CN110325642B

CN110325642B - Microorganism of corynebacterium genus producing L-amino acid and method for producing L-amino acid using the same

Info

Publication number: CN110325642B
Application number: CN201980000870.XA
Authority: CN
Inventors: 孙承珠; 尹炳勋; 李光雨; 金善慧; 卞效情; 张真淑; 金亨俊; 申容旭
Original assignee: CJ CheilJedang Corp
Current assignee: CJ CheilJedang Corp
Priority date: 2018-01-25
Filing date: 2019-01-25
Publication date: 2021-04-13
Anticipated expiration: 2039-01-25
Also published as: PH12020551045A1; CA3086227A1; MX2020007037A; KR101947945B1; JP2021511009A; EP3567110A4; ZA202003315B; AU2019212400B8; BR112019019376A2; JP7090159B2; CN110325642A; AU2019212400B2; CN113046288A; US11180784B2; RU2754781C1; WO2019147059A1; CN113046288B; CA3086227C; IL275641A; EP3567110A1

Abstract

Microorganisms of Corynebacterium genus that produce L-amino acid, and a method for producing L-amino acid using the same are provided.

Description

Microorganism of corynebacterium genus producing L-amino acid and method for producing L-amino acid using the same

[ technical field ]

The present disclosure relates to a microorganism of Corynebacterium genus that produces L-amino acid, and a method for producing L-amino acid using the same.

[ background art ]

L-amino acids are basic structural units of proteins and are used as important materials for pharmaceuticals, food additives, animal feeds, nutrients, pesticides, bactericides and the like. Among L-amino acids, L-lysine is an essential amino acid which is not biosynthesized in an organism and is known to be essential for promoting growth, calcium metabolism, promoting gastric secretion and resisting diseases. L-lysine is widely used in feeds, medical products, foods and the like. In addition, L-valine is also one of essential amino acids, and is known to have an antioxidant effect and an effect of directly promoting muscle cell protein synthesis. L-valine is used in health products, medical products, foods, feeds, perfumes, hair and skin conditioners, etc.

Meanwhile, Corynebacterium strains, particularly Corynebacterium glutamicum, are gram-positive microorganisms frequently used for the production of L-amino acids and other useful substances. Many studies have been conducted to develop microorganisms having high production efficiency and fermentation techniques for producing amino acids. For example, target material-specific methods of increasing the expression of genes encoding enzymes involved in amino acid biosynthesis or removing unnecessary genes in amino acid biosynthesis in Corynebacterium strains have been mainly used (Korean patent Nos. 10-0924065 and 1208480). In addition to these methods, a method of deleting a gene not involved in amino acid production and a method of deleting a gene whose specific function in amino acid production is unknown are used. However, there is still a need to develop a method capable of efficiently producing an L-amino acid with a high yield.

In this context, the present inventors have conducted intensive studies to develop microorganisms capable of producing L-amino acids in high yield, and as a result, they have found that the yield of L-amino acids is increased when a specific gene is inactivated, thereby completing the present disclosure.

Disclosure of Invention

[ problem ] to

The object of the present disclosure is to provide a microorganism of Corynebacterium genus that produces L-amino acid, wherein the L-amino acid is represented by SEQ ID NO: 1 is inactivated.

It is another object of the present disclosure to provide a method for producing an L-amino acid using the microorganism.

It is still another object of the present disclosure to provide use of a microorganism for enhancing L-amino acid productivity.

It is still another object of the present disclosure to provide a method for enhancing the productivity of an L-amino acid, comprising: inactivating a microorganism of corynebacterium genus consisting of SEQ ID NO: 1 in the sequence listing.

[ solution ]

The present disclosure will be described in detail as follows. Also, the description and embodiments disclosed herein may be applied to other descriptions and embodiments. In other words, all combinations of the various elements disclosed herein are within the scope of the present disclosure. Further, the scope of the present disclosure is not limited to the specific description described below.

To achieve the above object, one aspect of the present disclosure provides a microorganism of corynebacterium genus that produces an L-amino acid, wherein the L-amino acid is represented by SEQ ID NO: 1 is inactivated.

As used herein, the term "L-amino acid" may include all L-amino acids that may be produced by microorganisms from many different kinds of carbon sources by metabolic processes. Specifically, the L-amino acid may include basic amino acids such as L-lysine, L-arginine, L-histidine, etc.; nonpolar amino acids such as L-valine, L-leucine, L-glycine, L-isoleucine, L-alanine, L-proline, L-methionine, etc.; polar amino acids such as L-serine, L-threonine, L-cysteine, L-asparagine, L-glutamine, etc.; aromatic amino acids such as L-phenylalanine, L-tyrosine, L-tryptophan, etc.; acidic amino acids such as L-glutamic acid, L-aspartic acid; aliphatic amino acids such as L-alanine, L-valine, L-isoleucine, L-serine, etc.; and branched chain amino acids such as L-valine, L-leucine, L-isoleucine and the like. In the present disclosure, the L-amino acid may be more specifically a basic amino acid, an aliphatic amino acid, a branched amino acid, etc., and more specifically, L-lysine or L-valine, but is not limited thereto. The L-amino acid may include any amino acid without limitation so long as when represented by SEQ ID NO: 1 is inactivated, and the productivity thereof is increased.

As used herein, the term "consists of SEQ ID NO: 1 "refers to a protein encoded by NCgl0275 gene inherently present in a microorganism of the genus corynebacterium, and specifically, a protein encoded by the sequence of SEQ ID NO: 1 in the sequence listing. SEQ ID NO: 1 and the polynucleotide sequence of the gene encoding the protein can be obtained from known databases such as, but not limited to, the gene bank of NCBI and the like. In addition, the protein may be a polypeptide comprising SEQ ID NO: 1, consisting essentially of the amino acid sequence of SEQ ID NO: 1, or a protein consisting of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

Furthermore, the proteins of the present disclosure may be encoded by a sequence identical to SEQ ID NO: 1 and SEQ ID NO: 1 has an amino acid sequence composition having 80% or more homology. Consists of a nucleotide sequence identical to SEQ ID NO: 1 may include a protein consisting of an amino acid sequence having 80% or more homology with the amino acid sequence of SEQ ID NO: 1, specifically 83% or more, 84% or more, 88% or more, 90% or more, 93% or more, 95% or more, or 97% or more. Obviously, any amino acid sequence having deletion, modification, substitution, conservative substitution or addition in a partial sequence is also included as an amino acid sequence having homology or identity with a sequence within the scope of the present disclosure as long as it is a sequence having a sequence identical to SEQ ID NO: 1 has substantially the same or a corresponding biologically active amino acid sequence.

In the present disclosure, although described as "a protein or polypeptide consisting of a specific SEQ ID NO", it is obviously within the scope of the present disclosure that it may comprise an amino acid sequence having deletions, modifications, substitutions, conservative substitutions or insertions in a partial sequence, as long as the protein has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO. Even when the polypeptide comprises the amino acid sequence of a particular SEQ ID NO, it is clearly within the scope of the present disclosure.

In addition, a probe may be included, without limitation, which can be prepared from a known gene sequence, for example, a sequence encoding a protein having a sequence represented by SEQ ID NO: 1 in the sequence listing.

For example, a polypeptide represented by SEQ ID NO: 1 can be composed of a protein comprising the amino acid sequence of SEQ ID NO: 2. Furthermore, the polypeptide represented by SEQ ID NO: 1 can be composed of a protein comprising the amino acid sequence of SEQ ID NO: 2 consisting essentially of the polynucleotide sequence of SEQ ID NO: 2, or a gene consisting of the polynucleotide sequence of SEQ ID NO: 2, but is not limited thereto.

Furthermore, SEQ ID NO: 2 may comprise a nucleotide sequence identical to SEQ ID NO: 2 and SEQ ID NO: 2, or a polynucleotide sequence having at least 80% homology thereto.

Specifically, any polynucleotide sequence is included within the scope of the present disclosure as long as it can encode a polypeptide comprising the sequence of SEQ ID NO: 1 a protein having an amino acid sequence with at least 80% homology. The protein may be encoded by a gene comprising a polynucleotide sequence that hybridizes to SEQ ID NO: 2, in particular 83% or more, 84% or more, 88% or more, 90% or more, 93% or more, 95% or more, or 97% or more homology or identity.

It is also apparent that in SEQ ID NO: 2, further comprising a polynucleotide sequence translated from SEQ ID NO: 1 or a protein having homology thereto due to codon degeneracy. Probes prepared from known nucleotide sequences that hybridize under stringent conditions to a sequence complementary to all or a portion of a polynucleotide sequence to encode a probe having a sequence represented by SEQ ID NO: 1, or a pharmaceutically acceptable salt thereof. "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. These conditions are described in detail in the literature (e.g., J.Sambrook et al, Molecular Cloning, A Laboratory Manual,2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M.Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). Stringent conditions may include, for example, conditions under which genes having high homology, 40% or more homology, specifically 90% or more homology, more specifically 95% or more homology, more specifically 97% or more homology, still more specifically 99% or more homology hybridize to each other, and genes having lower homology than the above do not hybridize to each other, or ordinary washing conditions for Southern hybridization, i.e., washing once, specifically two or three times, at a salt concentration and temperature corresponding to: 60 ℃,1 x SSC, 0.1% SDS, specifically, 60 ℃, 0.1 x SSC, 0.1% SDS, more specifically 68 ℃, 0.1 x SSC, 0.1% SDS. Hybridization requires that the two polynucleotides contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, in the case of DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Thus, the present disclosure may also include isolated polynucleotide fragments that are complementary to the entire sequence as well as polynucleotide sequences substantially similar thereto.

Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step under the above conditions with a Tm value of 55 ℃. Further, the Tm value may be 60 ℃,63 ℃ or 65 ℃, but is not limited thereto, and is appropriately controlled by those skilled in the art according to the purpose thereof.

As used herein, the term "homology" or "identity" refers to the degree of match with a given amino acid sequence or polynucleotide sequence, and homology can be expressed as a percentage. The terms "homology" and "identity" are generally used interchangeably with each other. In the present disclosure, homologous sequences having the same or similar activity as a given amino acid sequence or polynucleotide sequence are denoted as "% homology".

Homology or identity to amino acid or polynucleotide sequences can be determined, for example, by the algorithm BLAST [ see Karlin and Altschul, Pro.Natl.Acad.Sci.USA,90,5873(1993) ] or by Pearson's FASTA [ see Methods enzymol.,183,63(1990) ]. Based on the algorithm BLAST, a program called BLASTN or BLASTX [ see http:// www.ncbi.nlm.nih.gov ] has been developed.

In addition, homology, similarity or identity between amino acid or polynucleotide sequences can be determined by comparing the sequences using Southern hybridization under stringent conditions. Stringent conditions are within the scope of the corresponding art and can be determined by methods understood by those skilled in the art (e.g., J.Sambrook et al, Molecular Cloning, A Laboratory Manual,2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M.Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

As used herein, the phrase "consisting of SEQ ID NO: 1 "means that the protein is not expressed at all, or the protein is expressed but shows NO activity, or the protein is inactivated compared to a natural wild-type strain, a parent strain, or a protein consisting of the amino acid sequence of SEQ ID NO: 1, the activity of the unmodified strain is reduced as compared with the activity of the unmodified strain. In this regard, the reduction refers to a concept including the following cases: a case where the activity of the protein itself is lower than that of the protein originally possessed in the microorganism due to modification or deletion of a gene encoding the protein; the level of total protein activity in the cell is lower than that of the native strain or the strain before modification due to inhibition of expression or translation of the gene encoding the protein; or a combination thereof.

In the present disclosure, inactivation may be achieved by various methods well known in the art. Examples of the method may include 1) a method of deleting all or part of a gene encoding a protein; 2) a method of modifying an expression control sequence so that the expression of a gene encoding a protein is reduced; 3) a method of modifying a gene sequence encoding a protein so as to remove or attenuate the activity of the protein; 4) methods of introducing antisense oligonucleotides (e.g., antisense RNA) that complementarily bind to a transcript of a gene encoding a protein; 5) a method in which a Shine-Dalgarno sequence and a complementary sequence thereof are added to the front end of a Shine-Dalgarno sequence of a gene encoding a protein to form a secondary structure, thereby making a ribosome not to attach; 6) a method of Reverse Transcription Engineering (RTE) in which a promoter for reverse transcription is added to the 3' -end of the Open Reading Frame (ORF) of a polynucleotide sequence of a gene encoding a protein, and the like, and combinations thereof may also be included, but is not particularly limited thereto.

Specifically, a method of deleting part or all of the gene encoding the protein can be performed by: the polynucleotide encoding the endogenous target protein within the chromosome is replaced with a polynucleotide lacking a part of the nucleotide sequence or a marker gene, and used for chromosomal insertion into a microorganism via a vector. In an exemplary embodiment of the method of deleting a part or all of the polynucleotide, a method of deleting a polynucleotide by homologous recombination may be used, but is not limited thereto. In another exemplary embodiment of the method of deleting part or all of the polynucleotide, mutation may be induced using light such as UV or chemicals, and a strain having the deleted target gene is selected from the obtained mutants.

The method of deleting a gene may include a method using a gene recombination technique. For example, a polynucleotide sequence or a vector comprising a polynucleotide sequence having homology to a target gene is introduced into a microorganism to cause homologous recombination. In addition, the polynucleotide sequence or vector to be introduced may include a dominant selection marker, but is not limited thereto.

In addition, the method of modifying the expression control sequence can be accomplished by applying various methods well known in the art. For example, the method may further attenuate the activity of the expression control sequence by inducing a modification of the expression control sequence in the polynucleotide sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or by replacing the expression control sequence with a polynucleotide sequence having weaker activity. The expression control sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding region, and a sequence controlling termination of transcription and translation.

In addition, the method of modifying a nucleotide sequence may be performed by inducing a modification in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the nucleotide sequence to further attenuate the enzyme activity, or by replacing the nucleotide sequence with a nucleotide sequence improved to have weaker activity or a nucleotide sequence improved to have no activity, but is not limited thereto.

As used herein, the term "L-amino acid-producing microorganism" may refer to a microorganism naturally having the ability to produce an L-amino acid or a microorganism prepared by imparting the ability to produce an L-amino acid to a parent strain having no ability to produce an L-amino acid. For example, the L-amino acid-producing microorganism may be a microorganism in which the amino acid sequence represented by SEQ ID NO: 1, or a microorganism in which the activity of the protein consisting of the amino acid sequence of 1 is inactivated. In addition, the L-amino acid-producing microorganism may be a microorganism in which the expression of a gene encoding an enzyme involved in the biosynthetic pathway of L-amino acids is enhanced or an enzyme involved in the degradation pathway is inactivated. Alternatively, the L-amino acid producing microorganism may be produced by inactivating the amino acid sequence represented by SEQ ID NO: 1, wherein the expression of a gene encoding an enzyme involved in the biosynthetic pathway of L-amino acids is enhanced or an enzyme involved in the degradation pathway is inactivated. L-amino acid-producing microorganisms can be prepared by applying various known methods.

In the present disclosure, "microorganism of Corynebacterium genus" may include all microorganisms of Corynebacterium genus, specifically, Corynebacterium glutamicum, Corynebacterium crohnii (Corynebacterium crenulatum), Corynebacterium desertificum (Corynebacterium desugarium), Corynebacterium hepaticum (Corynebacterium efficiens), Corynebacterium saccharolyticum (Corynebacterium calcoaceticus), Corynebacterium parvum (Corynebacterium staphylium), Corynebacterium miraculum (Corynebacterium luteum), Corynebacterium halodurans (Corynebacterium halodurans), Corynebacterium striatum (Corynebacterium striatum), Corynebacterium ammoniagenes, Corynebacterium contaminations (Corynebacterium polutisonatum), Corynebacterium imminium (Corynebacterium immitis), Corynebacterium testis (Corynebacterium testinum) or Corynebacterium flavum (Corynebacterium flavum), and more specifically, Corynebacterium glutamicum may be Corynebacterium glutamicum.

Microorganism of corynebacterium genus that produces L-amino acid — wherein the amino acid sequence represented by SEQ ID NO: 1-may be a microorganism in which L-amino acid productivity is improved. Specifically, the microorganism may be a microorganism having an increased L-amino acid productivity as compared with an unmodified strain. The unmodified strain may be a native wild-type strain, a parental strain, or an unmodified strain, wherein the amino acid sequence encoded by SEQ ID NO: 1 is not inactivated.

Another aspect of the present disclosure provides a method for producing an L-amino acid, the method comprising culturing a microorganism according to the present disclosure in a medium; and a step of recovering the L-amino acid from the microorganism or the culture medium.

The microorganisms according to the present disclosure are the same as described above.

In the methods of the present disclosure, the culturing of the microorganism of corynebacterium genus may be performed using any culture conditions and methods known in the art.

As used herein, the term "culturing" refers to allowing a microorganism to grow under artificially controlled environmental conditions. In the present disclosure, a method for producing an L-amino acid using an L-amino acid-producing microorganism can be performed using a method well known in the art. Specifically, the cultivation may be performed by a batch method, a feed method, or a continuous manner repeated feed method, but is not limited thereto. Any medium for cultivation can be used without limitation, for example, media for Corynebacterium strains are known in the art (e.g., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).

Suitable carbon sources for the culture medium may include sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid and linoleic acid; alcohols such as ethanol and glycerol; and organic acids such as acetic acid. These may be used alone or in combination, but are not limited thereto.

Suitable nitrogen sources may include peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean cake, and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. These nitrogen sources may also be used alone or in combination, but are not limited thereto.

Suitable phosphorus sources may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or the corresponding sodium-containing salts. In addition, the culture medium may include metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth factors such as amino acids and vitamins may be used in addition to the above-mentioned substances, but are not limited thereto. In addition, precursors suitable for the culture medium may be used. These substances may be appropriately added to the culture during the culture in a batch or continuous manner, but are not limited thereto.

During the cultivation of the microorganisms, basic compounds such as sodium hydroxide, potassium hydroxide or ammonia, or acidic compounds such as phosphoric acid or sulfuric acid, may be added in a suitable manner to adjust the pH of the culture. In addition, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. In order to maintain aerobic conditions, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture, but is not limited thereto. The temperature of the culture may be generally 20 ℃ to 45 ℃, particularly 25 ℃ to 40 ℃. The culture may be continued until the desired amount of the L-amino acid is produced, and it may be usually achieved within 10 hours to 160 hours, but is not limited thereto.

The L-amino acid can be recovered from the culture by a conventional method known in the art. Recovery methods may include centrifugation, filtration, chromatography, crystallization, and the like. For example, a supernatant obtained by centrifuging the medium at a low speed and removing the biomass may be separated by ion exchange chromatography, but is not limited thereto.

The recovery step may also include a purification process.

Yet another aspect of the present disclosure provides a use of a microorganism of corynebacterium genus for enhancing L-amino acid productivity, wherein the L-amino acid is represented by SEQ ID NO: 1 is inactivated.

Yet another aspect of the present disclosure provides a method for enhancing the productivity of an L-amino acid, comprising: inactivation of a microorganism belonging to the genus corynebacterium consisting of SEQ ID NO: 1 in the sequence listing.

[ advantageous effects ]

The L-amino acid-producing microorganism of the present disclosure can produce an L-amino acid in a high yield. Furthermore, the prepared L-amino acid can be applied to various products, such as foods or food additives for human or medical products and feeds or feed additives for animals.

[ embodiment ]

Hereinafter, the present disclosure will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present disclosure is not intended to be limited by these examples.

Example 1: random mutant pool preparation Using transposons

In order to obtain a strain with improved lysine productivity, a library of vectors was prepared by the following method.

First, it will be determined by using EZ-Tn5^TM<R6Kγori/KAN-2>Tnp Transposome^TMThe plasmid obtained from the kit (Epicentre) was transformed into Corynebacterium glutamicum KCCM11016P (Korean patent No. 10-0159812; the microorganism is published as KFCC10881 and deposited as a mother strain in the International Depositary organization (International Depositary Automation) according to the Budapest treaty (accession No. KCCM11016P) by an electric pulse method (appl. Microbiol. Biothcenol.52:541-545,1999) and smeared on a composite medium plate (25mg/L) containing kanamycin to obtain about 20,000 colonies.

< Complex Medium plate (pH7.0) >

10g glucose, 10g peptone, 5g beef extract, 5g yeast extract, 18.5g brain heart infusion, 2.5g NaCl, 2g urea, 91g sorbitol, 20g agar (based on 1 liter distilled water).

Example 2: screening of random mutant pools Using transposons

Each of about 20,000 colonies obtained in example 1 was inoculated into 300. mu.L or less of selection medium and cultured in a 96-deep well plate at 32 ℃ for about 24 hours at 1000 rpm.

< selection Medium (pH8.0) >

10g glucose, 5.5g ammonium sulfate, 1.2g MgSO₄·H₂O、0.8g KH₂PO₄、16.4gK₂HPO₄100. mu.g biotin, 1mg thiamine hydrochloride, 2mg calcium pantothenate, 2mg nicotinamide (based on 1 liter of distilled water).

The amount of L-lysine produced in the medium was analyzed using the ninhydrin method (Moore, S., Stein, W.H., Photometric peptide method for use in the chromatography of amino acids.J.biol.chem.1948,176, 367-388).

After completion of the incubation, 10. mu.L of the culture supernatant and 190. mu.L of the ninhydrin reaction solution were reacted at 65 ℃ for 30 minutes. Thereafter, the absorbance was measured at a wavelength of 570nm using a spectrophotometer, and about 60 colonies showing high absorbance compared to the corynebacterium glutamicum KCCM11016P strain as a control group were selected. It was confirmed that other colonies showed similar or decreased absorbance compared to the Corynebacterium glutamicum KCCM11016P strain used as a control group.

The 60 selected strains were cultured in the same manner as described above, and the ninhydrin reaction was repeated. As a result, the first 10 mutant strains having improved L-lysine productivity as compared with Corynebacterium glutamicum KCCM11016P strain as a parent strain were selected.

Example 3: analysis of L-lysine productivity of selected mutant Strain

In order to finally select strains having increased L-lysine productivity, 10 mutant strains selected in example 2 were cultured by the following method. Each strain was inoculated in a 250mL triangular shake flask (corner-buffered flash) containing 25mL of seed medium and cultured at 30 ℃ for 20 hours with shaking at 200 rpm. Then, 1mL of the seed culture was inoculated into a 250mL triangular shake flask containing 24mL of the production medium and cultured at 32 ℃ for 72 hours with shaking at 200 rpm. Each seed medium and production medium had the following composition. After completion of the culture, the L-lysine concentration in the medium was analyzed using HPLC (Waters, 2478), and the L-lysine concentration of each mutant strain is shown in Table 1 below.

< seed culture Medium (pH7.0) >

20g glucose, 10g peptone, 5g yeast extract, 1.5g urea, 4g KH₂PO₄、8g K₂HPO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1mg thiamine hydrochloride, 2mg calcium pantothenate, 2mg nicotinamide (based on 1 liter of distilled water)

< production Medium (pH7.0) >

100g glucose, 40g (NH)₄)₂SO₄2.5g of soy protein, 5g of corn steep liquor solids, 3g of urea, 1g of KH₂PO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1mg thiamine hydrochloride, 2mg calcium pantothenate, 3mg nicotinamide, 30g CaCO₃(based on 1 liter of distilled water)

[ Table 1]

L-lysine concentration produced by 10 selected random mutant strains

Among the above 10 selected mutants, KCCM11016P/mt-3 was finally selected as a strain having significantly improved L-lysine productivity.

Example 4: identification of the cause of the increase in L-lysine productivity in the finally selected strains

In this example, genes deleted due to random insertion of transposons were identified in the mutant strains finally selected in example 3.

KCCM11016P/mt-3 genomic DNA showing the most excellent L-lysine productivity was extracted and then digested. Then, the resultant was ligated, transformed into E.coli DH5 α, and then spread on LB solid medium containing kanamycin (25 mg/L). After selecting 20 transformed colonies, a plasmid containing a part of the unknown gene was obtained and EZ-Tn5 was used^TM<R6Kγori/KAN-2>Tnp Transposome^TMPrimer 1(SEQ ID NO: 3) and primer 2(SEQ ID NO: 4) in the kit analyze nucleotide sequences.

As a result, it was confirmed that SEQ ID NO: 2. Confirmation of SEQ ID NO: 2 encodes the polynucleotide of SEQ ID NO: 1, and SEQ ID NO: 2 is a regulatory protein whose function is not specifically disclosed, based on the nucleotide sequence reported in the U.S. NIH gene bank.

Primer 1(SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC

Primer 2(SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT

Therefore, in order to examine whether inactivation of protein activity affects L-lysine productivity, the gene was selected as a deletion candidate gene.

Example 5: construction of recombinant vector for Gene deletion

In this example, to confirm the sequence encoded by SEQ ID NO: 1 affects L-lysine production, a recombinant plasmid for deleting the gene selected in example 4 on the chromosome of a microorganism of Corynebacterium genus that produces L-lysine was constructed. For this, primers 3 to 6 as shown in table 2 below were synthesized.

[ Table 2]

Primers 3 to 6 for preparing a fragment for gene deletion

In detail, in order to delete the ORF of NCgl0275 gene (SEQ ID NO: 2), primer 3(SEQ ID NO: 5), primer 4(SEQ ID NO: 6), primer 5(SEQ ID NO: 7) and primer 6(SEQ ID NO: 8) (Table 2) were synthesized to have EcoRI and SalI restriction sites at the 5 '-and 3' -ends, respectively, and PCR was performed using the genomic DNA of wild type Corynebacterium glutamicum ATCC 13032 as a template (Sambrook et al, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, 1989).

As a result, a DNA fragment of 500bp corresponding to the upstream and downstream regions of the gene was amplified. In this regard, the PCR conditions were as follows: 30 cycles, each cycle consisting of: denaturation at 95 ℃ for 30 seconds; renaturation at 50 ℃ for 30 seconds; elongation was carried out at 72 ℃ for 1 minute and then at 72 ℃ for 7 minutes. A pDZ vector incapable of replication in Corynebacterium glutamicum (Korean patent No. 10-0924065) and a DNA fragment amplified by PCR were treated with EcoRI and SalI restriction enzymes for chromosome insertion, ligated to each other using DNA ligase, transformed into E.coli DH 5. alpha. and then spread on LB solid medium containing kanamycin (25 mg/L).

After selecting a colony transformed with a plasmid into which a desired gene was inserted by PCR, a plasmid was obtained using a plasmid extraction method and designated pDZ-. DELTA.NCgl 0275.

Example 6: preparation of NCgl 0275-deleted Strain from Corynebacterium glutamicum KCCM11016P and evaluation of L-lysine productivity

Based on KCCM11016P strain, which is a representative Corynebacterium strain producing L-lysine, a deletion strain selected from the above-mentioned NCgl0275 was prepared and an attempt was made to evaluate its L-lysine productivity.

In detail, the recombinant plasmid pDZ- Δ NCgl0275 constructed in example 5 was transformed into L-lysine-producing Corynebacterium glutamicum KCCM11016P by homologous recombination on the chromosome (van der Rest et al, applied Microbiol Biotechnol 52:541-545, 1999).

Thereafter, secondary recombination was performed on solid medium plates containing 4% sucrose. Confirmation of the expression of SEQ ID NO: 2 is deleted in the chromosome. The recombinant strain was named Corynebacterium glutamicum KCCM11016P-NCgl 0275.

In order to analyze the L-lysine productivity of the prepared Corynebacterium glutamicum KCCM11016P-NCgl0275 strain, the parent strain (i.e., Corynebacterium glutamicum KCCM11016P strain) was also cultured by the following method.

Each of Corynebacterium glutamicum KCCM11016P as a parent strain and Corynebacterium glutamicum KCCM11016P-NCgl0275 prepared in example 6 was inoculated in a 250mL triangular shake flask containing less than 25mL of seed medium and cultured at 30 ℃ for 20 hours with shaking at 200 rpm. Then, 1mL of the seed culture was inoculated into a 250mL triangular shake flask containing 24mL of the production medium and cultured at 30 ℃ for 72 hours with shaking at 200 rpm. The compositions of the seed medium and the production medium are as follows, respectively.

< seed culture Medium (pH7.0) >

< production Medium (pH7.0) >

After completion of the culture, L-lysine production was measured using HPLC, and the L-lysine concentrations thus analyzed are shown in Table 3 below.

[ Table 3]

L-lysine productivity analysis of KCCM11016P and KCCM11016P-NCgl0275

As shown in the above results, when NCgl0275 was deleted in Corynebacterium glutamicum KCCM11016P which produces L-lysine, L-lysine productivity was increased by 17.2% on average as compared with the parent strain.

Thus, it was confirmed that by inactivating the amino acid sequence represented by SEQ ID NO: 1 to improve the productivity of L-lysine.

Further, the KCCM11016P-NCgl0275 strain was named CA01-7512 and was deposited under the Budapest treaty on 7/11 in 2017 in the Korean Collection of Microorganisms (KCCM) having a deposit number of KCCM12153P, in the International depository of Korea Microorganisms.

Example 7: NCgl 0275-deleted Strain prepared from Corynebacterium glutamicum KCCM11347P and evaluated for L-lysine productivity

In order to examine whether the above-mentioned effects were also exhibited in other L-lysine-producing Corynebacterium glutamicum strains, NCgl 0275-deleted strain was prepared from Corynebacterium glutamicum KCCM11347P (Korean patent No. 10-0073610; this microorganism is published as KFCC10750 and re-deposited in the International depositary organization under the Budapest treaty under accession No. KCCM 11347P) which produces L-lysine in the same manner as in example 6 and was named KCCM11347P-NCgl 0275.

Thereafter, the strain was cultured in the same manner as in example 6. After completion of the culture, L-lysine production was measured using HPLC, and the L-lysine concentrations thus analyzed are shown in Table 4 below.

[ Table 4]

L-lysine productivity analysis of KCCM11347P and KCCM11347P-NCgl0275

As shown by the above results, it was confirmed that L-lysine productivity was increased by 13.6% on average when NCgl0275 gene was deleted in Corynebacterium glutamicum KCCM11347P which produces L-lysine.

Thus, as in the results of example 6, it was confirmed that the expression of the polypeptide represented by SEQ ID NO: 1, the productivity of L-lysine is improved as compared with that of an unmodified microorganism.

Example 8: NCgl 0275-deleted Strain prepared from Corynebacterium glutamicum KCCM10770P and evaluated for L-lysine productivity

To examine whether the above effects were also shown in other L-lysine-producing Corynebacterium glutamicum strains, NCgl 0275-deleted strain was prepared from L-lysine-producing Corynebacterium glutamicum KCCM10770P (Korean patent No. 10-0924065) in the same manner as in example 6 and was named KCCM10770P-NCgl 0275.

Thereafter, the strain was cultured in the same manner as in example 6. After completion of the culture, L-lysine production was measured using HPLC, and the L-lysine concentrations thus analyzed are shown in Table 5 below.

[ Table 5]

L-lysine productivity analysis of KCCM10770P and KCCM10770P-NCgl0275

As shown by the above results, it was confirmed that the L-lysine productivity was increased by 14.6% on average when NCgl0275 gene was deleted in Corynebacterium glutamicum KCCM10770P which produces L-lysine.

Thus, as in the results of example 7, it was confirmed that the expression of the amino acid sequence represented by SEQ ID NO: 1, can improve the productivity of L-lysine as compared with the parent strain.

Example 9: NCgl 0275-deleted Strain prepared from Corynebacterium glutamicum CJ3P and evaluated for L-lysine productivity

To examine whether the above effect was also shown in other L-lysine-producing Corynebacterium glutamicum strains, NCgl 0275-deleted strain (Binder et al genome Biology 2012,13: R40) was prepared from L-lysine-producing Corynebacterium glutamicum CJ3P in the same manner as in example 6 and named CJ3P-NCgl 0275.

Thereafter, the strain was cultured in the same manner as in example 6. After completion of the culture, L-lysine production was measured using HPLC, and the L-lysine concentrations thus analyzed are shown in Table 6 below.

[ Table 6]

L-lysine Productivity analysis of CJ3P and CJ3P-Ncgl0275

As shown by the above results, it was confirmed that L-lysine productivity was increased by 15.8% on average when NCgl0275 gene was deleted in Corynebacterium glutamicum CJ3P which produces L-lysine.

Thus, as in the results of examples 6 to 8, it was confirmed that the expression of the amino acid sequence represented by SEQ ID NO: 1, can improve the productivity of L-lysine.

Example 10: NCgl 0275-deleted Strain prepared from Corynebacterium glutamicum KCCM11201P and evaluated for L-valine productivity

Whether valine productivity was also improved was examined by deleting NCgl0275 gene in Corynebacterium glutamicum having L-valine productivity in addition to L-lysine productivity.

The recombinant plasmid pDZ- Δ NCgl0275 constructed in example 5 was transformed into L-valine-producing Corynebacterium glutamicum KCCM11201P (Korean patent No. 10-1117022) by homologous recombination on the chromosome (van der Rest et al, Appl Microbiol Biotechnol 52:541-545, 1999). Thereafter, secondary recombination was performed on solid medium plates containing 4% sucrose. A strain in which NCgl0275 gene was deleted on the chromosome was prepared from a transformant of Corynebacterium glutamicum which had completed the secondary recombination by PCR using primer 3 and primer 6. The recombinant strain was named Corynebacterium glutamicum KCCM11201P-NCgl 0275.

In order to analyze the L-valine productivity of the prepared strain, the strain was cultured by the following method, and the composition of the medium was analyzed. The strain was inoculated into a 250mL triangular shake flask containing 25mL of the production medium and cultured at 30 ℃ for 72 hours with shaking at 200 rpm. Thereafter, the L-valine concentration was measured using HPLC, and the L-valine concentration thus analyzed is shown in Table 7 below.

< production Medium (pH7.0) >

100g glucose, 40g ammonium sulfate, 2.5g soy protein, 5g corn steep liquor solids, 3g urea, 1g dipotassium hydrogen phosphate, 0.5g magnesium sulfate heptahydrate, 100. mu.g biotin, 1mg thiamine hydrochloride, 2mg calcium pantothenate, 3mg nicotinamide, 30g calcium carbonate (based on 1 liter of distilled water)

[ Table 7]

L-valine Productivity of KCCM11201P and KCCM11201P-NCgl0275

As shown by the above results, it was confirmed when the L-valine productivity of KCCM11201P-NCgl0275 strain was increased by 25.0% compared to the control group. That is, it was confirmed that the L-valine productivity can be improved by deleting NCgl0275 gene in a microorganism of Corynebacterium genus.

It was also confirmed that by inactivating the peptide consisting of SEQ ID NO: 1, can improve the productivity of various L-amino acids.

Example 11: NCgl 0275-deleted Strain prepared from Corynebacterium glutamicum CJ7V and evaluated for L-valine Productivity

To examine whether the above effect was also shown in other L-valine-producing Corynebacterium glutamicum strains, a mutation [ ilvN (A42V); biotechnology and Bioprocess Engineering, June2014, Volume 19, Issue 3, pp 456-467] was introduced into wild type Corynebacterium glutamicum ATCC14067 to prepare a strain having an increased L-valine productivity.

In detail, genomic DNA of the wild-type Corynebacterium glutamicum ATCC14067 strain was extracted using a G-spin Total DNA Extraction mini kit (Intron, catalog No. 17045) according to the protocol provided in the kit. Genomic DNA was used as a template for PCR. To construct a vector for introducing the A42V mutation into the ilvN gene, a primer set of primer 7(SEQ ID NO: 9) and primer 8(SEQ ID NO: 10), and a primer set of primer 9(SEQ ID NO: 11) and primer 10(SEQ ID NO: 12) were used to obtain DNA fragments (A, B). The PCR conditions were as follows: denaturation at 94 ℃ for 5 min, 25 cycles, each consisting of: denaturation at 94 ℃ for 30 seconds; renaturation at 55 ℃ for 30 seconds; elongation was carried out at 72 ℃ for 60 seconds and then at 72 ℃ for 7 minutes.

As a result, A and B fragments each having 537bp polynucleotide were obtained. These two fragments were used as templates, and primer 7(SEQ ID NO: 9) and primer 10(SEQ ID NO: 12) were used to perform overlap PCR. A PCR product of 1044bp (hereinafter referred to as "mutation-introduced fragment") was obtained.

The obtained mutation-introduced fragment was treated with XbaI restriction enzyme (New England Biolabs, Beverly, Mass.), and then ligated to pDZ vector which had been treated with the same restriction enzyme using T4 ligase (New England Biolabs, Beverly, Mass.). The prepared gene was transformed into escherichia coli DH5 α, and then selection was performed on LB medium containing kanamycin. DNA was obtained using a DNA-spinning plasmid DNA purification kit (DNA-spin plasmid DNA purification kit) (iNtRON). The vector in which the A42V mutation was introduced into the ilvN gene was named pDZ-ilvN (A42V).

[ Table 8]

Primers 7 to 10 for preparing a fragment for introducing A42V mutation into ilvN gene

Thereafter, the prepared recombinant plasmid pDZ-ilvN (A42V) was transformed into the wild type Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome (van der Rest et al, applied Microbiol Biotechnol 52:541-545, 1999). Then, secondary recombination was performed on solid medium plates containing 4% sucrose. From the transformant of Corynebacterium glutamicum which had completed the secondary recombination, a gene fragment was amplified by PCR using primer 7 and primer 10. The strain into which the mutation was introduced was confirmed by sequencing analysis. The recombinant strain was named Corynebacterium glutamicum CJ 7V.

Finally, from Corynebacterium glutamicum CJ7V, which has L-valine productivity, a NCgl 0275-deleted strain was prepared in the same manner as in example 9 and named CJ7V-NCg 100275. In order to compare the L-valine productivity of the prepared strains, the strains were cultured in the same manner as in example 9 and then analyzed for L-valine concentration, and the L-valine concentrations thus analyzed are shown in Table 9 below.

[ Table 9]

L-valine Productivity of CJ7V and CJ7V-NCgl0275

As shown by the above results, it was confirmed when the L-valine productivity of CJ7V-NCgl0275 strain was increased by 17.6% compared with the control group. That is, it was confirmed that L-valine productivity can be improved by deleting NCgl0275 gene in various microorganisms of the genus Corynebacterium having L-valine productivity.

As in examples 6 to 10, it was confirmed that by inactivating the microorganism of corynebacterium genus, the expression of SEQ ID NO: 1, can improve the productivity of various L-amino acids.

Example 12: NCgl 0275-deleted Strain prepared from Corynebacterium glutamicum CJ8V and evaluated for L-valine Productivity

To examine whether the above-mentioned effect was also exhibited in other L-valine-producing Corynebacterium glutamicum strains, a mutation [ ilvN (A42V) ] was introduced into wild-type Corynebacterium glutamicum ATCC13869 in the same manner as in example 10 to prepare a mutant strain having improved L-valine productivity. This recombinant strain was named Corynebacterium glutamicum CJ 8V.

From Corynebacterium glutamicum CJ8V, which has L-valine productivity, a NCgl 0275-deleted strain was prepared in the same manner as in example 9 and named CJ8V-NCg 100275.

In order to compare the L-valine productivity of the prepared strains, the strains were cultured in the same manner as in example 9, and then the L-valine concentration was analyzed, and the L-valine concentrations thus analyzed are shown in Table 10 below.

[ Table 10]

L-valine Productivity of CJ8V and CJ8V-NCgl0275

As shown in the above results, it was confirmed when the L-valine productivity of CJ8V-NCgl0275 strain was increased by 25.9% compared with the control group. That is, as in examples 10 to 11, it was confirmed that L-valine productivity can be improved by deleting NCgl0275 gene in various microorganisms of the genus Corynebacterium having L-valine productivity.

Thus, as in examples 6 to 11, it was confirmed that the expression of the polypeptide represented by SEQ ID NO: 1, can improve the productivity of various L-amino acids.

Based on the above description, those skilled in the art will appreciate that the present disclosure may be implemented in various specific forms without changing the technical spirit or essential characteristics thereof. It should therefore be understood that the above-described embodiments are not limitative, but illustrative in all aspects. The scope of the disclosure is defined by the appended claims, rather than the description, and all changes and modifications that fall within the metes and bounds of the claims, or equivalence of such metes and bounds are therefore intended to be embraced by the claims.

[ deposit No. ]

The preservation organization: korea Centre for Culture of Microorganisms (KCCM) (International depositary organization)

The preservation number is as follows: KCCM12153P

The preservation date is as follows: 11/7/11/2017

<110> CJ first sugar manufacturing Co., Ltd

<120> L-amino acid-producing microorganism of Corynebacterium genus and method for producing L-amino acid using the same

<130> OPA18432

<150> KR 10-2018-0009633

<151> 2018-01-25

<160> 12

<170> KoPatentIn 3.0

<210> 1

<211> 116

<212> PRT

<213> Corynebacterium glutamicum

<400> 1

Met Thr Ser Val Ile Pro Glu Gln Arg Asn Asn Pro Phe Tyr Arg Asp

1 5 10 15

Ser Ala Thr Ile Ala Ser Ser Asp His Thr Glu Arg Gly Glu Trp Val

20 25 30

Thr Gln Ala Lys Cys Arg Asn Gly Asp Pro Asp Ala Leu Phe Val Arg

35 40 45

Gly Ala Ala Gln Arg Arg Ala Ala Ala Ile Cys Arg His Cys Pro Val

50 55 60

Ala Met Gln Cys Cys Ala Asp Ala Leu Asp Asn Lys Val Glu Phe Gly

65 70 75 80

Val Trp Gly Gly Leu Thr Glu Arg Gln Arg Arg Ala Leu Leu Arg Lys

85 90 95

Lys Pro His Ile Thr Asn Trp Ala Glu Tyr Leu Ala Gln Gly Gly Glu

100 105 110

Ile Ala Gly Val

115

<210> 2

<211> 351

<212> DNA

<213> Corynebacterium glutamicum

<400> 2

atgacgtctg tgattccaga gcagcgcaac aacccctttt atagggacag cgccacaatt 60

gcttcctcgg accacacaga gcgtggtgag tgggtcactc aggcaaagtg tcgaaatggc 120

gacccagatg cattgtttgt tcgtggtgca gcgcaacgcc gagcagcagc aatttgccgc 180

cactgccctg tagccatgca gtgctgcgcc gatgccttag ataacaaggt ggaattcgga 240

gtctggggag gcctgaccga gcgccagcgc cgtgcattgc ttcgaaagaa gccgcacatt 300

actaactggg ctgaatattt ggctcagggg ggcgagatcg ccggggttta a 351

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> primer 1

<400> 3

acctacaaca aagctctcat caacc 25

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer 2

<400> 4

ctaccctgtg gaacacctac atct 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer 3

<400> 5

gaattcgcgc cccactggcc cttc 24

<210> 6

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> primer 4

<400> 6

accccggcgg cgctgctctg gaatcac 27

<210> 7

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> primer 5

<400> 7

gagcagcgcc gccggggttt aattaat 27

<210> 8

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> primer 6

<400> 8

gcaggtcgac ctggttaccg gtctgaatc 29

<210> 9

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer 7

<400> 9

aatttctaga ggcagaccct attctatgaa gg 32

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> primer 8

<400> 10

agtgtttcgg tctttacaga cacgagggac 30

<210> 11

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> primer 9

<400> 11

gtccctcgtg tctgtaaaga ccgaaacact 30

<210> 12

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer 10

<400> 12

aatttctaga cgtgggagtg tcactcgctt gg 32

Claims

1. A method for producing an L-amino acid, comprising:

culturing in a medium an L-amino acid-producing microorganism of the genus Corynebacterium, wherein the amino acid sequence represented by SEQ ID NO: 1, wherein the L-amino acid productivity of the microorganism of the corynebacterium genus is increased or enhanced as compared with a corresponding wild-type microorganism of the corynebacterium genus, and wherein the microorganism of the corynebacterium genus is corynebacterium glutamicum; and

recovering the L-amino acid from the microorganism or the medium.

2. The method for producing an L-amino acid according to claim 1, wherein the L-amino acid is a basic amino acid, an aliphatic amino acid, or a branched-chain amino acid.

3. The process for producing an L-amino acid according to claim 1, wherein the L-amino acid is L-lysine or L-valine.