and A2 products with different concentrations is taken as the ordinate, and the dimethoate concentration is taken as the abscissa to draw a dimethoate concentration and fluorescence intensity variation standard curve;
in the step B, when the concentration of the dimethoate is more than or equal to 6 mug/L and less than or equal to 200 mug/L, the regression equation of the correlation between the concentration and the fluorescence intensity is as follows: y =0.5961C + 2.02737;
y is the fluorescence intensity difference = A2 fluorescence intensity of the sample containing dimethoate;
the specific method for preparing the solution C to be detected with unknown dimethoate concentration comprises the following steps:
C. and (3) replacing the dimethoate standard solution with known concentration with the actual sample solution, and preparing the solution to be tested with unknown dimethoate concentration as product C according to the method A1.
In the dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence, the concentration of the salt ion solution is 15 mM; the concentration of the nano-silver AgNPs solution is 0.38 nM; the concentration of the carbon dot CDs solution was 5. mu.g/mL.
In the dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence, the sequence of the dimethoate aptamer is as follows: 5'-AGCTTGCTGCAGCGATTCTTGATCGCCACAG AGCT-3' at a concentration of 30 nM.
In the dimethoate pesticide detection method based on aptamer controlled carbon dot fluorescence, the preparation method of the carbon dot CDs solution comprises the following steps: the following proportions were prepared, 1.26 g of solid citric acid: 1608 μ L of liquid ethylenediamine: 30 mL of double distilled water, solid citric acid and liquid ethylenediamine were dissolved in the double distilled water, the solution was transferred to a Teflon lined autoclave and heated at 180 ℃ for 5 h, then the solution was dialyzed at MW 300, then dried in a 80 ℃ vacuum oven for 8-12 h to a solid, and finally double distilled water was added to make a stock solution with a concentration of 0.5 mg/mL and stored at 4 ℃ for use.
In the dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence, the specific method for obtaining the fluorescence emission spectrum in the step a3 and the step D comprises the following steps: placing the to-be-detected product in a quartz dish, and scanning and measuring the fluorescence intensity corresponding to the emission peak of the solution at 440 nm by using an F-4600 fluorescence photometer to obtain the fluorescence emission spectrum of the to-be-detected product, wherein the wavelength scanning range is 400-600 nm.
In the dimethoate pesticide detection method based on aptamer controlled carbon dot fluorescence, in the preparation process of the A1 product, the A2 product or the C product: adding a dimethoate standard solution with a known concentration, double distilled water or an actual sample solution into a graduated centrifuge tube, uniformly mixing the dimethoate standard solution with the dimethoate aptamer, incubating for 8-15 min at the temperature of 28-32 ℃, then adding a nano silver AgNPs solution, uniformly mixing, incubating for 8-15 min at the temperature of 28-32 ℃, finally adding a carbon point CDs solution, a salt ion solution and double distilled water, uniformly mixing, and incubating for 28-35 min at the temperature of 28-32 ℃.
In the dimethoate pesticide detection method based on aptamer controlled carbon dot fluorescence, in the preparation process of the A1 product, the A2 product or the C product: the dosage of the dimethoate standard solution, the redistilled water, the actual sample solution and the dimethoate aptamer with known concentration is 5.0 mu L; the dosage of the nano-silver AgNPs solution is 150.0 mu L; the dosage of the salt ion solution is 25.0 mu L; the dosage of the carbon dot CDs solution is 5.0 mu L; finally 310.0. mu.L of double distilled water was added to give a final volume of 500. mu.L.
In the dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence, the salt ion solution is NaCI solution.
In the dimethoate pesticide detection method based on aptamer carbon spot fluorescence regulation, before the dimethoate aptamer is used, the aptamer is dissolved in double distilled water, is subjected to denaturation treatment at 90 ℃ for 5 minutes, and is then cooled to room temperature.
The invention has the beneficial effects that: compared with the prior art, the detection principle of the method is as follows: in the system, the aptamer cannot interact with the nano-silver, so that the nano-silver is aggregated under the condition of high-concentration salt ion concentration, the absorption spectrum of the nano-silver is changed, so that the fluorescence of a carbon point added subsequently cannot be quenched, and at the moment, the whole system emits blue fluorescence. When the dimethoate is added into a detection system, the aptamer can be specifically combined with the dimethoate pesticide, and dimethoate molecules can form coordinate bonds with silver atoms on the surface of the nano silver, so that the electronegativity of the surface of the nano silver is further enhanced, and the dimethoate can stably exist in a high-concentration salt ion system. At the moment, the nano silver in the dispersed state can quench the fluorescence signal of the carbon dots added subsequently through the fluorescence resonance energy transfer effect, and the change of the fluorescence intensity is in direct proportion to the concentration of the dimethoate, so that the method can be used for dimethoate detection. The method realizes the recovery rate of 91.6-108.6% in the actual sample detection of agricultural products. The method can specifically detect the dimethoate in the interference of the acephate bromide, the acetamiprid, the methyl parathion, the phoxim, the paraquat, the dichlorvos, the omethoate, the phorate and the like.
Drawings
FIG. 1 is a schematic representation of the feasibility of Dimethoate detection;
FIG. 2 is a schematic diagram of Dimethoate detection;
FIG. 3 shows the fluorescence change (F) of dimethoate solutions of different concentrations0-a correspondence of F);
FIG. 4 is a schematic diagram showing the effect of other pesticides on Dimethoate detection;
FIG. 5 is a schematic diagram showing the detection of Dimethoate in an actual sample.
FIGS. 1 and 2 show the principle conjecture and feasibility study of the invention, which indicates that the method of the invention can be used for dimethoate detection.
In FIG. 1, point 1-carbon; 2-nano silver + carbon dots; 3-aptamer + nano silver + carbon dots + sodium chloride; 4-100 mug/L of dimethoate, aptamer, nano silver, carbon dots and sodium chloride; 5-200 mug/L of dimethoate, aptamer, nano silver, carbon dots and sodium chloride; 6-500 mug/L of dimethoate, aptamer, nano silver, carbon dots and sodium chloride;
FIG. 3 shows that the linear range of the invention is 6-200 mug/L, and the lowest detection limit is 2.24 mug/L, which shows that the invention has the characteristics of good stability and high sensitivity.
As can be seen in FIG. 4, the method established by the invention can specifically detect Dimethoate, and other competitive targets hardly interfere with the detection of Dimethoate.
As shown in the attached figure 5, the method disclosed by the invention is used for determining that 4 samples of wheat, apples, hot peppers and tomatoes are purchased in a local supermarket, and the recovery rate of the kola nuts is 91.6-108.6% by respectively adding 100 mug/L, 200 mug/L and 500 mug/L of kola nuts into the samples, thereby proving the reliability of the method.
Detailed Description
The invention is further illustrated by the following figures and examples, which are not to be construed as limiting the invention.
Example 1 of the invention: a dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence comprises the following steps:
a: drawing a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity, wherein the standard curve is shown as the attached figure 3, and the standard curve comprises the following steps:
a1: preparing sample solution to be tested with known dimethoate concentration to obtain A1 product. The concrete mode is as follows: taking 11 1.5 mL graduated centrifuge tubes, adding 5.0 μ L of a known concentration dimethoate standard solution and 5.0 μ L of a 30 nM dimethoate aptamer solution into each graduated centrifuge tube, mixing the solutions uniformly, incubating the mixture at 28 ℃ for 15 min, adding 150.0 μ L of a 0.38 nM nano silver AgNPs solution, mixing the solutions uniformly, incubating the mixture at 28 ℃ for 15 min, adding 5.0 μ L of a 5 μ g/mL carbon spot CDs solution, 25.0 μ L of a 15 mM NaCl salt ion solution and 310.0 μ L double distilled water, mixing the solutions uniformly, and incubating the mixture at 28 ℃ for 35 min to prepare a 500.0 μ L solution to be detected, which is A1.
A2: a blank control solution was prepared to obtain sample A2. The concrete mode is as follows: and (3) taking 1.5 mL graduated centrifuge tube, replacing the dimethoate standard solution with 5.0 mu L of double distilled water with the same volume, and preparing a blank control solution A2 product according to the method in the step A1.
A3: placing 11 samples A1 of sample solution to be detected with different dimethoate concentrations and 1 sample A2 of blank control solution in a quartz cuvette special for a 0.75 mL fluorescence photometer, scanning with an F-4600 fluorescence photometer at an excitation wavelength of 360 nm to obtain fluorescence intensities corresponding to emission peaks of the solution at 440 nm, which are respectively marked as F and F0And obtaining the fluorescence emission spectrum. The wavelength scanning range in the whole scanning process is 400-600 nm.
A4: and obtaining a standard curve of the dimethoate concentration and the fluorescence intensity variation according to the fluorescence emission spectrum. The specific drawing method comprises the following steps: based on the absorption spectra, the difference in fluorescence intensity (F) between A1 and A2 samples at different concentrations0-F) is used as an ordinate, and the concentration of the dimethoate is used as an abscissa to draw a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity.
B. And establishing a regression equation related to the correlation between the dimethoate concentration and the fluorescence intensity according to the standard curve of the dimethoate concentration and the fluorescence intensity variation. When the concentration C of the dimethoate is more than or equal to 6 mu g/L and less than or equal to 200 mu g/L, the regression equation of the correlation between the concentration and the fluorescence intensity is as follows: y =0.5961C + 2.02737. y is the difference in fluorescence intensity (i.e., F)0-F) = fluorescence intensity of a2 article-fluorescence intensity of a dimethoate-containing test article. Therefore, the concentration of the dimethoate in the A1 sample is ensured to be maintained at 6-200 mug/L during preparation of the sample solution A1 to be detected.
C: and preparing a wheat solution to be detected with unknown dimethoate concentration to obtain a product C. The specific method comprises the following steps: and (3) carrying out ultrasonic extraction on the crushed wheat by using anhydrous methanol, and diluting the extract by 10 times by using secondary distilled water to obtain an actual sample solution. And replacing the dimethoate standard solution with known concentration with the actual sample solution with the same volume, and preparing the solution to be tested with unknown dimethoate concentration, namely the product C, according to the method A1.
D: and (3) scanning the product C by using a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the fluorescence intensity difference value of the product C and the product A2, and substituting the fluorescence intensity difference value into a linear regression equation to obtain the concentration of the dimethoate in the product C.
Example 2 of the invention: a dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence comprises the following steps:
a: drawing a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity, wherein the standard curve is shown as the attached figure 3, and the standard curve comprises the following steps:
a1: preparing sample solution to be tested with known dimethoate concentration to obtain A1 product. The concrete mode is as follows: taking 11 1.5 mL graduated centrifuge tubes, adding 5.0 μ L of a known concentration dimethoate standard solution and 5.0 μ L of a 30 nM dimethoate aptamer solution into each graduated centrifuge tube, fully mixing, incubating for 10 min at 30 ℃, adding 150.0 μ L of a 0.38 nM nano silver AgNPs solution, fully mixing, incubating for 10 min at 30 ℃, finally adding 5.0 μ L of a 5 μ g/mL carbon spot CDs solution, 25.0 μ L of a 15 mM NaCl salt ion solution and 310.0 μ L double distilled water, fully mixing, and incubating for 30 min at 30 ℃, thus preparing 500.0 μ L of a solution to be tested, which is A1.
A2: a blank control solution was prepared to obtain sample A2. The concrete mode is as follows: and (3) taking 1.5 mL graduated centrifuge tube, replacing the dimethoate standard solution with 5.0 mu L of double distilled water with the same volume, and preparing a blank control solution A2 product according to the method in the step A1.
A3: placing 11 samples A1 of sample solution to be tested with different dimethoate concentrations and 1 sample A2 of blank control solution in a quartz cuvette special for a 0.75 mL fluorescence photometer, and scanning with an F-4600 fluorescence photometer at an excitation wavelength of 360 nm to obtain an emission peak of the solution at 440 nmThe corresponding fluorescence intensities, denoted F and F, respectively0And obtaining the fluorescence emission spectrum. The wavelength scanning range in the whole scanning process is 400-600 nm.
A4: and obtaining a standard curve of the dimethoate concentration and the fluorescence intensity variation according to the fluorescence emission spectrum. The specific drawing method comprises the following steps: based on the absorption spectra, the difference in fluorescence intensity (F) between A1 and A2 samples at different concentrations0-F) is used as an ordinate, and the concentration of the dimethoate is used as an abscissa to draw a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity.
B. And establishing a regression equation related to the correlation between the dimethoate concentration and the fluorescence intensity according to the standard curve of the dimethoate concentration and the fluorescence intensity variation. When the concentration of the dimethoate is more than or equal to 6 mu g/L and less than or equal to 200 mu g/L, the regression equation of the correlation between the concentration and the fluorescence intensity is as follows: y =0.5961C + 2.02737; y is the difference in fluorescence intensity (i.e., F)0-F) = fluorescence intensity of a2 article-fluorescence intensity of a dimethoate-containing test article. Therefore, the concentration of the dimethoate in the A1 sample is ensured to be maintained at 6-200 mug/L during preparation of the sample solution A1 to be detected.
C: and preparing to-be-detected wheat and apple solutions with unknown dimethoate concentrations to obtain a product C. The specific method comprises the following steps: and (3) performing ultrasonic extraction on the crushed wheat and apple by using anhydrous methanol respectively, and diluting the extract by 10 times by using secondary distilled water to obtain actual sample liquid. And replacing the dimethoate standard solution with known concentration with the actual sample solution with the same volume, and preparing the solution to be tested with unknown dimethoate concentration, namely the product C, according to the method A1.
D: and (3) scanning the product C by using a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the fluorescence intensity difference value of the product C and the product A2, and substituting the fluorescence intensity difference value into a linear regression equation to obtain the concentration of the dimethoate in the product C.
Example 3 of the invention: a dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence comprises the following steps:
a: drawing a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity, wherein the standard curve is shown as the attached figure 3, and the standard curve comprises the following steps:
a1: preparing sample solution to be tested with known dimethoate concentration to obtain A1 product. The concrete mode is as follows: taking 11 1.5 mL graduated centrifuge tubes, adding 5.0 μ L of a known concentration dimethoate standard solution and 5.0 μ L of a 30 nM dimethoate aptamer solution into each graduated centrifuge tube, fully mixing, incubating for 10 min at 30 ℃, adding 150.0 μ L of a 0.38 nM nano silver AgNPs solution, fully mixing, incubating for 10 min at 30 ℃, finally adding 5.0 μ L of a 5 μ g/mL carbon spot CDs solution, 25.0 μ L of a 15 mM NaCl salt ion solution and 310.0 μ L double distilled water, fully mixing, and incubating for 30 min at 30 ℃, thus preparing 500.0 μ L of a solution to be tested, which is A1.
A2: a blank control solution was prepared to obtain sample A2. The concrete mode is as follows: and (3) taking 1.5 mL graduated centrifuge tube, replacing the dimethoate standard solution with 5.0 mu L of double distilled water with the same volume, and preparing a blank control solution A2 product according to the method in the step A1.
A3: placing 11 samples A1 of sample solution to be detected with different dimethoate concentrations and 1 sample A2 of blank control solution in a quartz cuvette special for a 0.75 mL fluorescence photometer, scanning with an F-4600 fluorescence photometer at an excitation wavelength of 360 nm to obtain fluorescence intensities corresponding to emission peaks of the solution at 440 nm, which are respectively marked as F and F0And obtaining the fluorescence emission spectrum. The wavelength scanning range in the whole scanning process is 400-600 nm.
A4: and obtaining a standard curve of the dimethoate concentration and the fluorescence intensity variation according to the fluorescence emission spectrum. The specific drawing method comprises the following steps: based on the absorption spectra, the difference in fluorescence intensity (F) between A1 and A2 samples at different concentrations0-F) is used as an ordinate, and the concentration of the dimethoate is used as an abscissa to draw a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity.
B. And establishing a regression equation related to the correlation between the dimethoate concentration and the fluorescence intensity according to the standard curve of the dimethoate concentration and the fluorescence intensity variation. When the concentration of the dimethoate is more than or equal to 6 mu g/L and less than or equal to 200 mu g/L, the regression equation of the correlation between the concentration and the fluorescence intensity is as follows: y =0.5961C + 2.02737; y is the difference in fluorescence intensity (i.e., F)0-F) = fluorescence intensity of a2 article-fluorescence intensity of a dimethoate-containing test article. Therefore, it is testedThe sample solution A1 should be prepared in such a way that the concentration of Dimethoate in A1 sample solution is maintained at 6-200 μ g/L.
C: preparing to-be-tested solution of Capsici fructus and fructus Lycopersici Esculenti with unknown Dimethoate concentration to obtain product C. The specific method comprises the following steps: the capsicum and the tomato are respectively extracted by ultrasonic by using anhydrous methanol, and the extract is diluted by 10 times by using secondary distilled water to obtain actual sample liquid. And replacing the dimethoate standard solution with known concentration with the actual sample solution with the same volume, and preparing the solution to be tested with unknown dimethoate concentration, namely the product C, according to the method A1.
D: and (3) scanning the product C by using a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the fluorescence intensity difference value of the product C and the product A2, and substituting the fluorescence intensity difference value into a linear regression equation to obtain the concentration of the dimethoate in the product C.
Example 4 of the invention: a dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence comprises the following steps:
a: drawing a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity, wherein the standard curve is shown as the attached figure 3, and the standard curve comprises the following steps:
a1: preparing sample solution to be tested with known dimethoate concentration to obtain A1 product. The concrete mode is as follows: taking 11 1.5 mL graduated centrifuge tubes, adding 5.0 μ L of a known concentration dimethoate standard solution and 5.0 μ L of a 30 nM dimethoate aptamer solution into each graduated centrifuge tube, mixing the solutions uniformly, incubating the mixture at 32 ℃ for 8 min, adding 150.0 μ L of a 0.38 nM nano silver AgNPs solution, mixing the solutions uniformly, incubating the mixture at 32 ℃ for 8 min, adding 5.0 μ L of a 5 μ g/mL carbon spot CDs solution, 25.0 μ L of a 15 mM NaCI salt ion solution and 310.0 μ L double distilled water, mixing the solutions uniformly, and incubating the mixture at 32 ℃ for 28 min to prepare a 500.0 μ L solution to be tested, which is A1.
A2: a blank control solution was prepared to obtain sample A2. The concrete mode is as follows: and (3) taking 1.5 mL graduated centrifuge tube, replacing the dimethoate standard solution with 5.0 mu L of double distilled water with the same volume, and preparing a blank control solution A2 product according to the method in the step A1.
A3: make 11 different musicPlacing sample solution A1 product with fruit concentration to be measured and 1 blank control solution A2 product in a quartz cuvette special for a 0.75 mL fluorescence photometer, scanning with an F-4600 fluorescence photometer at an excitation wavelength of 360 nm to obtain fluorescence intensities corresponding to emission peaks of the solutions at 440 nm, and respectively recording as F and F0And obtaining the fluorescence emission spectrum. The wavelength scanning range in the whole scanning process is 400-600 nm.
A4: and obtaining a standard curve of the dimethoate concentration and the fluorescence intensity variation according to the fluorescence emission spectrum. The specific drawing method comprises the following steps: based on the absorption spectra, the difference in fluorescence intensity (F) between A1 and A2 samples at different concentrations0-F) is used as an ordinate, and the concentration of the dimethoate is used as an abscissa to draw a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity.
B. And establishing a regression equation related to the correlation between the dimethoate concentration and the fluorescence intensity according to the standard curve of the dimethoate concentration and the fluorescence intensity variation. When the concentration of the dimethoate is more than or equal to 6 mu g/L and less than or equal to 200 mu g/L, the regression equation of the correlation between the concentration and the fluorescence intensity is as follows: y =0.5961C + 2.02737; y is the difference in fluorescence intensity (i.e., F)0-F) = fluorescence intensity of a2 article-fluorescence intensity of a dimethoate-containing test article. Therefore, the concentration of the dimethoate in the A1 sample is ensured to be maintained at 6-200 mug/L during preparation of the sample solution A1 to be detected.
C: and preparing a tomato solution to be tested with unknown dimethoate concentration to obtain product C. The specific method comprises the following steps: carrying out ultrasonic extraction on tomatoes by using anhydrous methanol, and diluting the extract by 10 times by using secondary distilled water to obtain an actual sample solution. And replacing the dimethoate standard solution with known concentration with the actual sample solution with the same volume, and preparing the solution to be tested with unknown dimethoate concentration, namely the product C, according to the method A1.
D: and (3) scanning the product C by using a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the fluorescence intensity difference value of the product C and the product A2, and substituting the fluorescence intensity difference value into a linear regression equation to obtain the concentration of the dimethoate in the product C.
In the above examples, the preparation method of the carbon dot CDs solution used was: the following proportions were prepared, 1.26 g of solid citric acid: 1608 μ L of liquid ethylenediamine: 30 mL of double distilled water, 1.26 g of solid citric acid and 1608. mu.L of liquid ethylenediamine were dissolved in 30 mL of double distilled water, and then the solution was transferred to a Teflon-lined autoclave and heated at 180 ℃ for 5 hours, and then the solution was dialyzed at MW 300, and then dried in a vacuum oven at 80 ℃ for 8 to 12 hours to become solid, and finally double distilled water was added to prepare a stock solution having a concentration of 0.5 mg/mL and stored at 4 ℃ for use.
In the above examples, the dimethoate aptamer (SS-24-S-35) was synthesized and purified by Shanghai Biotech, Inc., having the sequence of 5'-AGCTTGCTGCAGCGATTCTTGATCGCCACAG AGCT-3'. Prior to use, the dimethoate aptamer was dissolved in double distilled water and subjected to vigorous denaturation treatment at 90 ℃ for 5 minutes, and then cooled to room temperature (25-30 ℃) to give a dimethoate aptamer solution with a concentration of 30 nM.
Sequence listing
<110> Guizhou university
<120> dimethoate pesticide detection method based on aptamer controlled carbon dot fluorescence
<130> 1
<160> 1
<210> 1
<211> 35
<212> DNA
<213> Artificial Synthesis
<400> 1
AGCTTGCTGCAGCGATTCTTGATCGCCACAGAGCT
Claims (5)
1. A dimethoate pesticide detection method based on aptamer controlled carbon spot fluorescence is characterized by comprising the following steps: the method comprises the following steps:
a: drawing a standard curve of dimethoate concentration and fluorescence intensity variation; the drawing method comprises the following steps:
a1: taking a plurality of graduated centrifuge tubes, adding a dimethoate standard solution and a dimethoate aptamer with known concentration into each graduated centrifuge tube, uniformly mixing, incubating, adding a nano-silver AgNPs solution, uniformly mixing, incubating, adding a carbon dot CDs solution and a salt ion solution, and uniformly mixing to obtain a sample solution to be detected, namely A1 product; the sequence of the adopted dimethoate aptamer is shown as Seq ID No. 1;
the preparation of the carbon point CDs solution can be obtained by the following method:
0. preparing materials: 1.26 g solid citric acid, 1608. mu.L liquid ethylenediamine and 30 mL double distilled water, 1.26 g solid lemon
Acid and 1608. mu.L liquid ethylenediamine were dissolved in 30 mL of bi-distilled water, and the solution was then transferred to a Teflon lined ceiling
Heating at 180 deg.C for 5 hr, dialyzing at MW of 300, and placing
Drying in 80 deg.C vacuum oven for 8-12 hr to obtain solid, and adding double distilled water to obtain stock solution with concentration of 0.5 mg/mL
Storing the solution at 4 ℃ for use;
a2: taking a centrifuge tube, replacing dimethoate standard solution with known concentration by using double distilled water, and preparing a blank reference solution which is A2 product according to the method of A1;
a3: respectively scanning and measuring the fluorescence intensity corresponding to the emission peak of the solution at 440 nm by using a fluorescence photometer for an A1 product and an A2 product to obtain fluorescence emission spectra thereof;
a4: according toFluorescence emission SpectroscopyDrawing a standard curve of the concentration of the dimethoate and the change amount of the fluorescence intensity by taking the difference of the fluorescence intensity between A1 products and A2 products with different concentrations as the ordinate and the concentration of the dimethoate as the abscissa
B. Establishing correlation between dimethoate concentration and fluorescence intensity according to standard curve of dimethoate concentration and fluorescence intensity variationLinear regression equation；
C: preparation ofTo be measuredObtaining a solution to be detected of dimethoate concentration to obtain a product C; when preparing product C, the dimethoate standard solution with known concentration is replaced by the actual sample solution, and the product A1 can be prepared according to the method for preparing product A1 in step ATo be measuredThe solution to be tested with the dimethoate concentration can be a product C;
d: scanning sample C with a fluorescence photometer to measure the fluorescence intensity corresponding to the emission peak of the solution at 440 nm, calculating the difference between the fluorescence intensity of sample C and that of sample A2, and comparing the fluorescence intensity of sample C with that of sample A2The difference in fluorescence intensity is substituted into that obtained in step BLinear regression equationAnd (4) obtaining the concentration of the dimethoate in the product C.
2. The dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence as claimed in claim 1, characterized in that: in the step B, when the concentration of the dimethoate is more than or equal to 6 mu g/L and less than or equal to 200 mu g/L, the correlation between the concentration and the fluorescence intensity isLinear regression equationComprises the following steps: y =0.5961C + 2.02737;
y is the difference in fluorescence intensity = fluorescence intensity of A2 article-fluorescence intensity of the sample containing Dimethoate.
3. The dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence as claimed in claim 1, characterized in that: the concentration of the salt ion solution is 10-25 mM; the concentration of the nano-silver AgNPs solution is 0.38-0.55 nM; the concentration of the carbon dot CDs solution is 2-7 mug/mL.
4. The dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence as claimed in claim 1, characterized in that: in the preparation process of the product A1, the product A2 or the product C: adding a dimethoate standard solution with a known concentration, double distilled water or an actual sample solution into a graduated centrifuge tube, uniformly mixing the dimethoate standard solution with the dimethoate aptamer, incubating for 8-15 min at the temperature of 28-32 ℃, then adding a nano silver AgNPs solution, uniformly mixing, incubating for 8-15 min at the temperature of 28-32 ℃, then adding a carbon point CDs solution, a salt ion solution and double distilled water, uniformly mixing, and incubating for 28-35 min at the temperature of 28-32 ℃.
5. The dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence as claimed in claim 1, characterized in that: in the preparation process of the product A1, the product A2 or the product C: the dosage of the dimethoate standard solution, the redistilled water, the actual sample solution and the dimethoate aptamer with known concentration is 5.0 mu L; the dosage of the nano-silver AgNPs solution is 150.0 mu L; the dosage of the salt ion solution is as follows: 25.0 μ L; the dosage of the carbon dot CDs solution is 5.0 mu L; finally 310.0. mu.L of double distilled water was added to give a final volume of 500. mu.L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910818207.2A CN110412005B (en) | 2019-08-30 | 2019-08-30 | Dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910818207.2A CN110412005B (en) | 2019-08-30 | 2019-08-30 | Dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110412005A CN110412005A (en) | 2019-11-05 |
| CN110412005B true CN110412005B (en) | 2022-01-28 |
Family
ID=68369457
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910818207.2A Active CN110412005B (en) | 2019-08-30 | 2019-08-30 | Dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110412005B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111573652B (en) * | 2020-05-19 | 2021-10-22 | 四川农业大学 | Preparation of chicken feather nitrogen-doped carbon quantum dot and fluorescent probe and paraquat detection method |
| CN114199799A (en) * | 2021-11-24 | 2022-03-18 | 江苏大学 | Method for visually and rapidly detecting malathion by using fluorescence/colorimetric bimodal sensor |
| CN116640571B (en) * | 2023-05-31 | 2023-12-01 | 广东工业大学 | Fluorescent carbon dot, preparation method thereof and application thereof in detection of Dimethoate |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104849268A (en) * | 2015-05-21 | 2015-08-19 | 南京理工大学 | Aptamer wrapped gold nanoparticle probe-based reagent for colorimetric detection of omethoate and application of reagent |
| CN107561069A (en) * | 2017-08-28 | 2018-01-09 | 贵州大学 | A kind of method of the distinguishable colorimetric detection Rogor of naked eyes |
| CN109520981A (en) * | 2018-11-15 | 2019-03-26 | 贵州大学 | A kind of Acetamiprid Pesticides Testing method based on carbon dots fluorescence inner filtering effect |
-
2019
- 2019-08-30 CN CN201910818207.2A patent/CN110412005B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104849268A (en) * | 2015-05-21 | 2015-08-19 | 南京理工大学 | Aptamer wrapped gold nanoparticle probe-based reagent for colorimetric detection of omethoate and application of reagent |
| CN107561069A (en) * | 2017-08-28 | 2018-01-09 | 贵州大学 | A kind of method of the distinguishable colorimetric detection Rogor of naked eyes |
| CN109520981A (en) * | 2018-11-15 | 2019-03-26 | 贵州大学 | A kind of Acetamiprid Pesticides Testing method based on carbon dots fluorescence inner filtering effect |
Non-Patent Citations (4)
| Title |
|---|
| A colorimetric sensor based on citrate-stabilized AuNPs for rapidpesticide residue detection of terbuthylazine and dimethoate;Ningyi Chen 等;《Sensors and Actuators B》;20170928;全文 * |
| A novel fluorescent aptasensor for ultrasensitive and selective detection of acetamiprid pesticide based on the inner filter effect between gold nanoparticles and carbon dots;Jinlong Wang 等;《Analyst》;20181231;全文 * |
| Selective determination of dimethoate via fluorescence resonance energy transfer between carbon dots and a dye-doped molecularly imprinted polymer;Shuhuai Li 等;《Sensors andActuators B》;20140919;全文 * |
| 核酸适配体生物传感技术在食品污染物检测中的应用;梁刚 等;《食品安全质量检测学报》;20170831;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110412005A (en) | 2019-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110412005B (en) | Dimethoate pesticide detection method based on aptamer-controlled carbon dot fluorescence | |
| Ouyang et al. | A highly sensitive detection of carbendazim pesticide in food based on the upconversion-MnO2 luminescent resonance energy transfer biosensor | |
| Huang et al. | Simultaneous analysis of serotonin, melatonin, piceid and resveratrol in fruits using liquid chromatography tandem mass spectrometry | |
| Atrott et al. | Studies on the formation of methylglyoxal from dihydroxyacetone in Manuka (Leptospermum scoparium) honey | |
| Qin et al. | A ratiometric supramolecular fluorescent probe for on-site determination of cyfluthrin in real food samples | |
| Esquivel et al. | Phenolic compound profiles and their corresponding antioxidant capacity of purple pitaya (Hylocereus sp.) genotypes | |
| US10126245B1 (en) | Method for representing quality change process of beef fat during repeated freezing and thawing through Raman spectrum | |
| AU2020101288A4 (en) | Method and System for Quantitatively Detecting Copper in Rice Leaves | |
| Zhang et al. | Effect of sonication on eliminating of phorate in apple juice | |
| CN110441280B (en) | Method for detecting tetracycline and clenbuterol by carbon dot-rhodamine B double-fluorescent system proportion fluorescent probe | |
| Xiao-Yue et al. | Application progress of fluorescent carbon quantum dots in food analysis | |
| Bertogna et al. | Acute stress in seedlings detected by ultra-weak photon emission | |
| CN114460054B (en) | Quantum dot-MXene fluorescent sensor and preparation method and application thereof | |
| Hu et al. | A new fluorescent biosensor based on inner filter effect and competitive coordination with the europium ion of non-luminescent Eu-MOF nanosheets for the determination of alkaline phosphatase activity in human serum | |
| Roughley et al. | Reduction of acetylene by nodules of Trifolium subterraneum as affected by root temperature, Rhizobium strain and host cultivar | |
| Gudkov et al. | Modern physical methods and technologies in agriculture | |
| US20230304984A1 (en) | A method for the early detection of potato bacterial diseases based on characterizing volatile signatures | |
| CN113109406B (en) | Method for constructing electrochemiluminescence aptamer sensor for omethoate detection | |
| CN108613954B (en) | Detection method of carbendazim | |
| Skoczowski et al. | Isothermal calorimetry and Raman spectroscopy to study response of plants to abiotic and biotic stresses | |
| Kitts et al. | Chemistry and genotoxicity of caramelized sucrose | |
| Hutchings et al. | Analytical methods for the analysis of bromoform in red seaweed Asparagopsis armata and Asparagopsis taxiformis–A review | |
| CN109852389B (en) | Preparation method and application of fluorescence sensor for detecting ochratoxin A | |
| Hasegawa et al. | Metabolism of limonin and limonoate by microorganisms. Conversion to nonbitter compounds | |
| CN109520981A (en) | A kind of Acetamiprid Pesticides Testing method based on carbon dots fluorescence inner filtering effect |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |