CN110358736B

CN110358736B - Modified K562 cells, preparation method thereof and NK cell culture composition

Info

Publication number: CN110358736B
Application number: CN201910620164.7A
Authority: CN
Inventors: 卓朗; 王晖; 王柯
Original assignee: Hangzhou Shuoxi Biopharmaceutical Co ltd
Current assignee: Hangzhou Shuoxi Biopharmaceutical Co ltd
Priority date: 2016-05-20
Filing date: 2016-05-20
Publication date: 2023-07-07
Anticipated expiration: 2036-05-20
Also published as: CN110358736A; CN105838677A; CN105838677B

Abstract

The invention provides a modified K562 cell, a preparation method thereof and an NK cell culture composition. The modified K562 cells are obtained by gene recombination of the fusion gene into AAVS1 transposon of the K562 cells by a plasmid; wherein the fusion gene comprises a human gene, wherein the human gene comprises mbIL15,4-1BBL, and mbIL21. The modified K562 cells are cell lines developed by an integration technology using site-specific genes, and NK cells amplified by the modified K562 cells have higher cell activity, purity, cytotoxicity and amplification efficiency; has great market prospect and economic value.

Description

Modified K562 cells, preparation method thereof and NK cell culture composition

The patent application is a divisional application of patent application with application number of 201610340117.3, application date of 2016, 5 and 20, and invention name of 'a method for efficiently amplifying and freezing and preserving NK cells' and application thereof.

Technical Field

The invention belongs to the field of cell engineering, and particularly relates to a modified K562 cell, a preparation method thereof and an NK cell culture composition containing the modified K562 cell.

Background

Human Natural Killer (NK) cells are composed of lymphocytes of the natural immune system expressing CD56 and lacking CD3 (CD-CD56+). NK cells have a broad spectrum of functions to kill tumor cells, can exert antitumor effects by cytotoxic particles such as perforin and granzyme, and by mechanisms such as death receptor interaction, fas-Fas ligand binding and TNF-related apoptosis-inducing ligand binding. NK cells can also mediate Antibody Dependent Cellular Cytotoxicity (ADCC) through the membrane receptor fcrγiii (CD 16). Targeted recognition and activation of NK cells works by a balance of inhibition and activation of NK cell surface receptors and related ligands expressed on target cells, which allows immediate response to pathogen invasion and degeneration. This unique mechanism of targeted recognition of NK cells is different from the T cell-dependent mechanism of the Major Histocompatibility Complex (MHC) restricted T Cell Receptor (TCR). Thus, the use of allogeneic NK cells to treat cancer may not cause Graft Versus Host Disease (GVHD).

In healthy subjects, NK cells account for approximately 5-20% of Peripheral Blood Mononuclear Cells (PBMC). In adoptive immunotherapy, large doses of NK cells range from 5X 10≡6-5X 10≡7 per kg body weight per dose, up to 4 doses. In the prior art, the methods for enriching and amplifying NK cells from a large amount of peripheral blood are mostly by using invasive leukocyte separation and large-scale magnetic separation devices, which are very expensive and pose a certain risk to patients. Another popular NK cell therapy is the expansion of NK cells using feeder cells, such as K562 cell-modified membrane-bound molecules, e.g. Interleukin (IL) -15 and 4-1BB ligand (K562-mb 15-41 BBL). These feeder cells can rapidly expand NK cells from peripheral blood mononuclear cells, allowing 21.6-fold expansion of NK cells on the 7 th balance and 277-fold expansion on the 21 st day. However, continued amplification is limited due to the shortened telomerase resulting from aging.

Obtaining large doses of NK cells typically requires several weeks of expansion, the reinfusion NK cells must be fresh, and coordination between cell culture and multi-dose cell infusion is extremely challenging. Therefore, cryopreservation of amplified NK cells is very necessary. However, the cryopreservation of traditional NK cells has deleterious effects on cells, such as reduced NK cell viability, cytotoxicity, and expression of NK cell receptors critical to function. Often NK cells cannot lyse cancer cells immediately after thawing from cryopreservation, and resuscitated NK cells need to be stimulated overnight with IL-2 to restore cytotoxicity of cryopreserved NK cells (Denman, senyukov et al, 2012;Lapteva N et al, 2012). Thus, in the prior art, cell viability remains a problem and NK cell survival after resuscitation cannot last for more than one week. At the same time, it is still unclear whether resuscitated NK cells can be further expanded. Thus, there is a great need in the art for a new cryopreservation method that maintains NK cell activity and original function and has good expansibility.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to provide a freezing method for maintaining NK cell activity, function and expansibility.

In order to solve the technical problems, the invention discloses a method for efficiently amplifying and cryopreserving NK cells, which comprises the steps of carrying out gene recombination on fusion genes to AAVS1 transposons through plasmids, and introducing a freezing/thawing step to an NK cell amplification step based on a modified K562 cell line in an intermediate stage of cell amplification; and finally, amplifying and preserving NK cells.

Preferably, the fusion gene encodes mbIL15,4-1BBL and mbIL21 for human chromosome 19.

Preferably, the gene expression plasmid backbone of the fusion gene is pFastBac1.

Preferably, the promoter of the plasmid backbone is cytomegalovirus.

Preferably, the recombination of the plasmid uses zinc finger nuclease-mediated homologous recombination techniques.

Preferably, the step of gene recombination specifically includes:

suspending K562 cells;

electrotransferring the pFastBac-ZFN and PFB-fusion gene host into a cell;

the electroporated cells were then transferred to K562 growth medium for culture.

After culturing, single cells are amplified, cloning is carried out, PCR genotyping and flow cytometry analysis are carried out, and cells stably expressing fusion genes are obtained.

Preferably, the specific steps of the NK cell amplification are as follows:

peripheral blood mononuclear cells are firstly taken and analyzed and treated by a density gradient method;

amplifying the NK cells by using a serum-free stem cell growth medium, and co-culturing the NK cells in the NK cell growth medium by using PBMC and gamma irradiation K562 feeder cells;

freezing the amplified NK cells in a freezing medium containing SCGM medium and 10% FBS and a freezing tube containing 10% DMSO;

more preferably, the cells are thawed and washed after being subjected to a cryopreservation process; finally, the thawed NK cells were again stimulated with K562 feeder cells in a ratio of 1:1.

The invention also discloses application of the method for efficiently amplifying and freezing and preserving NK cells in the field of cell preservation.

Compared with the prior art, the technical scheme of the invention has the advantages that the K562-mbiL15-41BBL-mbiL21 cell line developed by using the integration technology of the site-specific genes has high NK cell activity, purity and cytotoxicity, and high NK cell amplification efficiency is realized to improve NK amplification.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings, in which

FIG. 1 is a schematic diagram showing the process of site-specific integration of fusion genes into K562 cells in the examples;

FIG. 2 is a flow cytometer analysis of protein expression levels of mbiL15,4-1BBL, and mbiL21 in modified K562 cells in examples;

FIG. 3 is NK cell expansion fold in the examples;

FIG. 4 is a comparison of NK cell purity after the use of K562mbil15-41BBL-mbil21 in the examples;

FIG. 5 shows NK cell activation receptors, inhibition of receptor and NK cell marker expression after amplification in the examples;

FIG. 6 is a graph showing the killing activity of NK cells against K562 human leukemia cell line amplified in the examples;

FIG. 7 is a schematic diagram showing ADCC actions of NK cells against RaJi B-cell lymphocyte lines in the presence of anti-CD 20 human antibody in examples;

FIG. 8 is a schematic representation of the killing activity of initial NK cells against PCRC7 colorectal cancer cells modified by EpCAM-specific CARs in the examples;

figure 9 is the killing activity of EpCAM specific CAR modified naive NK cells on MCF7 breast cancer cells in the examples.

Detailed Description

Example 1 this example discloses a method for high efficiency expansion of cryopreserved NK cells comprising the steps of:

1. culture of human cell lines

Wild-type K562 and Raji cell lines were obtained from the American Type Culture Collection (ATCC). And placing the cells in RPMI-1640 medium (GIBCO) containing 10% fetal bovine serum (GIBCO) and placing in 37℃and 5% CO ₂ Is cultured in an incubator of (a).

2. Construction of plasmids

pFastBac1 (Invitrogen, carlsbad, calif.) was used as a plasmid backbone for expression of ZFN and fusion genes encoding mbIL15,4-1BBL and mbiL21, wherein the promoter was Cytomegalovirus (CMV). Specific construction of pFastBac-ZFN was previously reported (Tay, tan et al 2013).

For the construction of the pFB-fusion gene host, the DNA fragment encoding the fusion gene was synthesized for the first time by AIT biotechnology from the sequence genes reported in the prior art, the synthesized construct was cloned into pUC57 (ampicillin resistance), and the fragment was amplified by PCR.

In addition, the CMV promoter, internal Ribosome Entry Site (IRES), neomycin resistance gene (new) and woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) were also amplified by PCR. All these fragments were cloned into a pUC19 plasmid using the GENEART seamless cloning and assembly kit (Invitrogen). The pooled fragments were then excised and cloned into the pFastBac1 backbone using Asc/ClaI, which contained a 810bp left homology arm and a 837bp right homology arm belonging to the AAVS1 transposon (Tay, tan et al 2013).

3. Fusion gene of site-specific integration to AAVS1 locus of K562 cell

Will be 2X 10 ⁶ The individual K562 cell lines were resuspended in 100. Mu.l of Opti-MEM, respectively. Mu.g of each of the pFastBac-ZFN and PFB-fusion gene hosts were electrotransferred to cells using NE PA 21 electroporation and Bio-Rad company tube. The electroporated cells were then transferred to fresh K562 growth medium in 6 well plates. On day 5 after electroporation, G418 selection was performed at a concentration of 200. Mu.g/mL for 1 month. The medium was changed every 2 days. After 1 month of selection, single cells were sorted into 96-well plates using a cell sorter, BD FACSAria (BD Biosciences). Single cells and clones were amplified for PCR genotyping and flow cytometry analysis to confirm expression and stable expression of the site-specific integrated fusion gene. PCR genotyping to identify integration of cell clones with AAVS1 sites. Genomic DNA of cells using

Blood and tissue kit (Qiagen, hilden, germany). PCR genotyping was used to detect site-specific integration of the OKSM cassette. KAPA high-fidelity hot start ready mix (KAPA Biosystem, woburn, MA) was used together, forward primer: ATATTGCTGAAGAGCTTGGCGGCGAATGGG and reverse primer: CGGGGATGCAGGGGAACGGGGCTCAGTCTG. The amplified products were analyzed on a 1% agarose gel.

4. NK cell expansion and cryopreservation

Peripheral blood mononuclear cells of 20 healthy donors were taken and isolated from peripheral blood using Ficoll-Paque PREMUM (GE healthcare group Life sciences)The fresh buffy coat of the nuclear cells was analyzed by density gradient method. NK cells were expanded using serum free Stem Cell Growth Medium (SCGM) (CellGro/CellGenix) supplemented with 10% FBS (GIBCO) and 10 or 50IU/ml IL-2 (PeproTech, rocky.Hill, NJ, USA) and co-cultured with PBMC with gamma irradiated K562 feeder cells (quantitative ratio 1:2) in NK cell growth Medium. 2X 10 in T75 flask ⁶ PBMC with 4X 10 ⁶ K562 feeder cells of (A) were co-cultured in 10ml of NK medium. Half the amount of liquid is changed every 2-3 days and 100IU/ml IL-2 is added.

After NK cells were amplified for 7 days, the amplified NK cells were expressed in a 2X 10 ratio ⁷ cells/mL were frozen in a freezer tube (NUNC) in a freezer medium containing SCGM medium+10% fbs+10% dmso (Invitrogen). The cells were placed in a freezer (Thermo Fisher Scientific, rochester, NY) at 1 ℃ for 24 hours in a-80 ℃ freezer, then transferred and stored in a liquid nitrogen vapor storage tank. Frozen NK cells were thawed in a 37℃water bath until a small amount of frozen material remained, and then washed in NK cell growth medium. The thawed NK cells were stimulated again every 7 days with K562 feeder cells at a 1:1 ratio. Cryopreserved NK cells can be expanded for at least 3 months.

5. Flow cytometer analysis

The flow cytometer used was a BD Accuri C6 flow cytometer (BD Biosciences, franklin Lakes, NJ).

The APC-labeled antibodies used were purchased from maytansinoid (Bergisch Gladbach, germany), BD Biosciences, or Beckman Coulter (Brea, CA).

6. Cytotoxicity assays

The said

Cell cytotoxicity kits (Perkin Elmer) were used to test cytotoxicity against wild type K562 and Raji cells.

NK cells and target cells at a ratio of 1:1,1:5 and 1:10 at 37 ℃,5% CO ₂ Co-cultivation in the incubator of (2) for 2 hours.

7. Experimental results

Fusion gene of site-specific integration to K562 feeder cells

Two plasmid construction techniques were performed using established zinc finger nucleases (BV-ZFN) (Tay, tan et al 2013): one encodes ZFN, targets and cleaves AAVS1 transposons (pFastBac-ZFN) and other hosts mbil15,4-1BBL, and mbil21 and neomycin genes that have been used to contain CMV promoter to drive expression encoded by the fusion gene. See in particular fig. 1. In the figure, the fusion gene was site-specifically integrated into K562 cells. Construction of the pFastBac-fusion Gene host AAVS1 to PPP1R12C genes, cleavage site BV-ZFN, and modified AAVS1 after homologous recombination. E1 E2 and E3: exons of the first three PPP1R12C genes. The arrow indicates the 3' modified AAVS1 of a 2.4kb fragment formed by the binding of the PCR front and reverse promoters (FP and RP).

This cassette was flanked by a 810-bp left homology arm and a 837-bp right homology arm with respect to the AAVS1 transposon (pFastBac-mbiL 21-host) (FIG. 1). K562 cells achieved site-specific integration of both plasmids by electroporation. Following electroporation, K562 cells were G418 selected and after 5 days single cell sorting was performed. DNA was extracted from the genome of the G418 resistant single cell clone and PCR genotyping was performed by using a primer pair of the pFastBac-mbiL 21-host gene (downstream of the 3' end of the right homology arm) in which neomycin specific for chromosome 19 was present. Amplification of the 2.5-kb fragment indicated successful AAVS1 modification by zFN-mediated homologous recombination. To demonstrate that successful modification will result in stable protein expression of the fusion gene in clones that were subjected to flow cytometry analysis. One clone showed high expression of the protein selected as NK cell expanded feeder cells. See in particular fig. 2.

Expansion of NK cells after cryopreservation

Cryopreservation of NK cells is known to be detrimental to cells, such as cell viability, decreased cytotoxicity, decreased NK cell receptor expression. To overcome this problem we developed a protocol where freshly isolated NK cells were incubated with K562 cells we obtained for a short period of 7 days at a ratio of 1:2, then the expanded cells were frozen and then co-cultured with K562 cells at a ratio of 1:1 after resuscitation. NK cells were then re-stimulated with K562 feeder cells every 7 days, and NK cells expanded for up to 3 months. We have found that this method overcomes the problem of reduced cell viability caused by cryopreservation. As shown in fig. 3, cryopreserved NK cells were able to proliferate for at least 35 days after resuscitation. The mean total expansion of NK cells is shown as 78, 880, 152, ranging from 280, 354 to 226, 456, 888. Each row represents one PBMC patient (n=3). NK cells were expanded with K562mbil15-41BBL-mbil21 feeder cells at a K562 ratio of 1:2 for 7 days before freezing at-80 ℃. Cryopreserved NK cells were resuscitated one week and re-expanded after stimulation with K562.

To determine optimal culture conditions for NK cell proliferation, PBMC to K562-mbiL15-41BBL-mbiL21 ratios, 1:2,1:1.5 and 1:1 differences were assessed, respectively. It was observed that a decrease in stimulation of initial PBMC at dosing could result in a decrease in NK cell expansion, with a ratio of PBMC:K562 of 1:2 yielding the highest NK cell expansion. An increase in the ratio will also maintain a higher NK cell purity, with a maximum purity of 94.9.+ -. 2.8% after 21 days of culture (FIG. 4) at 1:2 in PBMC:K562.

Experimental example

1. Phenotypic assay of amplified NK cells

A broad array of amplified NK cell adhesion molecules and receptors was tested. Most of the highly expressed receptors and adhesion molecules, with few exception-activating receptors, NKp44, and inhibitory receptors, surface CD158a, h, CD158i and CD158e1/e2 (fig. 5).

The expression of adhesion molecules after resuscitating NK cells cultured for 7 days and the expression of adhesion molecules and receptors after re-stimulation with K562-mbiL15-41BBL-mbiL21 for 1 week were also compared. The surface expression of inhibitory receptors, surface CD158a, h and CD158e1/e2, and activating receptors, NKG2D and NKp44, appears to be significantly increased. The results show that expression of the surface marker CD16 was down-regulated by cryopreservation of NK cells (Sakamoto, ishikawa et al 2015). Consistent with these results, a significant decrease (up to 86%) in the expression of the surface marker CD16 of NK cells occurred after cryopreservation and resuscitation. However, this problem was ameliorated after 1 week of restimulation with K562-mbiL15-41BBL-mbiL 21. CD16 surface expression was shown to increase to an average of 90.6±1.8%.

2. Testing of the killing of amplified NK cells against cancer cells

The expanded NK cells were able to kill NK sensitive leukemia cells K562 directly, on average 16.1% (ranging from 0.9% to 31.2%), 69.8% (ranging from 58.5% to 98.9%) and 86.3% (ranging from 74.9% to 98.7%), at 1:1,5:1 and 10:1 respectively (FIG. 6). Wherein NK cells were co-cultured with K562 cells at a ratio of 1:1,5:1 and 10:1 for 2 hours. Each row represents one PBMC healthy volunteer (n=6). However, raji lymphoma cells are less sensitive to NK cells. By exploiting the ADCC function of these NK cells, cytotoxicity against Raji cells was clearly observed in the presence of the antibody CD20-hIgG1 (fig. 7). Thus, the ADCC function of amplified NK cells can significantly expand the killing spectrum against malignant cells.

Chimeric Antigen Receptors (CARs) of immune cells can increase their killing activity against cancer cells. Cancer cell killing efficiency of expanded NK cells was further increased after cryopreservation by testing whether anti-EpCAM CAR-redirected NK cells displayed cytotoxicity against EpCAM positive colorectal and breast cancer cells. After electroporation of mRNA encoding anti-EpCAM, the modified NK cells were co-cultured with pCRC7 human colorectal cancer cells (FIG. 8) and MCF-7 breast cancer cells (FIG. 9). EpCAM in fig. 8, 9 is a specific CAR modified primary NK cell; CAR is control modified primary NK cells; wt is the initial NK cell.

The following results were obtained: anti-EpCAM calnk cells showed strong cytotoxic activity and were able to kill tumor cells 100% at an E: T ratio of 10:1, which had more potent killing activity than the unmodified primary NK cells and mGFP CAR modified control NK cells.

Taken together, it can be seen that adoptive NK cell therapy is an effective cancer treatment that shows high anti-tumor potential with very low risk of Graft Versus Host Disease (GVHD) in clinical trials. However, the difficulty of obtaining sufficient numbers of NK cells for adoptive transplantation is a limitation of NK cell therapy. In vitro expansion of NK cells is often associated with complex protocols and expensive costs. The K562-mbiL15-41BBL-mbiL21 cell line developed by the integration technology using the site-specific gene achieves high NK cell expansion efficiency by having high NK cell activity, purity and cytotoxicity to improve NK expansion scheme. Random integration of genes encoding retroviral vectors for NK stimulatory molecules into K562 cells is used to generate genetically modified K562 cells, which may result in different expression levels of stimulatory molecules, and thus this would be the same expression level where challenging replicating cell lines may express the transgene. AAVS1 transposons were introduced by overcoming the integration problem from site-specific genes. AAVS1 is located within the protein phosphatase 1, regulatory (inhibitor) subunit 12C (PPP 1R 12C) gene versus human chromosome 19 (19q13.3-qter). This site serves as a non-pathogenic human parvovirus that specifically integrates the locus AAV serotype 2 (AAV 2). AAVS1 has transcriptional capacity, including an open chromatin structure and gene integration resistance comprising natural insulators, silencing the transgene. AAVS1 is considered to be an adult genome that is "safe harbor" as the additive transgene, since there is no known adverse effect on cells due to disruption of the transcriptional capacity of the transgene cassette from the PPP1R12C gene and the insertion site, which remains in different cell types.

Amplified NK cells have better efficiency after cryopreservation and improved NK cell function during subsequent amplification.

Currently, immediately resuscitated NK cells cannot be used for ADCC anti-tumor therapy due to the effect of freezing on CD16 expression. This therapy would be made possible by restimulation with K562-mbiL15-41BBL-mbIL 21. NK cell therapies are currently more successful in treating leukemia than solid tumors. This is due to the effect of this solid tumor microenvironment factor that shows inhibition of signal to NK cell killing. Thus, the genetically modified NK cells of the CAR have NK cells targeted to solid tumors that are resistant, opening up the possibility of broader NK cell treatment for various cancer types. Thus, after resuscitating cryopreserved NK cells, anti-EpCAM CAR-redirected NK cells can effectively kill EpCAM positive colorectal and breast cancer cells.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

Claims

1. A modified K562 cell, wherein the modified K562 cell is obtained by gene recombination of a fusion gene into an AAVS1 transposon of the K562 cell by a plasmid; wherein, the fusion genes are human genes mbIL15,4-1BBL and mbIL21.

2. The modified K562 cell of claim 1 wherein the backbone of the plasmid is pFastBac1.

3. The modified K562 cell of claim 2 wherein the promoter of the backbone of the plasmid is a cytomegalovirus promoter.

4. The modified K562 cell of claim 1 wherein the gene recombination uses zinc finger nuclease ZFN mediated homologous recombination techniques.

5. An NK cell culture composition comprising the modified K562 cells of any one of claims 1-4, IL-2 and serum-free stem cell growth medium.

6. The NK cell culture composition of claim 5 further comprising FBS.

7. A method of making the modified K562 cell of any one of claims 1-4, comprising:

constructing a pFastBac-fusion gene; wherein the fusion genes are human genes mbIL15,4-1BBL and mbIL21;

suspending K562 cells;

electrotransferring pFastBac-ZFN and said pFastBac-fusion gene to said K562 cells;

transferring the electrotransformed K562 cells into a K562 growth medium for culturing;

after culturing, carrying out single cell clone amplification, carrying out PCR genotyping and flow cytometry analysis on single cell clone, and obtaining the modified K562 cells stably expressing the fusion gene.