CN110358783A - Recombinant plasmid, recombination engineering and its application - Google Patents
Recombinant plasmid, recombination engineering and its application Download PDFInfo
- Publication number
- CN110358783A CN110358783A CN201910574311.1A CN201910574311A CN110358783A CN 110358783 A CN110358783 A CN 110358783A CN 201910574311 A CN201910574311 A CN 201910574311A CN 110358783 A CN110358783 A CN 110358783A
- Authority
- CN
- China
- Prior art keywords
- recombinant plasmid
- cell
- ifn
- interferon
- enhance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/565—IFN-beta
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/57—IFN-gamma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Toxicology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention provides a kind of recombinant plasmid, recombination engineering and its application that cell factor can be made more preferably to play effect.The recombinant plasmid includes the gene of the gene of cell factor interconnected, enhance-like element sequence and cell-penetrating peptide, and enhance-like element sequence is at least one of SEQ ID No:1-4.The encoding gene of enhance-like element sequence and cell-penetrating peptide is connected with each other by the present invention, form new enhance-like element sequence, after in conjunction with foreign gene, the recombinant plasmid of formation can be obviously improved the transcription rate of foreign gene and the yield of expression product, promote the uptake ratio of target cell, the effect of to Enhanced expressing product, the cell factor of external source is enable preferably to play effect.
Description
Technical field
The present invention relates to field of biotechnology, in particular to a kind of recombinant plasmid, recombination engineering and its application.
Background technique
Interferon (interferon, INF) be body by particular stimulation when a kind of cell factor for generating.According to its base
Because of the difference of sequence, chromosome mapping and receptor-specific, interferon can be divided into 3 types: i.e. I type (including IFN-α, IFN-β,
IFN- δ etc.), II type (i.e. IFN-γ) and III type interferon (including IFN- λ 1, IFN- λ 2 and IFN- λ 3).The biology of interferon
Effect is mainly manifested in three aspects of antiviral and antitumor and immunological regulation.Wherein most important aspect is antivirus action,
With broad anti-viral activity, but lack specificity.After organism infection virus, more interferon can be generated in moment, then
Interferon gradually diffuses to whole body, and the Antiviral mechanism in active cell generates a series of antiviral substances, plays disease-resistant
The effect of poison.Meanwhile interferon also has antineoplastic action, interferon can inhibit the proliferation of tumour, change tumour cell
Surface property, new antigen is induced, to be identified and be repelled by immune surveillance cells.In addition, interferon can also lead to
Immunoregulation effect is crossed, antitumor immunity of organism power is enhanced.Meanwhile it can be existed simultaneously with antivirus action.For example, II type interferes
The major function of element is exactly to participate in immunological regulation.Interferon has clinically obtained very extensive application, antitumor, disease-resistant
Poison etc. brings Gospel to patient, but how it could preferably play as with the active cell factor of good biological
Effect also needs further to explore.
Summary of the invention
A technical problem to be solved by this invention is that how providing one kind can make cell factor more preferably play effect
Recombinant plasmid, recombination engineering and its application answered.
According to the first aspect of the invention, the present invention provides a kind of recombinant plasmids, according to an embodiment of the invention, should
Recombinant plasmid includes enhance-like element sequence, the encoding gene of cell-penetrating peptide and the encoding gene of cell factor interconnected, enhancing
Increment sequence is at least one of SEQ ID No:1-4.
Wherein, which further includes the plasmid vector for being inserted into said gene segment, which can select this
Commonly some plasmid vectors, non-limiting example include PV20, PB20 etc. in field.
According to an embodiment of the invention, the recombinant plasmid at least has the advantages that
The encoding gene of enhance-like element sequence and cell-penetrating peptide is connected with each other by the present invention, forms new enhance-like element sequence,
After in conjunction with foreign gene, the recombinant plasmid of formation can be obviously improved the production of the transcription rate and expression product of foreign gene
Rate promotes the uptake ratio of target cell, to enable the cell factor of external source preferably to play effect the effect of Enhanced expressing product
It answers.
In addition, according to an embodiment of the invention, the recombinant plasmid can also have following additional technical feature:
In some embodiments of the invention, cell-penetrating peptide has the amino acid sequence as shown in SEQ ID No:5, the amino
Acid sequence is Arg Lys Lys Arg Arg Gln Arg Arg Arg, i.e. RKKRRQRRR (SEQ ID No:5).
In some embodiments of the invention, the encoding gene of cell-penetrating peptide has the nucleotide as shown in SEQ ID No:6
Sequence, the nucleotides sequence are classified as CGTAAGAAGCGTCGACAACGCCGACGT (SEQ ID No:6).
In some embodiments of the invention, cell factor is at least one of interferon, epithelical cell growth factor.
In some embodiments of the invention, interferon is source of people interferon.
In some embodiments of the invention, source of people interferon is at least one below: IFN-α, INF- β, INF- α
2a、INF-γ。
According to the second aspect of the invention, the present invention provides a kind of recombination engineerings, according to an embodiment of the invention,
Recombination engineering conversion has above-mentioned recombinant plasmid.The recombination engineering can be the common engineering bacteria in this field, non-limit
Property example processed includes Escherichia coli, saccharomycete etc..
According to the third aspect of the present invention, the present invention provides a kind of recombinant plasmids or recombination engineering to prepare cell
Application in the factor.
According to the fourth aspect of the present invention, it is anti-swollen in preparation that the present invention provides a kind of recombinant plasmids or recombination engineering
Application in tumor medicine or antiviral drugs.
Detailed description of the invention
Fig. 1 is the antitumous effect confirmatory experiment of the recombinant plasmid PC20-IFN- γ-TAT of one embodiment of the present of invention
Result figure.
Fig. 2 is the antitumous effect confirmatory experiment of the recombinant plasmid PV20-IFN- γ-TAT of one embodiment of the present of invention
Result figure.
Specific embodiment
It is clearly and completely described below with reference to technical effect of the embodiment to design and generation of the invention, with
It is completely understood by the purpose of the present invention, feature and effect.
Embodiment 1:
A kind of recombinant plasmid PC20-IFN- γ-TAT, the recombinant plasmid entrust Hong Xun Biotechnology Co., Ltd in Suzhou to close
At building, can carry out with the following method:
(1) DNA sequence dna as shown in SEQ ID No:1 is synthesized, and wears film in its C-terminal (end end) addition TAT (49-57)
The encoding gene of peptide: CGTAAGAAGCGTCGACAACGCCGACGT forms new enhancing segment；
(2) the cDNA segment of coding human gamma-interferon (IFN-γ) is cut from plasmid pBV220- γ with EcoR I；
(3) connection of step (1) and (2) two segments is carried out under T4DNA connection enzyme effect；
(4) segment after connection is inserted into plasmid vector PC20, obtains recombinant plasmid PC20-IFN- γ-TAT and tested
Demonstrate,prove its accuracy.
The recombinant plasmid PC20- of cell-penetrating peptide encoding gene is prepared comprising enhance-like element sequence but not included in the same way
IFN-γ。
The building structure of this programme is: being added to TAT (49~57) in the C-terminal (end end) of enhance-like element sequence and wears film
Peptide, behind connect IFN-γ again.This wear can make cell-penetrating peptide carry destination protein after mould peptide is connected with aim sequence (IFN-γ)
Into cytoplasm, quickly and effectively by cellular uptake.The Rev of other cell-penetrating peptides such as HIV-1, bromovirus (BMV) Gag
And human transcription modulin cFos- (139~164) etc. all have the function of with similar in TAT.
Embodiment 2:
A kind of recombinant plasmid PV20-IFN- γ-TAT, the recombinant plasmid entrust Hong Xun Biotechnology Co., Ltd in Suzhou to close
At building, can carry out with the following method:
(1) DNA sequence dna as shown in SEQ ID No:3 is synthesized, and wears film in its C-terminal (end end) addition TAT (49-57)
The encoding gene of peptide: CGTAAGAAGCGTCGACAACGCCGACGT forms new enhancing segment；
(2) the cDNA segment of coding human gamma-interferon (IFN-γ) is cut from plasmid pBV220- γ with EcoR I；
(3) connection of step (1) and (2) two segments is carried out under T4DNA connection enzyme effect；
(4) segment after connection is inserted into plasmid vector PV20, obtains recombinant plasmid PV20-IFN- γ-TAT and tested
Demonstrate,prove its accuracy.
The recombinant plasmid PV20- of cell-penetrating peptide encoding gene is prepared comprising enhance-like element sequence but not included in the same way
IFN-γ。
Embodiment 3:
The antitumous effect confirmatory experiment of recombinant plasmid
Experimental procedure is as follows:
1. collecting logarithmic phase breast cancer cell MCF-7, concentration of cell suspension is adjusted, bed board makes cell density to be measured to 1000
A/hole, every hole cell suspension final volume are 100 μ L (96 hole flat underside), setting zeroing hole, control wells and three groups of dosings when bed board
Hole is three wells.Culture solution is only added in zeroing hole, is added without cell.Cell and culture solution is added in control wells and medicine feeding hole.
Spread three blocks of plates.
2. next day, zeroing hole and control wells carry out culture medium replacement, three groups of medicine feeding holes are separately added into 10 μ of culture medium preparation
G/mL control plasmid pBV220-IFN- γ, the recombinant plasmid for not carrying cell-penetrating peptide encoding gene encode base with cell-penetrating peptide is carried
The expression of recombinant plasmid of cause, purifying IFN-γ.5%CO2Under the conditions of, 37 DEG C of incubations.
3. upon administration for 24 hours, 48h, 72h, take a plate cell respectively.It is living that 20 μ L WST-1 detection cell is added in every hole
Power, after 37 DEG C of culture 2h enzyme-linked immunosorbent assay instrument OD450nm at each hole of measurement light absorption value.Calculate cell viability.
Versus cell vigor=A450nm (administration cell)/A450nm (control cell).
It is verified respectively with the recombinant plasmid of embodiment 1 and embodiment 2, the result is shown in Figure 1 and Fig. 2.Fig. 1 and Fig. 2 difference
It is that the antitumous effect of the recombinant plasmid PC20-IFN- γ-TAT and PV20-IFN- γ-TAT of one embodiment of the present of invention is tested
Demonstrate,prove experimental result picture." * " indicates P < 0.01 compared with pBV220-IFN- γ group in Fig. 1, and " # " indicates compared with PC20-IFN- γ
P<0.01.In Fig. 2 " * " indicate compared with pBV220-IFN- γ group P < 0.01, " # " expression compared with PV20-IFN- γ P <
0.01。
As shown in Figure 1, the recombinant plasmid PC20- with control plasmid pBV220-IFN- γ and carrying enhance-like element sequence
The cell of IFN-γ conversion is compared, and the Escherichia coli table of the recombinant plasmid PC20-IFN- γ-TAT conversion of the present embodiment 1 is carried
The IFN-γ reach, purified has stronger antitumous effect.
As shown in Figure 1, the recombinant plasmid PV20- with control plasmid pBV220-IFN- γ and carrying enhance-like element sequence
The cell of IFN-γ conversion is compared, and the Escherichia coli table of the recombinant plasmid PV20-IFN- γ-TAT conversion of the present embodiment 2 is carried
The IFN-γ reach, purified has stronger antitumous effect.
Embodiment 4:
A kind of recombinant plasmid PC20-IFN- γ-TAT, the recombinant plasmid entrust Hong Xun Biotechnology Co., Ltd in Suzhou to close
At building, can carry out with the following method:
(1) DNA sequence dna as shown in SEQ ID No:2 is synthesized, and wears film in its C-terminal (end end) addition TAT (49-57)
The encoding gene of peptide: CGTAAGAAGCGTCGACAACGCCGACGT forms new enhancing segment；
(2) the cDNA segment of coding human gamma-interferon (IFN-γ) is cut from plasmid pBV220- γ with EcoR I；
(3) connection of step (1) and (2) two segments is carried out under T4DNA connection enzyme effect；
(4) segment after connection is inserted into plasmid vector PC20, obtains recombinant plasmid PC20-IFN- γ-TAT and tested
Demonstrate,prove its accuracy.
Embodiment 5:
A kind of recombinant plasmid PV20-IFN- γ-TAT, the recombinant plasmid entrust Hong Xun Biotechnology Co., Ltd in Suzhou to close
At building, can carry out with the following method:
(1) DNA sequence dna as shown in SEQ ID No:4 is synthesized, and wears film in its C-terminal (end end) addition TAT (49-57)
The encoding gene of peptide: CGTAAGAAGCGTCGACAACGCCGACGT forms new enhancing segment；
(2) the cDNA segment of coding human gamma-interferon (IFN-γ) is cut from plasmid pBV220- γ with EcoR I；
(3) connection of step (1) and (2) two segments is carried out under T4DNA connection enzyme effect；
(4) segment after connection is inserted into plasmid vector PV20, obtains recombinant plasmid PV20-IFN- γ-TAT and tested
Demonstrate,prove its accuracy.
Embodiment 6:
Antitumous effect verifying is carried out in fact using the method in embodiment 3 for the recombinant plasmid of embodiment 4 and embodiment 5
Test, the results show that the recombinant plasmid that embodiment 4 and embodiment 5 obtain all has better antitumous effect, should the result shows that,
Recombinant plasmid provided by embodiment 4 and embodiment 5 can make exogenous cytokines preferably play effect.
Obviously, embodiments described above is only a part of the embodiments of the present invention, instead of all the embodiments.
Within the technical scope of the present disclosure, any changes or substitutions that can be easily thought of by anyone skilled in the art,
It should be covered by the protection scope of the present invention.Therefore, protection scope of the present invention should be with the protection model of claims
Subject to enclosing.
SEQUENCE LISTING
<110>the big Bioisystech Co., Ltd of Shenzhen appearance of the city
<120>recombinant plasmid, recombination engineering and its application
<130> 9
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 669
<212> DNA
<213> Escherichia coli
<400> 1
cctccacgca tgtaatgtgc gatccttccg tacccgcaag ttacttctca accagcgcga 60
actggactcc ttgtacggtc gcgtcaatcg agaagctata ccgtagtggc gctctccctg 120
tactggaaaa atgcctggtg caaagtgaaa atcggcgtcg ccaaaggtaa gaaacagcac 180
gataaacgtt cagatatcaa agagcgcgaa tggcaggtgg ataaagcacg tatcatgaaa 240
aacgcccacc gttaaacctg cactccaatt attgaccagt tcctcaccgc gcctccctct 300
ccggcggcgc gaatgaacat cttattggct atcacatccg acacaaatgt tgccatccca 360
ttgcttaatc gaataaaaat caggctacat gggtgctaaa tctttaacga taacgccatt 420
gaggctggtc atggcgctca taaatctggt atacttacct ttacacattg gggctgattc 480
tggattcgac gggatttgcg aaacccaagg tgcatgccga ggggcggttg gcccgaacca 540
gaagtggggc aggagacatc acgtacaatc gtacagatga aggctggctg tatctggcag 600
tggtcattga catgtggtca cgtgccgtta ttgggggctt aatgtcgcca cgcatgacgg 660
cgcaactgg 669
<210> 2
<211> 451
<212> DNA
<213> Escherichia coli
<400> 2
ccgtgtactt aaatgtactt ttgctccatc gcgatgactt agtaaagcac atctaaaact 60
tttagcgtta taacgtaaaa aatcttgcca gctttcccct tctaaagggc aaaagtgagt 120
atggtgccta tctaacatct caatggctaa gggtcgagca aagcccgctt attttttaca 180
tgccaataca atgtaggctg ctctacacct agcttctggg cgagtttacg ggttgttaaa 240
ccttcgattc cgacctcatt aagcagctct aatgcgctgt taatcacttt acttttatct 300
aatctagaca tcattaattc ctaatttttg ttgacactct atcattgata gagttatttt 360
accactccct atcagtgata gagaaaagtg aaatgaatag ttcgacaaag atcgcatgtt 420
aaattacgtt actcgatgcc atggggattg g 451
<210> 3
<211> 283
<212> DNA
<213> Vaccinia virus
<400> 3
ccccacctgg gcacactgct gtctcctgcg cagtcgagca tcaatcaata ccctcaggtc 60
catttcttct tatgacacca agctgggagg gagttatgac accaagctgg gagggagcgt 120
tgatctgcca gaggggagaa gggcactaca gagggaccag gatagactgg atcgattggc 180
cactgtatgt actcctacac ctactggtgg tacagtatgt acaacagcac aaccaaatcc 240
aaatccagga gcagcatctc aacaaaatct cgccgatatg ggg 283
<210> 4
<211> 112
<212> DNA
<213> Vaccinia virus
<400> 4
aattcctctg aaaataaatc caaaataact agacattcta ttttttgtgg attagtgtac 60
tctcttcctt ctatcatgtt cactactggt gtccacgatg ataaatatct ag 112
<210> 5
<211> 9
<212> PRT
<213>artificial synthesized
<400> 5
Arg Lys Lys Arg Arg Gln Arg Arg Arg
1 5
<210> 6
<211> 27
<212> DNA
<213>artificial synthesized
<400> 6
cgtaagaagc gtcgacaacg ccgacgt 27
Claims (9)
1. a kind of recombinant plasmid, which is characterized in that including enhance-like element sequence interconnected, the encoding gene of cell-penetrating peptide and thin
The encoding gene of intracellular cytokine, the enhance-like element sequence are at least one of SEQ ID No:1-4.
2. recombinant plasmid according to claim 1, which is characterized in that the cell-penetrating peptide has as shown in SEQ ID No:5
Amino acid sequence.
3. recombinant plasmid according to claim 1, which is characterized in that the encoding gene of the cell-penetrating peptide has such as SEQ ID
Nucleotide sequence shown in No:6.
4. recombinant plasmid according to claim 1, which is characterized in that the cell factor is interferon, epidermal cell life
At least one of long factor.
5. recombinant plasmid according to claim 4, which is characterized in that the interferon is source of people interferon.
6. recombinant plasmid according to claim 5, which is characterized in that the source of people interferon is at least one below:
IFN-α、INF-β、INF-α2a、INF-γ。
7. a kind of recombination engineering, which is characterized in that conversion has the right to require the described in any item recombinant plasmids of 1-6.
8. recombinant plasmid described in any one of claims 1-6 or recombination engineering as claimed in claim 7 prepare cell because
Application in son.
9. recombinant plasmid described in any one of claims 1-6 or recombination engineering as claimed in claim 7 prepare it is antitumor
Application in drug or antiviral drugs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910574311.1A CN110358783A (en) | 2019-06-28 | 2019-06-28 | Recombinant plasmid, recombination engineering and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910574311.1A CN110358783A (en) | 2019-06-28 | 2019-06-28 | Recombinant plasmid, recombination engineering and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110358783A true CN110358783A (en) | 2019-10-22 |
Family
ID=68216718
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910574311.1A Pending CN110358783A (en) | 2019-06-28 | 2019-06-28 | Recombinant plasmid, recombination engineering and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110358783A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1339586A (en) * | 2000-08-25 | 2002-03-13 | 中国预防医学科学院病毒学研究所 | New pronucleus enhancer sample sequence and its use |
| WO2018151823A1 (en) * | 2017-02-16 | 2018-08-23 | Firststring Research, Inc. | Composition and methods for preventing radiation injury and promoting tissue regeneration |
-
2019
- 2019-06-28 CN CN201910574311.1A patent/CN110358783A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1339586A (en) * | 2000-08-25 | 2002-03-13 | 中国预防医学科学院病毒学研究所 | New pronucleus enhancer sample sequence and its use |
| WO2018151823A1 (en) * | 2017-02-16 | 2018-08-23 | Firststring Research, Inc. | Composition and methods for preventing radiation injury and promoting tissue regeneration |
Non-Patent Citations (3)
| Title |
|---|
| ALAN 0. FRANKEL等: "Cellular Uptake of the Tat Protein from Human lmmunodeficiency Virus", 《CELL》 * |
| 胡大强: "TAT修饰的小鼠IFNγ的制备", 《第三军医大学学报》 * |
| 胡大强: "TAT修饰的小鼠和人IFNγ的制备及功能鉴定", 《中国优秀博硕士学位论文全文数据库（硕士）基础科学辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Walter | The molecular basis of IL-10 function: from receptor structure to the onset of signaling | |
| Li et al. | Interferon-λs: the modulators of antivirus, antitumor, and immune responses | |
| Chertova et al. | Characterization and favorable in vivo properties of heterodimeric soluble IL-15· IL-15Rα cytokine compared to IL-15 monomer | |
| Saito et al. | The role of type-2 conventional dendritic cells in the regulation of tumor immunity | |
| CN102309757B (en) | Novel regulatory factor of FOXP3 and regulatory T cells, and use thereof | |
| TW201831688A (en) | Method for increasing the secretion levels of interleukin 2 and proteins derived from it | |
| CA2955006A1 (en) | Modified il-2 variants that selectively activate regulatory t cells for the treatment of autoimmune diseases | |
| Pagliaccetti et al. | Interferon-λ in HCV infection and therapy | |
| Martínez-Espinoza et al. | The relevance of TLR8 in viral infections | |
| CN108350032A (en) | Adjust γ C- cytokine activities | |
| CN106661095A (en) | N-terminally truncated interleukin-38 | |
| Fiani et al. | Exploiting manipulated small extracellular vesicles to subvert immunosuppression at the tumor microenvironment through mannose receptor/CD206 targeting | |
| Harwood et al. | Therapeutic potential of IL-15 and N-803 in HIV/SIV infection | |
| Baudet et al. | Approaches to manipulate Ephrin-A: EphA forward signaling pathway | |
| Tao et al. | Thymosin α1 and its role in viral infectious diseases: the mechanism and clinical application | |
| Rowley et al. | Inhibition of tumor growth by NK1. 1+ cells and CD8+ T cells activated by IL-15 through receptor β/common γ signaling in trans | |
| Filiberti et al. | Self-renewal of macrophages: tumor-released factors and signaling pathways | |
| CN111777667B (en) | Small peptide and application thereof in preparation of immunoregulation medicine | |
| CN105524147A (en) | Recombinant polypeptides and use thereof | |
| CN113101363A (en) | Circular RNA vaccine and application thereof | |
| CN110358783A (en) | Recombinant plasmid, recombination engineering and its application | |
| CN108395480A (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER2-NKT cells and its preparation method and application | |
| CN116925240A (en) | Recombinant collagen and expression method and application thereof | |
| CN108690123B (en) | Application of short peptide in preparation of immunoregulation medicine | |
| CN116874581A (en) | Human tumor antigen capable of activating anti-tumor immune response of patient and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |