CN110327470A - The preparation and its application method of women primary sterility are caused for treating crossing barriers - Google Patents

The preparation and its application method of women primary sterility are caused for treating crossing barriers Download PDF

Info

Publication number
CN110327470A
CN110327470A CN201910626680.0A CN201910626680A CN110327470A CN 110327470 A CN110327470 A CN 110327470A CN 201910626680 A CN201910626680 A CN 201910626680A CN 110327470 A CN110327470 A CN 110327470A
Authority
CN
China
Prior art keywords
wee2
preparation
crna
ovum
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910626680.0A
Other languages
Chinese (zh)
Inventor
王磊
匡延平
桑庆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Zhuhai Fudan Innovation Research Institute
Original Assignee
Fudan University
Zhuhai Fudan Innovation Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Zhuhai Fudan Innovation Research Institute filed Critical Fudan University
Priority to CN201910626680.0A priority Critical patent/CN110327470A/en
Publication of CN110327470A publication Critical patent/CN110327470A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Reproductive Health (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Pregnancy & Childbirth (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention belongs to gene therapy technology fields, and the preparation and its application method of women primary sterility are caused particularly for treatment crossing barriers.Crossing barriers patients with clinical manifestations is that ovum cannot be fertilized or rate of fertilization is low or polyspermy, and without effective embryo, thus test-tube baby fails repeatedly in test-tube baby's art.The preparation of women primary sterility is caused to be formulated by a certain concentration WEE2 cRNA or WEE2 protein provided by the present invention for treatment crossing barriers.Then, make patient's ovum successful fertilization to the above-mentioned preparation of ovum injection of patient or significantly improve rate of fertilization, and can get effective embryo and final foundation gestation.

Description

The preparation and its application method of women primary sterility are caused for treating crossing barriers
Technical field
The invention belongs to gene therapy technology fields, and in particular to treatment crossing barriers cause the preparation of women primary sterility And its application method.
Background technique
Normal fertilization is the key link of successful human reproduction.Sperm and ovum pass through fertilization and generate totipotency zygote, To continue all cells (Clift, D., and Schuh, M. Nature reviews that differentiation generates formation individual 2013. 14,549-562 of Molecular cell biology.).Therefore, exception, which occurs, in fertilization link will lead to women not Pregnant and clinical supplementary reproduction fails repeatedly.Crossing barriers mainly include low rate of fertilization, fertilization failure and polyspermy in clinic. Crossing barriers are the one of the major reasons of clinical supplementary reproduction failure.Rate of fertilization is low so that patient need to repeatedly take ovum to be likely to obtain The effective embryo of only a few or although repeatedly taking ovum, still can not obtain effective embryo.And failure of being fertilized then makes with polyspermy Patient can not obtain embryo completely.Currently, only one gene mutation is found (Alazami et al. related with fertilization failure TLE6 mutation causes the earliest known human embryonic lethality. Genome Biology 16,240).But this gene mutation is only capable of explaining only a few fertilization failure patient, we have found that WEE2 is prominent recently Change is present in multiple crossing barriers patients (Qing Sang et al. Homozygous Mutations in WEE2Cause Fertilization Failure and Female Infertility. Am J Hum Genet. 2018;102(4): 649-657).In addition, for crossing barriers patient, having no any method can improve and treat in the clinic of supplementary reproduction at present. These patients thus can not obtain offspring by itself sperm and ovum.Using the unique road for for ovum or for essence being these patients Diameter.
Gene therapy, which refers to, the operation such as is supplemented by molecular biology method corresponding gene, is inhibited, being repaired, being edited, To improve and treat associated genetic disorders.Gene therapy method has been used for the treatment of a variety of diseases, including hemophilia (Rangarajan S et al. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med. 2017;377:2519-2530), spinal muscular atrophy (Mendell JR et al. Single-Dose Gene-Replacement Therapy for Spinal Muscular Astrophy. N Engl J Med. 2017; 377:1713-1722), Bai Shi congenital amaurosis cataract or glaucoma (Bainbridge et al. Long-term Effect of Gene Therapy on Leber's Congenital Amaurosis. N Engl J Med. 2015;372:1887-1897), high Blood lipid disease (Fitzgerald K, et al. A Highly Durable RNAi Therapeutic Inhibitor of PCSK9.N Engl J Med. 2017;376:41-51) etc..But any gene therapy there is no to be applied to reproduction disease at present The report of disease.
Summary of the invention
The purpose of the present invention is to provide a kind of excellent effect, the easy to operate crossing barriers that are used to treat to cause women primary The preparation and its application method of infertility.
The research of the invention finds that patient carry WEE2 gene mutation show as it is infertile, supplementary reproduction clinic in show as ovum Son can not be fertilized always or fertilized eggs rate is low and test-tube baby fails.The present invention is by injecting WEE2cRNA to respective patient ovum Or WEE2 albumen, then with sperm fertilization, thus by restore mutation ovum normal fertilization ability so that subsequent embryo is able to Normal development simultaneously forms effective embryo and final foundation gestation.
In the present invention, the sequence of WEE2 cRNA (cDNA) and WEE2 albumen such as SEQ ID NO.1, SEQ IDNO.2 institute Show.
Present invention firstly provides a kind of preparations that women primary sterility is caused for treating crossing barriers, and said preparation is by certain Concentration WEE2 cRNA or WEE2 protein is formulated.Process for preparation is as follows:
(1) prepared by WEE2 cRNA preparation: (close containing terminating by the code area of PCR amplification WEE2 by template of WEE2 gene cDNA Numeral), purified pcr product and structure enters carrier pCMV6 after SfaAI and MluI double digestion as template will be carried with AgeI The cRNA at WEE2 is transcribed in vitro in body single endonuclease digestion, and by its concentration dilution to 300-1000ng/ul；
WEE2cRNA preparation prepares PCR amplification primer pair are as follows:
hWEE2-SfaAI-F: GAGGCGATCGCCATGGATGACAAAGATATTGACAAAGAAC
(SEQ ID NO.3)
hWEE2-TAA-MluI-R: GCGACGCGTTTAATGCAGAGGCTCACGCTCTC
(SEQ ID NO.4)；
(2) prepared by WEE2 protein formulation: (containing and terminates by the code area of PCR amplification WEE2 using WEE2 gene cDNA as template Codon), purified pcr product and structure enters carrier pFast-Bac1 after BamHI and XhoI double digestion as template turns Change DH10Bac E.coli, positive colony and sequence verification are chosen by the screening of blue hickie.Bacmid(plasmid) transfection Sf9 insect Cell obtains P1 generation and P2 generation virus.P2 continues to infect Sf9 cell for virus, infects 48-72 hours collection cells.Ultrasound is broken Broken, ultracentrifugation takes supernatant；Destination protein is obtained after purified, adjustment concentration is 0.5-1mg/ml.
WEE2 protein formulation prepares PCR amplification primer pair are as follows:
hWEE2-BamHI-F: CGGATCCGATGGATGACAAAGATATTGACAAAGAAC
(SEQ ID NO.5)
hWEE2-TAA-XhoI-R: GCGCTCGAGTTAATGCAGAGGCTCACGCTCTC
(SEQ ID NO.6).
The present invention also provides above-mentioned preparation application method, the specific steps are as follows:
(1) take out patient's ovum, granular cell is digested, select MII phase ovum, first progress WEE2 cRNA preparation or The injection of WEE2 protein formulation, injection concentration: WEE2 cRNA is 300-1000ng/ul, and WEE2 protein formulation is 0.5-1mg/ Ml is carried out intracytoplasmic sperm injection (ICSI) again after volume injected 5-15pL, 4-5 hours, and it is former that male and female are observed after 15-18h Karyomorphism at；
(2) the fertilized eggs culture for forming protokaryon is observed the 5-6 days, normotrophic blastaea biopsy is frozen simultaneously, chromosome Normal blastaea will be used to transplant in the future.
The invention further relates to a kind of gene therapy method that the primary infertile patient of women is caused for crossing barriers, specific steps Include:
(1) preparation of WEE2 cRNA preparation and WEE2 protein formulation；
(a) prepared by WEE2 cRNA preparation: (close containing terminating by the code area of PCR amplification WEE2 by template of WEE2 gene cDNA Numeral), purified pcr product and structure enters carrier pCMV6 after SfaAI and MluI double digestion as template will be carried with AgeI The cRNA at WEE2 is transcribed in vitro in body single endonuclease digestion, and by its concentration dilution to 300-1000ng/ul；
(b) prepared by WEE2 protein formulation: (containing and terminates by the code area of PCR amplification WEE2 using WEE2 gene cDNA as template Codon), purified pcr product and structure enters carrier pFast-Bac1 after BamHI and XhoI double digestion as template turns Change DH10Bac E.coli, positive colony and sequence verification are chosen by the screening of blue hickie.Bacmid(plasmid) transfection Sf9 insect Cell obtains P1 generation and P2 generation virus.P2 continues to infect Sf9 cell for virus, infects 48-72 hours collection cells.Ultrasound is broken Broken, ultracentrifugation takes supernatant；Destination protein is obtained after purified, adjustment concentration is 0.5-1mg/ml；
(2) take out patient's ovum, granular cell is digested, select MII phase ovum, first progress WEE2 cRNA preparation or The injection of WEE2 protein formulation, injection concentration: WEE2 cRNA is 300-1000ng/ul, and WEE2 protein formulation is 0.5-1mg/ Ml is carried out intracytoplasmic sperm injection (ICSI) again after volume injected 5-15pL, 4-5 hours, and it is former that male and female are observed after 15-18h Karyomorphism at；
(3) the fertilized eggs culture for forming protokaryon is observed the 5-6 days, normotrophic blastaea biopsy is frozen simultaneously, chromosome Normal blastaea will be used to transplant in the future.
Crossing barriers patient does not have treatment means in clinical supplementary reproduction at present.Using the present invention to due to WEE2 is mutated Caused by crossing barriers patient carry out gene therapy, the patient's ovum normal fertilization for the failure that can make to be fertilized originally, and generating effective Blastaea.Then there is high possibility that patient is pregnant and gives birth to offspring the transplanting of this blastaea.The invention is reproductive medicine field One gene therapy approach.
Specific embodiment
Below in conjunction with specific embodiment, to further illustrate the present invention.It should be understood that following embodiment is merely to illustrate this hair It is bright rather than limit the scope of the invention.
Embodiment 1: the gene therapy of reciprocal fertilization failure patient A
(1) prepared by preparation:
Using WEE2 gene cDNA as template by the code area of PCR amplification WEE2 (containing terminator codon), purified pcr product and with This enters carrier pCMV6 for template structure after SfaAI and MluI double digestion, with AgeI by carrier single endonuclease digestion, be transcribed in vitro at The cRNA of WEE2, and by its concentration dilution to 500ng/ul；
WEE2cRNA preparation prepares PCR amplification primer pair are as follows:
hWEE2-SfaAI-F: GAGGCGATCGCCATGGATGACAAAGATATTGACAAAGAAC
hWEE2-TAA-MluI-R: GCGACGCGTTTAATGCAGAGGCTCACGCTCTC；
(2) application method:
Reciprocal fertilization fails patient from the attached 9th the People's Hospital's reproductive center of Chinese Shanghai university of communications.Wife's side patient is female Sexual reproduction organ, ovarian function, sex hormone, ovulation are normal.Diagnostic criteria are as follows: this patient attempts multiple test-tube baby in outer court Art fails, and failure cause is ovum fertilization failure.In nine institute's reproductive centers, the ovum nonfertilization of first time IVF, second Ovum is still unfertilized after ICSI.Bridegroom's or husband's side semen efamination is normal.Patient signs informed consent, participates in the research of gene therapy.Nine Institute's reproductive center row third time test-tube baby's art, takes 11, MII ovum, wherein the WEE2500ng/ of 4 ovum injection 5pL It after ulcRNA, is carried out again after 4 hours intracytoplasmic sperm injection (ICSI), after 15 hours, injection group ovum is respectively formed normally 2PN protokaryon, but do not inject a group ovum and be shown as 0PN.Further in vitro culture was to the 6th day, 2 in the ovum of 4 normal fertilizations Form high quality blastaea.Blastaea Molecular Detection shows that embryo chromosome does not have large fragment repetition, missing and non-integral multiple body Phenomenon.
Embodiment 2: the gene therapy of reciprocal fertilization failure patient B
(1) prepared by preparation:
Using WEE2 gene cDNA as template by the code area of PCR amplification WEE2 (containing terminator codon), purified pcr product and with This enters carrier pCMV6 for template structure after SfaAI and MluI double digestion, with AgeI by carrier single endonuclease digestion, be transcribed in vitro at The cRNA of WEE2, and by its concentration dilution to 500ng/ul；
WEE2cRNA preparation prepares PCR amplification primer pair are as follows:
hWEE2-SfaAI-F: GAGGCGATCGCCATGGATGACAAAGATATTGACAAAGAAC
hWEE2-TAA-MluI-R: GCGACGCGTTTAATGCAGAGGCTCACGCTCTC；
(2) application method:
Reciprocal fertilization fails patient from the attached 9th the People's Hospital's reproductive center of Chinese Shanghai university of communications.Wife's side patient is female Sexual reproduction organ, ovarian function, sex hormone, ovulation are normal.Diagnostic criteria are as follows: this patient attempts multiple test-tube baby in outer court Art fails, and failure cause is ovum fertilization failure.Diagnostic criteria are as follows: this patient attempts test-tube baby's art twice in outer court (first time IVF, second of ICSI) fails, and failure cause is ovum fertilization failure.Bridegroom's or husband's side semen efamination is normal.Patient's label Informed consent is affixed one's name to, the research of gene therapy is participated in.Nine institute's reproductive center row first time test-tube baby arts, take 20, MII ovum, right After wherein 7 MII ovums give the WEE2500ng/ulcRNA of injection 5pL, intracytoplasmic sperm injection is carried out again after 4 hours (ICSI), after 15 hours, injection group ovum is respectively formed normal 2PN protokaryon, but does not inject a group ovum and be shown as 0PN.Further body Outer culture was to the 6th day, 4 formation high quality blastaeas in the ovum of 7 normal fertilizations.Blastaea Molecular Detection is shown, wherein 2 capsules Embryo, embryo chromosome do not have the phenomenon that large fragment repetition, missing and non-integral multiple body.
In conclusion the present invention has following important practical significance:
Crossing barriers patient does not have treatment means in clinical supplementary reproduction at present.It is caused using the present invention to because WEE2 is mutated Crossing barriers patient carry out gene therapy, the patient's ovum normal fertilization for the failure that can make to be fertilized originally and generates effective blastaea. Then there is high possibility that patient is pregnant and gives birth to offspring the transplanting of this blastaea.The invention is first, reproductive medicine field base Because of therapeutic scheme.
Sequence table
<110>Fudan University
Innovation research institute, Zhuhai Fudan University
<120>preparation and its application method of women primary sterility are caused for treating crossing barriers
<130> 001
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3061
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aatttctttt caatattagc ttattcccaa attggctaat gggtattttt aaagccatgc 60
taaattaaag gaattcaatt ttctcactag tatttggtaa cacatgggag actatgtgtc 120
atatccagaa gagttctgta catgaactgc atttaattgc tccgagagtc actggagctt 180
tctttaatca gaatggaaat caggataagc tgaggtctta tagattggtg gtacttaagg 240
cagaaaatta acaccgtgtt ttgtagctgt tagttggtag agggaaattc aggctaccgt 300
cgcgaaacct gcaggttaag ttattttctc ctccctgctt ctgtaggttc acagcgttcc 360
cttctgatag agctttttgt ctgtgttgta aagctctttg gctgagatgg atgacaaaga 420
tattgacaaa gaactaaggc agaaattaaa cttttcctat tgtgaggaga ctgagattga 480
agggcagaag aaagtagaag aaagcaggga ggcttcgagc caaaccccag agaagggtga 540
agtgcaggat tcagaggcaa agggtacacc accttggact ccccttagca acgtgcatga 600
gctcgacaca tcttcggaaa aagacaaaga aagtccagat cagattttga ggactccagt 660
gtcacaccct ctcaaatgtc ctgagacacc agcccaacca gacagcagga gcaagctgct 720
gcccagtgac agcccctcta ctcccaaaac catgctgagc cggttggtga tttctccaac 780
agggaagctt ccttccagag gccctaagca tttgaagctc acacctgctc ccctcaagga 840
tgagatgacc tcattggctc tggtcaatat taatcccttc actccagagt cctataaaaa 900
attatttctt caatctggtg gcaagaggaa aataagagga gatcttgagg aagctggtcc 960
agaggaaggc aagggagggc tgcctgccaa gagatgtgtt ttacgagaaa ccaacatggc 1020
ttcccgctat gaaaaagaat tcttggaggt tgaaaaaatt ggggttggcg aatttggtac 1080
agtctacaag tgcattaaga ggctggatgg atgtgtttat gcaataaagc gctctatgaa 1140
aacttttaca gaattatcaa atgagaattc ggctttgcat gaagtttatg ctcacgcagt 1200
gcttgggcat cacccccatg tggtacgtta ctattcctca tgggcagaag atgaccacat 1260
gatcattcag aatgaatact gcaatggtgg gagtttgcaa gctgctatat ctgaaaacac 1320
taagtctggc aatcattttg aagagccaaa actcaaggac atccttctac agatttccct 1380
tggccttaat tacatccaca actctagcat ggtacacctg gacatcaaac ctagtaatat 1440
attcatttgt cacaagatgc aaagtgaatc ctctggagtc atagaagaag ttgaaaatga 1500
agctgattgg tttctctctg ccaatgtgat gtataaaatt ggtgacctgg gccacgcaac 1560
atcaataaac aaacccaaag tggaagaagg agatagtcgc ttcctggcta atgagatttt 1620
gcaagaggat taccggcacc ttcccaaagc agacatattt gccttgggat taacaattgc 1680
agtggctgca ggagcagagt cattgcccac caatggtgct gcatggcacc atatccgcaa 1740
gggtaacttt ccggacgttc ctcaggagct ctcagaaagc ttttccagtc tgctcaagaa 1800
catgatccaa cctgatgccg aacagagacc ttctgcagca gctctggcca gaaatacagt 1860
tctccggcct tccctgggaa aaacagaaga gctccaacag cagctgaatt tggaaaagtt 1920
caagactgcc acactggaaa gggaactgag agaagcccag caggcccagt caccccaggg 1980
atatacccat catggtgaca ctggggtctc tgggacccac acaggatcaa gaagcacaaa 2040
acgcctggtg ggaggaaaga gtgcaaggtc ttcaagcttt acctcaggag agcgtgagcc 2100
tctgcattaa aggaagaaaa ggaaaacagc ccttggtttg gcctatggat tacgaggttg 2160
ctgttgctga ttccccacca aagatcccag ggactcgttg tacatagaaa ggaatagaat 2220
ttagtttaga gttgaagtca cagcttacag aaaatgtgcc tggatttcca cagcgcttcc 2280
caggttatat gatgctgttc ctaagagaga attcccagct tctttgagga agtgggtctc 2340
ctaatgtata ccctttctga tattgtattt attaaataaa tggtttcacc attatgtgag 2400
gtgggtaaaa gttagactgc atgcaacttg gacatctctg agctggttgt taacttgcag 2460
aacaaaaatg ctgtggggag aggcttcagg gaaaacttga tgtgcctgtg gttgttctcc 2520
atctatttgc cctgcctctc ttgctgttct ggttggtttg atattctggg tctcaccaat 2580
ttctcttgat ttttgtgaga atttggcttt gtttcctgtt ttttaaaatc atattttatc 2640
taaatccttt ttctgtacac atttttaaag gaagagaata ctgtattttt aaataaaggt 2700
ttttatcttg tccaaagcct aattacaggt aaaatatcct ttgtaaaatg taactaacaa 2760
agaatgagaa atttatgtcg gagaacattt tatgaataaa agggtaagag aattgagtgg 2820
gtcagtagta acaggtcttg gtggcaagtc tcagcttcac agttccaaca gttaatgatg 2880
gtcaggatct gctagaaaat tatgttggtc ataaaggtat ttgataagct ctgtttgtgt 2940
catcttagtg aatgcaacct gttaatgata atggcttttt cgctgcttga ttttcttctt 3000
ttcctcattt ttaaaagcta attaagtttt tttaattgaa taaaccctaa tactattctt 3060
t 3061
<210> 2
<211> 567
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Asp Asp Lys Asp Ile Asp Lys Glu Leu Arg Gln Lys Leu Asn Phe
1 5 10 15
Ser Tyr Cys Glu Glu Thr Glu Ile Glu Gly Gln Lys Lys Val Glu Glu
20 25 30
Ser Arg Glu Ala Ser Ser Gln Thr Pro Glu Lys Gly Glu Val Gln Asp
35 40 45
Ser Glu Ala Lys Gly Thr Pro Pro Trp Thr Pro Leu Ser Asn Val His
50 55 60
Glu Leu Asp Thr Ser Ser Glu Lys Asp Lys Glu Ser Pro Asp Gln Ile
65 70 75 80
Leu Arg Thr Pro Val Ser His Pro Leu Lys Cys Pro Glu Thr Pro Ala
85 90 95
Gln Pro Asp Ser Arg Ser Lys Leu Leu Pro Ser Asp Ser Pro Ser Thr
100 105 110
Pro Lys Thr Met Leu Ser Arg Leu Val Ile Ser Pro Thr Gly Lys Leu
115 120 125
Pro Ser Arg Gly Pro Lys His Leu Lys Leu Thr Pro Ala Pro Leu Lys
130 135 140
Asp Glu Met Thr Ser Leu Ala Leu Val Asn Ile Asn Pro Phe Thr Pro
145 150 155 160
Glu Ser Tyr Lys Lys Leu Phe Leu Gln Ser Gly Gly Lys Arg Lys Ile
165 170 175
Arg Gly Asp Leu Glu Glu Ala Gly Pro Glu Glu Gly Lys Gly Gly Leu
180 185 190
Pro Ala Lys Arg Cys Val Leu Arg Glu Thr Asn Met Ala Ser Arg Tyr
195 200 205
Glu Lys Glu Phe Leu Glu Val Glu Lys Ile Gly Val Gly Glu Phe Gly
210 215 220
Thr Val Tyr Lys Cys Ile Lys Arg Leu Asp Gly Cys Val Tyr Ala Ile
225 230 235 240
Lys Arg Ser Met Lys Thr Phe Thr Glu Leu Ser Asn Glu Asn Ser Ala
245 250 255
Leu His Glu Val Tyr Ala His Ala Val Leu Gly His His Pro His Val
260 265 270
Val Arg Tyr Tyr Ser Ser Trp Ala Glu Asp Asp His Met Ile Ile Gln
275 280 285
Asn Glu Tyr Cys Asn Gly Gly Ser Leu Gln Ala Ala Ile Ser Glu Asn
290 295 300
Thr Lys Ser Gly Asn His Phe Glu Glu Pro Lys Leu Lys Asp Ile Leu
305 310 315 320
Leu Gln Ile Ser Leu Gly Leu Asn Tyr Ile His Asn Ser Ser Met Val
325 330 335
His Leu Asp Ile Lys Pro Ser Asn Ile Phe Ile Cys His Lys Met Gln
340 345 350
Ser Glu Ser Ser Gly Val Ile Glu Glu Val Glu Asn Glu Ala Asp Trp
355 360 365
Phe Leu Ser Ala Asn Val Met Tyr Lys Ile Gly Asp Leu Gly His Ala
370 375 380
Thr Ser Ile Asn Lys Pro Lys Val Glu Glu Gly Asp Ser Arg Phe Leu
385 390 395 400
Ala Asn Glu Ile Leu Gln Glu Asp Tyr Arg His Leu Pro Lys Ala Asp
405 410 415
Ile Phe Ala Leu Gly Leu Thr Ile Ala Val Ala Ala Gly Ala Glu Ser
420 425 430
Leu Pro Thr Asn Gly Ala Ala Trp His His Ile Arg Lys Gly Asn Phe
435 440 445
Pro Asp Val Pro Gln Glu Leu Ser Glu Ser Phe Ser Ser Leu Leu Lys
450 455 460
Asn Met Ile Gln Pro Asp Ala Glu Gln Arg Pro Ser Ala Ala Ala Leu
465 470 475 480
Ala Arg Asn Thr Val Leu Arg Pro Ser Leu Gly Lys Thr Glu Glu Leu
485 490 495
Gln Gln Gln Leu Asn Leu Glu Lys Phe Lys Thr Ala Thr Leu Glu Arg
500 505 510
Glu Leu Arg Glu Ala Gln Gln Ala Gln Ser Pro Gln Gly Tyr Thr His
515 520 525
His Gly Asp Thr Gly Val Ser Gly Thr His Thr Gly Ser Arg Ser Thr
530 535 540
Lys Arg Leu Val Gly Gly Lys Ser Ala Arg Ser Ser Ser Phe Thr Ser
545 550 555 560
Gly Glu Arg Glu Pro Leu His
565
<210> 3
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gaggcgatcg ccatggatga caaagatatt gacaaagaac 40
<210> 4
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gcgacgcgtt taatgcagag gctcacgctc tc 32
<210> 5
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cggatccgat ggatgacaaa gatattgaca aagaac 36
<210> 6
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gcgctcgagt taatgcagag gctcacgctc tc 32

Claims (3)

1. a kind of preparation for causing women primary sterility for treating crossing barriers, which is characterized in that said preparation is by a certain concentration WEE2 cRNA or WEE2 protein is formulated, and the cDNA sequence of the WEE2 gene is described as shown in SEQ ID NO.1 The amino acid sequence of WEE2 albumen is as shown in SEQ ID NO.2；The concentration of WEE2 cRNA is 300-1000ng/ul；WEE2 albumen The concentration of matter is 0.5-1mg/ml.
2. a kind of application method of preparation as described in claim 1, which is characterized in that specific steps are as follows:
(1) take out patient's ovum, granular cell is digested, select MII phase ovum, first progress WEE2 cRNA preparation or The injection of WEE2 protein formulation, injection concentration: WEE2 cRNA is 300-1000ng/ul, and WEE2 protein formulation is 0.5-1mg/ Ml is carried out intracytoplasmic sperm injection (ICSI) again after volume injected 5-15pL, 4-5 hours, and it is former that male and female are observed after 15-18h Karyomorphism at；
(2) the fertilized eggs culture for forming protokaryon is observed the 5-6 days, normotrophic blastaea biopsy is frozen simultaneously, chromosome Normal blastaea will be used to transplant in the future.
3. a kind of gene therapy method for causing the primary infertile patient of women for crossing barriers, which is characterized in that specific steps are as follows:
(1) preparation of WEE2 cRNA preparation and WEE2 protein formulation
(a) prepared by WEE2 cRNA preparation: (close containing terminating by the code area of PCR amplification WEE2 by template of WEE2 gene cDNA Numeral), purified pcr product and structure enters carrier pCMV6 after SfaAI and MluI double digestion as template will be carried with AgeI The cRNA at WEE2 is transcribed in vitro in body single endonuclease digestion, and by its concentration dilution to 300-1000ng/ul；
(b) prepared by WEE2 protein formulation: (containing and terminates by the code area of PCR amplification WEE2 using WEE2 gene cDNA as template Codon), purified pcr product and structure enters carrier pFast-Bac1 after BamHI and XhoI double digestion as template turns Change DH10Bac E.coli, positive colony and sequence verification are chosen by the screening of blue hickie；Bacmid plasmid transfection Sf9 insect is thin Born of the same parents obtain P1 generation and P2 generation virus；P2 continues to infect Sf9 cell for virus, infects 48-72 hours collection cells；Ultrasonication, Ultracentrifugation takes supernatant；Destination protein is obtained after purified, adjustment concentration is 0.5-1mg/ml；
(2) take out patient's ovum, granular cell is digested, select MII phase ovum, first progress WEE2 cRNA preparation or The injection of WEE2 protein formulation, injection concentration: WEE2 cRNA is 300-1000ng/ul, and WEE2 protein formulation is 0.5-1mg/ Ml is carried out intracytoplasmic sperm injection (ICSI) again after volume injected 5-15pL, 4-5 hours, and it is former that male and female are observed after 15-18h Karyomorphism at；
(3) the fertilized eggs culture for forming protokaryon is observed the 5-6 days, normotrophic blastaea biopsy is frozen simultaneously, chromosome Normal blastaea will be used to transplant in the future.
CN201910626680.0A 2019-07-11 2019-07-11 The preparation and its application method of women primary sterility are caused for treating crossing barriers Pending CN110327470A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910626680.0A CN110327470A (en) 2019-07-11 2019-07-11 The preparation and its application method of women primary sterility are caused for treating crossing barriers

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910626680.0A CN110327470A (en) 2019-07-11 2019-07-11 The preparation and its application method of women primary sterility are caused for treating crossing barriers

Publications (1)

Publication Number Publication Date
CN110327470A true CN110327470A (en) 2019-10-15

Family

ID=68146457

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910626680.0A Pending CN110327470A (en) 2019-07-11 2019-07-11 The preparation and its application method of women primary sterility are caused for treating crossing barriers

Country Status (1)

Country Link
CN (1) CN110327470A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112342238A (en) * 2020-10-21 2021-02-09 复旦大学 Ovum function restoring preparation for inducing ovum maturation disorder by TRIP13 gene mutation and using method thereof
CN112359062A (en) * 2020-10-21 2021-02-12 复旦大学 Ovum function restoring preparation for inducing ovum maturation disorder by CDC20 mutation and use method thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013006948A1 (en) * 2011-07-08 2013-01-17 Robert Casper Methods and compositions for enhancing developmental potential of oocytes and preimplantation embryos
CN109913541A (en) * 2017-12-12 2019-06-21 深圳先进技术研究院 The application of GPR1 target spot and its antagonist in infertile related disease

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013006948A1 (en) * 2011-07-08 2013-01-17 Robert Casper Methods and compositions for enhancing developmental potential of oocytes and preimplantation embryos
CN109913541A (en) * 2017-12-12 2019-06-21 深圳先进技术研究院 The application of GPR1 target spot and its antagonist in infertile related disease

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
SANG Q等: "Homozygous Mutations in WEE2 Cause Fertilization Failure and Female Infertility" *
SANG Q等: "NM_001105558.1" *
YANG X等: "Homozygous missense mutation Arg207Cys in the WEE2 gene causes female infertility and fertilization failure" *
ZHAO S等: "Novel WEE2 gene variants identified in patients with fertilization failure and female infertility" *
刘超等: "Wee1B蛋白S15位点突变抑制小鼠1-细胞期受精卵的发育" *
王宁等: "辅助生殖技术基础研究新进展" *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112342238A (en) * 2020-10-21 2021-02-09 复旦大学 Ovum function restoring preparation for inducing ovum maturation disorder by TRIP13 gene mutation and using method thereof
CN112359062A (en) * 2020-10-21 2021-02-12 复旦大学 Ovum function restoring preparation for inducing ovum maturation disorder by CDC20 mutation and use method thereof

Similar Documents

Publication Publication Date Title
McKinnon Glaucoma, apoptosis, and neuroprotection
CN105209619B (en) MiR-204 and miR-211 and application thereof
Custers et al. Couples with unexplained subfertility and unfavorable prognosis: a randomized pilot trial comparing the effectiveness of in vitro fertilization with elective single embryo transfer versus intrauterine insemination with controlled ovarian stimulation
PT93996B (en) PROCESS FOR THE PRODUCTION OF GROWTH FACTOR OF VASCULAR ENDOTHELIAL CELLS AND OF THE DNA CODE OF THE SAME
WO2022194109A1 (en) Complex for treating optic nerve disease, and preparation method therefor and use thereof
CN110327470A (en) The preparation and its application method of women primary sterility are caused for treating crossing barriers
CN110381982A (en) Composition relevant to myocyte&#39;s fusion that MYOMIXER promotes and method
US20210085766A1 (en) Amh-inh-gnih tri-expression gene vaccine of improving fecundity of animals, preparation method and application
Kim et al. Successful pregnancy and delivery after ICSI with artificial oocyte activation by calcium ionophore in in-vitro matured oocytes: a case report
CN110724203A (en) Short peptide for promoting TFEB (T-Epstein-Barr) nuclear translocation, linear short peptide based on short peptide and application of short peptide in relieving cerebral ischemic injury
Hedrick et al. Isolation of extracellular matrix structures from Xenopus laevis oocytes, eggs, and embryos
Aslam et al. Therapeutical significance of Serpina3n subsequent cerebral ischemia via cytotoxic granzyme B inactivation
Ueno et al. Developmental potential of zona pellucida–free oocytes obtained following mild in vitro fertilization
CN109715191A (en) Pharmaceutical associations for the conversion of neoplastic cells into non-neoplastic cells and uses thereof
KR100627754B1 (en) Method for Enhancing Proliferation of Inner Ear Hair Cells Using Ligands for HER2 and/or HER3 Receptors
US10808026B2 (en) Monoclonal Olfml-3 antibodies and uses thereof
CN112359062A (en) Ovum function restoring preparation for inducing ovum maturation disorder by CDC20 mutation and use method thereof
CN103443276B (en) For healing or treating the molecular target of wound
KR102620242B1 (en) A composition for enhancing endometrial blood flow rate comprising botulinium toxin or its salt
US20190054137A1 (en) Peptides and methods for treatment of neurodegenerative diseases
CN112342238A (en) Ovum function restoring preparation for inducing ovum maturation disorder by TRIP13 gene mutation and using method thereof
CN109200289B (en) FAM134B treats the purposes in pyemic drug in preparation
WO2022253340A1 (en) Peptide translated by circular rna circ-ace2 and application thereof
Haas et al. The role of mitochondria in reproductive function and assisted reproduction
CN113502299B (en) Production method of staphylococcus aureus-resistant genetically modified goat

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20191015

WD01 Invention patent application deemed withdrawn after publication