CN110305957B - Kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof - Google Patents
Kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof Download PDFInfo
- Publication number
- CN110305957B CN110305957B CN201910777599.2A CN201910777599A CN110305957B CN 110305957 B CN110305957 B CN 110305957B CN 201910777599 A CN201910777599 A CN 201910777599A CN 110305957 B CN110305957 B CN 110305957B
- Authority
- CN
- China
- Prior art keywords
- mir
- pelteobagrus fulvidraco
- fatty liver
- kit
- degree
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Epidemiology (AREA)
- Pathology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for identifying the fatty liver degree of pelteobagrus fulvidraco and an identification method thereof, relating to the technical field of aquatic organisms, wherein the kit for identifying the fatty liver degree of pelteobagrus fulvidraco comprises a miR-484 specific upstream primer and a general reverse primer; the nucleotide sequence of the miR-484 specific upstream primer is shown in SEQ ID NO. 1. The research of the invention shows that the expression level of miR-484 in the pelteobagrus fulvidraco body is in negative correlation with the occurrence degree of fatty liver, the miR-484 expression level of the pelteobagrus fulvidraco can be rapidly detected by the miR-484 specific upstream primer and the general downstream primer provided by the invention, and then the fatty liver degree of the pelteobagrus fulvidraco can be accurately judged, so that a foundation is provided for accurate administration.
Description
Technical Field
The invention relates to the technical field of aquatic organisms, in particular to a kit for identifying the fatty liver degree of pelteobagrus fulvidraco and an identification method thereof.
Background
The yellow catfish is one of the important aquaculture varieties in China. With the continuous popularization of new breeding technologies, breeding modes are diversified day by day, the yield of the Chinese pelteobagrus fulvidraco is remarkably improved, according to the statistical data of 'annual book of Chinese fishery', 48 ten thousand tons are achieved in 2017, and the yield is increased by about 20% in continuous years. Wherein the total yield of the yellow catfish culture in Jiangsu, Zhejiang, Hubei, Jiangxi and Guangdong provinces accounts for more than 70 percent of the total amount of the whole country. The main bred pelteobagrus fulvidraco species include pelteobagrus vachelli, pelteobagrus fulvidraco, all-male pelteobagrus fulvidraco, hybrid pelteobagrus fulvidraco and the like. While achieving the favorable results, people should consciously realize that the excessive deposition of body fat of the cultured pelteobagrus fulvidraco is more frequent due to the problems of overhigh culture density, increased feeding frequency, excessive addition of feed fat and the like. The disturbance of the liver fat metabolism not only causes feed waste and increases the metabolic burden of the pelteobagrus fulvidraco, but also can cause the immune function damage and generate various nutritional diseases, thereby increasing the sensitivity of germ infection and causing serious economic loss of the pelteobagrus fulvidraco breeding industry.
Therefore, how to promote the digestion and absorption of the liver of the pelteobagrus fulvidraco on fat and reduce fat deposition so as to achieve the aim of promoting the healthy breeding of the pelteobagrus fulvidraco becomes a problem which is urgently needed to be solved at present. The traditional Chinese herbal medicine or chemical synthetic medicine treatment method is difficult to realize accurate regulation and control of fat metabolism, and excessive or insufficient ingestion may cause great tissue damage to the fish body or cannot achieve the treatment effect. The method has the advantages that the accurate control of fat metabolism is realized by the directional intervention of the key regulatory genes in the fat deposition process of the pelteobagrus fulvidraco, and the research result has important biological significance for improving the stress protection and healthy culture of the liver of the pelteobagrus fulvidraco. The fat metabolism of the pelteobagrus fulvidraco is accurately controlled, and the degree of fatty liver of the pelteobagrus fulvidraco needs to be accurately determined at first.
Disclosure of Invention
The invention provides a kit for identifying the fatty liver degree of pelteobagrus fulvidraco and an identification method thereof, aiming at overcoming the defect that the fatty liver degree of the pelteobagrus fulvidraco liver is lack of accurate identification in the prior art.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a kit for identifying the fatty liver degree of pelteobagrus fulvidraco, which comprises a miR-484 specific upstream primer and a general reverse primer; the nucleotide sequence of the miR-484 specific upstream primer is shown in SEQ ID NO. 1.
Preferably, the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO. 2.
Preferably, the kit further comprises: qPCR reaction buffer and distilled water.
Preferably, the PCR reaction buffer is 2 XSSYBR Green Master Mix.
The invention also provides a non-diagnosis purpose pelteobagrus fulvidraco fatty liver degree identification method based on the kit in the technical scheme, which comprises the following steps:
(1) extracting RNA of a pelteobagrus fulvidraco sample to be detected, and carrying out reverse transcription to obtain cDNA;
(2) and (2) carrying out qPCR reaction by using the cDNA obtained in the step (1) as a template and using the kit of the technical scheme, and calculating to obtain miR-484 expression quantity, wherein the lower the miR-484 expression quantity is, the higher the fatty liver degree of the pelteobagrus fulvidraco sample to be detected is judged to be.
Preferably, the extraction method in step (1) comprises Trizol and chloroform co-extraction.
Preferably, the qPCR reaction system of step (2) comprises, per 20 μ L: cDNA template 1. mu. L, miR-484 specific forward primer 1. mu.L, universal reverse primer 1. mu. L, qPCR reaction buffer 10. mu.L and the balance distilled water.
Preferably, the reaction procedure of the qPCR reaction system in step (2) is: 95 ℃ for 5min, then 40 cycles (95 ℃ 30s, 57 ℃ 30s, 72 ℃ 30 s).
The invention also provides a preparation for reducing the degree of the fatty liver of fish, which comprises the miR-484 promoter with the nucleotide sequence shown in SEQ ID No. 3.
Preferably, the fish comprises pelteobagrus fulvidraco.
Compared with the prior art, the invention has the beneficial effects that:
1. the research of the invention shows that the expression level of miR-484 in the pelteobagrus fulvidraco body is in negative correlation with the occurrence degree of fatty liver, the miR-484 expression level of the pelteobagrus fulvidraco can be rapidly detected by the miR-484 specific upstream primer and the general downstream primer provided by the invention, and then the fatty liver degree of the pelteobagrus fulvidraco can be accurately judged, so that a foundation is provided for accurate administration.
2. The preparation containing the miR-484 promoter provided by the invention can effectively enhance the expression of miR-484 in fish bodies, regulates and controls fat metabolism by enhancing the activity of miR-484 in the fish bodies, accurately targets acyl-CoA thioesterase 11(ACOT11), accurately regulates and controls targeted molecular fragments in the fish bodies by the miR-484 promoter, realizes accurate treatment of fish fatty liver diseases, and has no influence on other growth and development or metabolic levels of fish and the like.
Drawings
FIG. 1-1 shows the effect of high fat feed intake on the expression level of miR-484 in Pelteobagrus fulvidraco;
fig. 1-2 are graphs showing the effect of high fat feed intake on the expression level of ACOT11 in pelteobagrus fulvidraco;
FIG. 2-1 is a graph of oil red O staining analysis of fat droplets in liver tissue of a high-fat group 60 days after ingestion of a high-fat diet;
FIG. 2-2 is a graph of oil red O staining analysis of fat droplets from liver tissue of a normal group 60 days after ingestion of a high fat diet;
FIG. 3-1 is an expression diagram of liver tissue miR-484 after tail vein injection of miRNA promoter analyzed by qRT-PCR;
FIG. 3-2 is a graph of liver tissue ACOT11 expression after qRT-PCR analysis of miRNA promoter injected into tail vein;
FIG. 4 shows the expression of liver tissue miR-484 and ACOT11 after Northern blot and Western blot analysis of miRNA promoter injection into tail vein;
FIG. 5-1 is a staining graph of fat deposition in liver tissue after tail vein injection of miRNA promoter by PBS group oil red O staining analysis;
FIG. 5-2 is a staining chart of fat deposition in liver tissue after negative control group oil red O staining analysis tail vein injection of miRNA accelerant;
FIG. 5-3 is a staining graph of liver tissue fat deposition after miR-484 group oil red O staining analysis tail vein injection of miRNA accelerant;
FIG. 6 is a screening scheme for miRNA (miR-484).
Detailed Description
The invention provides a kit for identifying the fatty liver degree of pelteobagrus fulvidraco, which comprises a miR-484 specific upstream primer and a general reverse primer; the nucleotide sequence of the miR-484 specific upstream primer is shown in SEQ ID NO. 1.
SEQ ID NO.1：CCGCAAGGACTGTCCAACC。
In the present invention, the nucleotide sequence of the universal reverse primer includes, but is not limited to, the sequence shown in SEQ ID NO. 2.
SEQ ID NO.2：CAGTGCAGGGTCCGAGGT。
In the present invention, the kit preferably further comprises: qPCR reaction buffer and distilled water; the PCR reaction buffer is more preferably 2 XSSYBR Green MasterMix.
The invention also provides a method for identifying the fatty liver degree of the pelteobagrus fulvidraco based on the kit in the technical scheme, which comprises the following steps:
(1) extracting RNA of a pelteobagrus fulvidraco sample to be detected, and carrying out reverse transcription to obtain cDNA;
(2) and (2) carrying out qPCR reaction by using the cDNA obtained in the step (1) as a template and using the kit of the technical scheme, and calculating to obtain miR-484 expression quantity, wherein the lower the miR-484 expression quantity is, the higher the fatty liver degree of the pelteobagrus fulvidraco sample to be detected is judged to be.
In the present invention, the extraction method in step (1) preferably comprises co-extraction of Trizol and chloroform. The present invention is not particularly limited as to how RNA extraction and reverse transcription are carried out, and methods known in the art can be used.
In the present invention, the qPCR reaction system in step (2) preferably comprises, per 20 μ L: cDNA template 1. mu. L, miR-484 specific forward primer 1. mu.L, universal reverse primer 1. mu. L, qPCR reaction buffer 10. mu.L and the balance distilled water. In the present invention, the reaction procedure of the qPCR reaction system in step (2) is preferably: 95 ℃ for 5min, then 40 cycles (95 ℃ 30s, 57 ℃ 30s, 72 ℃ 30 s). According to the method, the pelteobagrus fulvidraco fatty liver is identified according to the liver fat content, the healthy pelteobagrus fulvidraco liver fat content is 3-5%, and when the liver fat content is higher than 7%, the fish can be considered to have the fatty liver. Specifically, the expression level of miR-484 of healthy pelteobagrus fulvidraco is preferably used as a reference standard, and when the expression level of miR-484 of the pelteobagrus fulvidraco sample to be detected is lower than 0.8 times of the reference standard, the pelteobagrus fulvidraco is judged to have fatty liver.
The invention also provides a preparation for reducing the degree of the fatty liver of fish, which comprises the miR-484 promoter with the nucleotide sequence shown in SEQ ID No. 3. In the present invention, the fish includes, but is not limited to, pelteobagrus fulvidraco. The screening process of the miRNA (miR-484) is shown in figure 6, the fat metabolism related miRNA gene expression change is researched by using fish liver fat deposition, and then the differential expression miRNA is screened and miRNA intervention is carried out.
SEQ ID NO.3：UCAGGCUCAGUCCCCUCCCGAU。
The miR-484 promoter is designed according to the sequence of miR-484 mature body (5'-TCAGGCTCAGTCCCCTCCCGAT-3' (SEQ ID NO. 9)). The single-stranded small RNA (UCAGGCUCAGUCCCCUCCCGAU (SEQ ID NO.3)) prepared by a chemical synthesis method and subjected to special labeling and chemical modification can effectively enhance the expression of endogenous miR-484. The special mark and chemical modification of the invention are as follows: the accelerant is subjected to cholesterol modification at the 3 'end, four thio frameworks modification at the 3' end, two thio frameworks modification at the 5 'end and full-chain 2' methylation modification, so that the miR-484 accelerant can be effectively introduced into a body for specific combination, and the inhibition efficiency of a target gene is increased.
The preparation for reducing the fat degree of the fish is continuously injected by an electronic injector when in use. In the present invention, the injection amount of the preparation is determined according to the degree of fatty liver identified by the kit of the present invention.
In the present invention, the formulation is preferably dissolved in PBS buffer prior to injection.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Two groups of equal-nitrogen-equivalent diets with different fat levels were formulated, a normal group (38% feed protein level, 5% fat level) and a high-fat group (38% feed protein level, 17% fat) (table 1).
About 20g of pelteobagrus fulvidraco is selected to be fed with the two groups of experimental feeds respectively, 3 groups of feeds are arranged in parallel in each treatment, and the culture period is 60 days. Liver samples were taken on days 20, 40 and 60 of feed feeding, respectively. And randomly selecting 9 fishes for each treatment group, quickly obtaining liver tissue samples by an ice bath sampling method, and controlling the time for extracting each tissue sample within 30 s. And identifying the expression characteristics of miR-484 and its target gene in a normal group and a high fat stress group by using qRT-PCR, and analyzing the expression difference.
TABLE 1 feed Components and Nutrition levels
TABLE 2 miRNA and mRNA primer design
TABLE 3 influence of pelteobagrus fulvidraco on liver cholesterol (mmol/L) by feeding high-fat feed
| Normal group (mmol/L) | High fat group (mmol/L) | |
| 20 days | 2.14 | 3.11 |
| 40 days | 2.39 | 4.12 |
| 60 days | 2.87 | 4.83 |
TABLE 4 influence of pelteobagrus fulvidraco on liver triglycerides (mmol/L) by ingestion of high-fat feed
| Normal group (mmol/L) | High fat group (mmol/L) | |
| 20 days | 2.42 | 2.61 |
| 40 days | 2.89 | 3.52 |
| 60 days | 3.07 | 4.79 |
As can be seen from tables 3 and 4, as the yellow catfish ingests the high fat feed for a prolonged period of time, the contents of cholesterol and triglycerides in the liver gradually increase. At 40 and 60 days of ingestion, the high-fat group had significantly higher liver cholesterol and triglyceride levels than the normal group, indicating increased fat deposition.
As can be seen from fig. 1 and fig. 2, when the pelteobagrus fulvidraco eats the high-fat feed, the expression of miR-484 can be obviously reduced, the gene expression of the target gene ACOT11 is promoted, and the liver fat deposition is increased. The expression of miR-484 is in negative correlation with the fatty liver occurrence degree, and the expression quantity of miR-484 can be used for identifying the fatty liver occurrence degree.
Example 2
A kit for identifying the fatty liver degree of pelteobagrus fulvidraco comprises: miR-484 specific upstream primer with nucleotide sequence shown as SEQ ID NO.1, universal reverse primer shown as SEQ ID NO.2, 2 x SYBR Green Master Mix and distilled water.
Example 3
1. The miR-484 promoter is designed according to the sequence of miR-484 mature body (5'-TCAGGCTCAGTCCCCTCCCGAT-3' (SEQ ID NO. 9)). The single-stranded small RNA (UCAGGCUCAGUCCCUCCCCGAUU) which is prepared by a chemical synthesis method and is specially marked and chemically modified can effectively enhance the expression of endogenous miR-484. Meanwhile, the promoter is subjected to cholesterol modification at the 3 'end, four thio frameworks modification at the 3' end, two thio frameworks modification at the 5 'end and full-chain 2' methylation modification, so that the miR-484 promoter can be effectively introduced into a body for specific combination, and the inhibition efficiency of a target gene is increased.
2. Adding 25mg of dry powder reagent of miR-484 promoter or negative promoter (5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO.8)) into 1.875ml of PBS buffer solution for dilution, shaking up and down, mixing well, standing for 5min, centrifuging at 5000rpm for 15s, and preparing miR-484 promoter working solution for injection.
3. 180 pelteobagrus fulvidraco (each fish is about 8g) are randomly distributed into 9 plastic barrels of 450L (each barrel is 20 fish), and are temporarily cultured for 10 days. According to 50mg kg -1 The injection measurement of (1) is carried out by respectively injecting 30 mu L of miR-484 promoter, negative promoter or PBS solution with the same volume into the tail vein of each experimental fish by adopting a 0.25ml electronic needle tube. After the injection is finished, the needle tube is slowly drawn away from the fish body, and the injection position is lightly pressed for 30s to stop bleeding to the utmost extentCan prevent the injection liquid from flowing out of the body along with the blood.
4. 48h after injection, the experimental groups started feeding high fat diet (38% feed protein level, 17% fat) as shown in Table 5. miR-484 promoter, negative control or PBS was injected into tail vein every 15 days. Thereby ensuring that the miR-484 can better enhance the efficiency in the fish body tissue. And (3) analyzing the expression of miR-484 by adopting qRT-PCR and Northern blot, taking U6 as an internal reference gene, verifying the expression of the target gene ACOT11 by adopting qRT-PCR and Western blot, and taking 18s rRNA as the internal reference gene. Specific primer designs are shown in table 2.
TABLE 5 feed composition and Nutrition levels
The feeding time is as follows: feeding twice a day, which is 6:30 and 17:00 respectively, wherein the feeding amount is 2-4% of the weight of the fish, changing water 1/3 every 10 days, and keeping sufficient dissolved oxygen and good water quality of the culture system.
As can be seen from fig. 3 and fig. 4, after the miRNA promoter is injected into the tail vein of the pelteobagrus fulvidraco, the expression and protein level of miR-484 can be significantly promoted, and the gene expression and protein level of the target gene ACOT11 can be inhibited.
The tail vein injection PBS group was set as a control group, and the specific results of the pelteobagrus fulvidraco fat cure are shown in tables 6 to 7:
table 6 influence of miR-484 promoter injected into tail vein on growth performance and blood index of pelteobagrus fulvidraco
| PBS | Negative control | miR-484 promoter | |
| Initial body weight (g) | 8.12 | 8.23 | 8.07 |
| Terminal body weight (g) | 37.54 | 38.03 | 42.14 |
| Triglyceride (mmol/L) | 4.62 | 4.37 | 3.38 |
| Cholesterol (mmol/L) | 3.87 | 3.92 | 2.55 |
Table 7 influence of tail vein injection of miR-484 promoter on liver biochemical indicators of pelteobagrus fulvidraco
| PBS | Negative control | miR-484 promoter | |
| Liver weight (g) | 4.15 | 4.43 | 4.04 |
| Triglyceride (mmol/L) | 5.64 | 5.36 | 4.12 |
| Cholesterol (mmol/L) | 4.77 | 4.98 | 3.21 |
As can be seen from FIG. 5, after the miR-484 promoter is injected into the tail vein, the fat drop deposition of the liver tissue of the pelteobagrus fulvidraco is obviously reduced (40 x).
According to tables 6-7 and fig. 3-5, it can be seen that the tail vein injection of the miR-484 promoter can obviously enhance the expression of the liver miR-484 of the pelteobagrus fulvidraco, regulate the expression of the key gene ACOT11 of fat deposition, reduce the fat deposition of the liver and serum of the pelteobagrus fulvidraco after the feeding of high-fat feed, and protect the liver health.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> research center of freshwater fishery of Chinese aquatic science research institute
<120> kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccgcaaggac tgtccaacc 19
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cagtgcaggg tccgaggt 18
<210> 3
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ucaggcucag uccccucccg au 22
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gcagtaagtc tatcgggcct 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttgctcaatc tcgtgtggct 20
<210> 8
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
uuuguacuac acaaaaguac ug 22
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tcaggctcag tcccctcccg at 22
Claims (7)
1. The application of the reagent for detecting miR-484 in the preparation of the kit for identifying the fatty liver degree of pelteobagrus fulvidraco comprises the following steps:
(1) extracting RNA of a pelteobagrus fulvidraco sample to be detected, and carrying out reverse transcription to obtain cDNA;
(2) carrying out qPCR reaction by using the cDNA obtained in the step (1) as a template and using a kit for identifying the fatty liver degree of the pelteobagrus fulvidraco, calculating to obtain miR-484 expression quantity, and judging that the fatty liver degree of the pelteobagrus fulvidraco sample to be detected is higher if the miR-484 expression quantity is lower;
The kit comprises a miR-484 specific upstream primer and a universal reverse primer;
the nucleotide sequence of the miR-484 specific upstream primer is shown in SEQ ID NO. 1; the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO. 2.
2. The use according to claim 1, wherein the kit further comprises: qPCR reaction buffer and distilled water.
3. Use according to claim 2, wherein the PCR reaction buffer is 2 XSSYBR Green Master Mix.
4. The use according to claim 1, wherein the extraction method of step (1) comprises co-extraction of Trizol and chloroform.
5. The use according to claim 1, wherein the qPCR reaction system of step (2) comprises per 20 μ L: cDNA template 1. mu. L, miR-484 specific forward primer 1. mu.L, universal reverse primer 1. mu. L, qPCR reaction buffer 10. mu.L and the balance distilled water.
6. The use according to claim 1 or 5, wherein the reaction program of the qPCR reaction system of step (2) is: 95 ℃ for 5 min, then 40 cycles: 95 ℃ for 30 s, 57 ℃ for 30 s and 72 ℃ for 30 s.
7. Application of miR-484 promoter with nucleotide sequence shown in SEQ ID No.3 in preparation of preparation for reducing fatty liver degree of pelteobagrus fulvidraco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910777599.2A CN110305957B (en) | 2019-08-22 | 2019-08-22 | Kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910777599.2A CN110305957B (en) | 2019-08-22 | 2019-08-22 | Kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110305957A CN110305957A (en) | 2019-10-08 |
| CN110305957B true CN110305957B (en) | 2022-07-29 |
Family
ID=68083712
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910777599.2A Active CN110305957B (en) | 2019-08-22 | 2019-08-22 | Kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110305957B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102266570A (en) * | 2011-07-08 | 2011-12-07 | 中国科学院动物研究所 | New application of miRNA-484, pharmaceutical composition containing miRNA-484 and use thereof |
| CN102643807A (en) * | 2011-02-18 | 2012-08-22 | 中国科学院上海药物研究所 | Antisense oligodeoxyncleotide of human miR-484 and application thereof |
| CN103889461A (en) * | 2011-07-18 | 2014-06-25 | 肯塔基大学研究基金会 | Protection of cells from alu-rna-induced degenereation and inhibitors for protecting cells |
-
2019
- 2019-08-22 CN CN201910777599.2A patent/CN110305957B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643807A (en) * | 2011-02-18 | 2012-08-22 | 中国科学院上海药物研究所 | Antisense oligodeoxyncleotide of human miR-484 and application thereof |
| CN102266570A (en) * | 2011-07-08 | 2011-12-07 | 中国科学院动物研究所 | New application of miRNA-484, pharmaceutical composition containing miRNA-484 and use thereof |
| CN103889461A (en) * | 2011-07-18 | 2014-06-25 | 肯塔基大学研究基金会 | Protection of cells from alu-rna-induced degenereation and inhibitors for protecting cells |
Non-Patent Citations (3)
| Title |
|---|
| 2018年省基础研究计划（自然科学基金）拟立项项目公示;江苏省科技厅;《http://www.xm-chuang.com/h-nd-441.html》;20180530;附件2 2018年省自然科学基金面上项目公示清单 * |
| MicroRNA expression analysis in high fat diet-induced NAFLD-NASH-HCC progression: study on C57BL/6J mice;Alessandra Tessitore等;《BMC Cancer》;20160105;第16卷;1-14页 * |
| Responses of functional miRNA-mRNA regulatory modules to a high-fat diet in the liver of hybrid yellow catfish (Pelteobagrus fulvidraco×P. vachelli);Jun Qiang等;《Genomics》;20201209;第113卷;1207-1220页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110305957A (en) | 2019-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104250646B (en) | A kind of molecular labeling relevant to pig feed transformation efficiency proterties and detection method and application | |
| He et al. | Identification and characterization of microRNAs in the gonad of Trachinotus ovatus using Solexa sequencing | |
| CN111387105A (en) | Method for producing seeds of all-male macrobrachium rosenbergii | |
| CN102653757B (en) | SNP molecular marker easy to domesticate artificial feed mandarin fish related gene | |
| CN110305957B (en) | Kit for identifying fatty liver degree of pelteobagrus fulvidraco and identification method thereof | |
| CN103255203B (en) | Application of molecular marker in pig birth weight trait correlation analysis | |
| CN110506676B (en) | ELOVL1 gene and application thereof | |
| Lu et al. | The function of miR-122 in the lipid metabolism and immunity of grass carp (Ctenopharyngodon idellus) | |
| CN103305506B (en) | SNP (single nucleotide polymorphism) molecular mark related to domesticating property of mandarin fish | |
| CN101603086B (en) | Molecular marking method for indicating and identifying chicken abdominal fat weight by using ACC alpha gene | |
| CN104232643A (en) | RNAi (ribonucleic acid interference) interference segment, interference vector, and preparation method and application thereof | |
| CN113209126A (en) | Prawn immunopotentiator based on RNA interference technology and preparation method and application thereof | |
| CN104031914A (en) | Internal reference genes with quantitative fluorescence in Crassostrea gigas Vibrio alginolyticus stress experiment, and primers and application thereof | |
| CN112342212B (en) | AMO-miRNA for resisting WSSV infection of penaeus japonicus | |
| CN112574996B (en) | Long-chain non-coding RNA AAGNCR and application thereof | |
| CN116762898B (en) | Prawn immunopotentiator based on CpG oligonucleotide tandem molecules and application thereof | |
| CN103305505B (en) | Molecular marker for screening easily domesticated mandarin fish | |
| CN102758022A (en) | Internal transcribed spacer (ITS2) molecular marker identifying method for aquaculture of catfish hybrids | |
| CN109852616B (en) | Application of wsv049 siRNA in preparation of white spot syndrome virus preparation | |
| CN116218842B (en) | siRNA and kit for specifically knocking down chicken TPM1 gene expression and application thereof | |
| CN110476843B (en) | ELOVL6 gene and application thereof | |
| CN110800886B (en) | Application of TWS119 in promoting growth of prawn and improving nonspecific immunity and disease resistance | |
| Solís et al. | Noncoding RNAs in fish physiology and development: miRNAs as a cornerstone in gene networks | |
| CN106498073A (en) | A kind of SNP marker related to Xinjiang Donkey milk production trait and its application | |
| CN105861730B (en) | A kind of megalobrama amblycephala diet carbohydrate utilizes and metabolic regulation molecular labeling miRNA and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |