CN110305953B - Application of system for detecting miRNA expression quantity in preparation of products for distinguishing tubercular meningitis and viral meningitis - Google Patents
Application of system for detecting miRNA expression quantity in preparation of products for distinguishing tubercular meningitis and viral meningitis Download PDFInfo
- Publication number
- CN110305953B CN110305953B CN201910608612.1A CN201910608612A CN110305953B CN 110305953 B CN110305953 B CN 110305953B CN 201910608612 A CN201910608612 A CN 201910608612A CN 110305953 B CN110305953 B CN 110305953B
- Authority
- CN
- China
- Prior art keywords
- mir
- hsa
- meningitis
- distinguishing
- patients
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an application of a system for detecting miRNA expression quantity in preparing products for distinguishing tuberculous meningitis and viral meningitis; the miRNA is four, three, two or one of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p and hsa-miR-199a-5 p. The invention discloses miRNA spectra in peripheral blood mononuclear cells of patients with tubercular meningitis and viral meningitis, is beneficial to better understanding pathogenesis of the two diseases, more importantly identifies and obtains 4 miRNAs which can be used for distinguishing or assisting in distinguishing tubercular meningitis and viral meningitis, and has very important significance for improving diagnosis of tubercular meningitis.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to application of a system for detecting miRNA expression quantity in preparation of products for distinguishing tuberculous meningitis and viral meningitis.
Background
Tuberculous meningitis (TBM) is a very serious chronic infectious disease of the Central Nervous System (CNS) caused by infection with Mycobacterium tuberculosis (m.tb), accounting for approximately 1% -2% of all active tuberculosis, and approximately 8% of extrapulmonary tuberculosis. Although China does not have exact epidemiological data on the onset of tuberculous meningitis at present, according to national epidemiological survey data on tuberculosis, the prevalence rate of tuberculous meningitis is estimated to be about 5/10 ten thousand. Although the incidence of tubercular meningitis is relatively low, mortality and disability rates may reach 44% -69% in tuberculosis-burdened countries. Delays in diagnosis and treatment are considered to be a major factor in the high mortality rate of patients with tubercular meningitis. The existing diagnosis method of the tubercular meningitis mainly depends on the culture of the tubercular cerebrospinal fluid, the acid-fast cerebrospinal fluid bacillus smear and the detection of the XpertMTB/RIF, but the sensitivity is low, the clinical diagnosis basis is difficult to obtain, the treatment is delayed, and the delayed treatment causes the aggravation of the tubercular meningitis and the poor prognosis. Tubercular meningitis is similar to other viral meningitis, bacterial meningitis and fungal meningitis (mainly cryptococcal meningitis) in clinical symptoms, signs, conventional biochemistry of cerebrospinal fluid and the like, so that clinically, the diagnostic method for tubercular meningitis and other chronic infectious meningitis is very important. Fortunately, with the use of antibiotics, the incidence of bacterial meningitis is reduced year by year and easy to diagnose, and the detection of cryptococcal meningitis can be rapidly realized by ink staining, so that the identification and diagnosis of tuberculous meningitis and viral meningitis become the biggest difficult problems clinically in recent years. In order to realize the differential diagnosis of the two diseases, research and development on the identification and verification of novel biomarkers are continuously carried out to improve the diagnostic sensitivity and specificity of tuberculous meningitis.
microRNA (miRNA) is a conserved non-coding small RNA with the length of 18-25 nucleotides, and participates in gene expression and regulation of various biological signal transduction pathways, including cell proliferation, differentiation, apoptosis, immune response, angiogenesis and the like. The previous research finds that the abnormal expression of miRNA in the tissues or blood of the active tuberculosis patients is closely related to the occurrence and development of diseases. However, to date, only one study used microarrays to identify differential miRNA profiles between tubercular meningitis and healthy people, and another only validated the association of miR-29 with childhood tubercular meningitis. No research is carried out on screening and verifying differential miRNA spectra of tuberculous meningitis and viral meningitis.
Therefore, screening of differential miRNA profiles of tuberculous meningitis and viral meningitis has important significance for clinical differential diagnosis.
Disclosure of Invention
The technical problem to be solved by the invention is how to distinguish tubercular meningitis patients from viral meningitis patients.
In order to solve the technical problem, the invention provides the application of the system for detecting the miRNA expression quantity in preparing products for distinguishing tubercular meningitis patients and viral meningitis patients or assisting in distinguishing tubercular meningitis patients and viral meningitis patients;
the miRNA is four, three, two or one of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p and hsa-miR-199a-5 p.
In the application, the hsa-miR-126-3p is RNA shown in a sequence 1, the hsa-miR-130a-3p is RNA shown in a sequence 2, the hsa-miR-151a-3p is RNA shown in a sequence 3, and the hsa-miR-199a-5p is RNA shown in a sequence 4.
In the application, the system for detecting the miRNA expression level comprises one, two, three or four of a system for detecting the hsa-miR-126-3p expression level, a system for detecting the hsa-miR-130a-3p expression level, a system for detecting the hsa-miR-151a-3p expression level and a system for detecting the hsa-miR-199a-5p expression level, wherein the system for detecting the miRNA expression level comprises one, two, three or four of the systems which are independent or combined together.
In the above application, the system for detecting the expression level of miRNA is M1) or M2):
m1) a system for detecting the miRNA expression level by quantitative PCR;
m2) a system for detecting the miRNA expression by using a high-throughput microarray chip.
The system may comprise reagents and/or kits and/or instruments, in particular:
the system for detecting the expression quantity of the hsa-miR-126-3p can comprise a reagent and/or a kit and/or an instrument for detecting the expression quantity of the hsa-miR-126-3p, such as a reagent, a kit and an instrument required for detecting the expression quantity of the hsa-miR-126-3p by a high-throughput microarray chip or a reagent, a kit and an instrument required for detecting the expression quantity of the hsa-miR-126-3p by quantitative PCR. More specifically, the system for detecting the expression level of the hsa-miR-126-3p by quantitative PCR can comprise a set of primers, a set of probes, a kit and/or other reagents and/or instruments required for amplifying the full length or the fragment of the hsa-miR-126-3 p. Of course, the system for detecting the expression level of the hsa-miR-126-3p can only consist of a PCR primer pair for amplifying the full length or the segment of the hsa-miR-126-3p, and also can only consist of a kit for detecting the expression level of the hsa-miR-126-3 p. The PCR primer pair for amplifying the full length or the segment of the hsa-miR-126-3p and other reagents required for carrying out quantitative PCR reaction can be independently packaged.
The system for detecting the expression quantity of the hsa-miR-130a-3p can comprise a reagent and/or a kit and/or an instrument for detecting the expression quantity of the hsa-miR-130a-3p, such as a reagent, a kit and an instrument for detecting the expression quantity of the hsa-miR-130a-3p by a high-throughput microarray chip or a reagent, a kit and an instrument for detecting the expression quantity of the hsa-miR-130a-3p by quantitative PCR. More specifically, the system for detecting the expression of hsa-miR-130a-3p by quantitative PCR can comprise a set of primers, a set of probes and a kit for amplifying full length or fragments of hsa-miR-130a-3p and/or other reagents and/or instruments required for performing quantitative PCR. Of course, the system for detecting the expression quantity of hsa-miR-130a-3p can only consist of a PCR primer pair for amplifying the full length or the fragment of hsa-miR-130a-3p, and also can only consist of a kit for detecting the expression quantity of hsa-miR-130a-3 p. The PCR primer pair for amplifying the full length or the fragment of the hsa-miR-130a-3p and other reagents required for carrying out quantitative PCR reaction can be independently packaged.
The system for detecting the expression quantity of the hsa-miR-151a-3p can comprise a reagent and/or a kit and/or an instrument for detecting the expression quantity of the hsa-miR-151a-3p, such as a reagent, a kit and an instrument for detecting the expression quantity of the hsa-miR-151a-3p by a high-throughput microarray chip or a reagent, a kit and an instrument for detecting the expression quantity of the hsa-miR-151a-3p by quantitative PCR. More specifically, the system for detecting the expression level of hsa-miR-151a-3p by quantitative PCR can comprise a set of primers, a set of probes, a kit and/or other reagents and/or instruments required for performing quantitative PCR for amplifying the full length or the fragment of hsa-miR-151a-3 p. Of course, the system for detecting the expression quantity of the hsa-miR-151a-3p can only consist of a PCR primer pair for amplifying the full length or the fragment of the hsa-miR-151a-3p, and also can only consist of a kit for detecting the expression quantity of the hsa-miR-151a-3 p. The PCR primer pair for amplifying the full length or the fragment of the hsa-miR-151a-3p and other reagents required for carrying out quantitative PCR reaction can be independently packaged.
The system for detecting the expression quantity of the hsa-miR-199a-5p can comprise a reagent and/or a kit and/or an instrument for detecting the expression quantity of the hsa-miR-199a-5p, such as a reagent, a kit and an instrument required for detecting the expression quantity of the hsa-miR-130a-3p by a high-throughput microarray chip or a reagent, a kit and an instrument required for detecting the expression quantity of the hsa-miR-199a-5p by quantitative PCR. More specifically, the system for detecting the expression of hsa-miR-199a-5p by quantitative PCR can comprise a set of primers, a set of probes and a kit for amplifying the full length or the fragment of hsa-miR-199a-5p, and/or other reagents and/or instruments required for carrying out quantitative PCR. Of course, the system for detecting the expression quantity of the hsa-miR-199a-5p can only consist of a PCR primer pair for amplifying the full length or the fragment of the hsa-miR-199a-5p, and also can only consist of a kit for detecting the expression quantity of the hsa-miR-199a-5 p. The PCR primer pair for amplifying the full length or the fragment of the hsa-miR-199a-5p and other reagents required for carrying out quantitative PCR reaction can be independently packaged.
In the application, the probe used for detecting hsa-miR-126-3p is Assay ID * 002228 the probe used for detecting hsa-miR-130a-3p is Assay ID * 000454, the probe used for detecting hsa-miR-151a-3p is Assay ID * 002254, the probe used for detecting hsa-miR-199a-5p is Assay ID * 000498, all of which are available from ABI, USA.
In the above application, the system for detecting miRNA expression level further includes a data processing device, and the data processing device is configured to convert the miRNA expression level from the object to be detected into a discrimination result of the object to be detected.
Specifically, the data processing device comprises a data input module, a data comparison module and a conclusion output module; the data input module is used for inputting the miRNA expression quantity of the object to be detected, the data comparison module is used for comparing the miRNA expression quantity of the object to be detected, and the conclusion output module is used for outputting the distinguishing result of the object to be detected: if the expression quantity of the hsa-miR-126-3p is less than or equal to 1.49, the object to be detected is a tubercular meningitis patient or is a candidate for the tubercular meningitis patient; when the expression quantity of the hsa-miR-126-3p is more than 1.49, the object to be detected is or is selected as a candidate for a viral meningitis patient; if the expression quantity of hsa-miR-130a-3p is less than or equal to 18.19, the object to be detected is or is selected as a tubercular meningitis patient; when the expression quantity of hsa-miR-130a-3p is more than 18.19, the object to be detected is or is selected as a candidate for a viral meningitis patient; if the expression quantity of hsa-miR-151a-3p is less than or equal to 120.1, the object to be detected is or is selected as a tuberculous meningitis patient; when the expression quantity of hsa-miR-151a-3p is more than 120.1, the object to be detected is or is selected as a candidate for a viral meningitis patient; if the expression quantity of hsa-miR-199a-5p is less than or equal to 0.0006, the object to be detected is or is selected as a tuberculous meningitis patient; when the expression quantity of hsa-miR-199a-5p is more than 0.0006, the object to be detected is or is selected as a viral meningitis patient; if the probability value of the 4 miRNA combinations is greater than 0.61, the object to be detected is or is selected as a tuberculous meningitis patient; and if the probability value is less than or equal to 0.61, the object to be detected is or is selected as a viral meningitis patient.
The probability value is obtained by combining 4 mirnas by a Logistic regression method.
The invention also provides application of the system for distinguishing or assisting in distinguishing patients with tuberculous meningitis from patients with viral meningitis by taking the miRNA as the marker in preparing products for distinguishing or assisting in distinguishing patients with tuberculous meningitis from patients with viral meningitis.
The system for distinguishing or assisting in distinguishing patients with tubercular meningitis from patients with viral meningitis is the system for detecting the expression level of miRNA.
The invention further provides a product for distinguishing or assisting to distinguish patients with tuberculous meningitis from patients with viral meningitis, wherein the product is the system for detecting the expression quantity of miRNA.
In the present invention, the expression level of miRNA may be the expression level of miRNA in blood; specifically, the expression level of miRNA in peripheral blood mononuclear cells may be used.
The invention further provides a method for distinguishing or assisting in distinguishing patients with tuberculous meningitis from patients with viral meningitis, which comprises the steps of detecting the expression quantity of four, three, two or one of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p and hsa-miR-199a-5p of a to-be-detected object, and determining whether the to-be-detected object is a tuberculous meningitis patient or a viral meningitis patient according to the expression quantity of four, three, two or one of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p and hsa-miR-199a-5 p.
In the invention, when a tubercular meningitis patient and a viral meningitis patient are distinguished by detecting the expression quantity of hsa-miR-126-3p, when the expression quantity of hsa-miR-126-3p is less than or equal to 1.49, the object to be detected is or is selected as a tubercular meningitis patient; and when the expression quantity of the hsa-miR-126-3p is more than 1.49, the object to be detected is or is selected as a viral meningitis patient. When distinguishing patients with tuberculous meningitis from patients with viral meningitis by detecting the expression level of hsa-miR-130a-3p, when the expression level of hsa-miR-130a-3p is less than or equal to 18.19, the object to be detected is or is selected as a tuberculous meningitis patient; and when the expression level of the hsa-miR-130a-3p is more than 18.19, the object to be detected is or is selected as a viral meningitis patient. When distinguishing patients with tuberculous meningitis from patients with viral meningitis by detecting the expression level of hsa-miR-151a-3p, when the expression level of hsa-miR-151a-3p is less than or equal to 120.1, the object to be detected is or is selected as a tuberculous meningitis patient; and when the expression level of the hsa-miR-151a-3p is more than 120.1, the object to be detected is or is selected as a viral meningitis patient. When the patients with tuberculous meningitis and the patients with viral meningitis are distinguished by detecting the expression level of hsa-miR-199a-5p, when the expression level of hsa-miR-199a-5p is less than or equal to 0.0006, the object to be detected is or is selected as the tuberculous meningitis patient; when the expression level of the hsa-miR-199a-5p is more than 0.0006, the object to be tested is or is selected as a viral meningitis patient. When the tuberculous meningitis patients and the viral meningitis patients are distinguished by the combined expression quantity of the 4 miRNA combinations, obtaining a probability value by using a Logistic regression method, wherein if the probability value is more than 0.61, the object to be detected is or is selected as the tuberculous meningitis patient; and if the probability value is less than or equal to 0.61, the object to be detected is or is selected as a viral meningitis patient. When the 4 miRNAs are used for distinguishing tuberculous meningitis and viral meningitis, the area under the ROC curve (AUC) is larger than 0.70, the sensitivity is larger than 78%, the specificity is larger than 56%, and the 4 miRNAs can be used for distinguishing tuberculous meningitis patients from viral meningitis patients. The area under the combined ROC curve of 4 miRNAs [ AUC is 0.893(0.788-0.957) ], the sensitivity is 90.6% (75.0% -98.0%) and the specificity is 86.7% (69.3% -96.2%), and the method has better capability of distinguishing patients with tuberculous meningitis from patients with viral meningitis.
In the present invention, the miRNA expression level is a relative expression level of miRNA with respect to U6 SnRNA.
In the invention, the object to be detected is a meningitis patient to be detected.
The invention discloses miRNA spectra in peripheral blood mononuclear cells of patients with tubercular meningitis and viral meningitis, is beneficial to better understanding pathogenesis of the two diseases, more importantly identifies and obtains 4 miRNAs which can be used for distinguishing or assisting in distinguishing tubercular meningitis and viral meningitis, and has very important significance for improving diagnosis of tubercular meningitis.
Drawings
Fig. 1 is a differential analysis of the expression of 6 differential mirnas in expanded samples (TBM 32, VM 30, HCs 34); wherein, A-F are expression difference analysis of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p, hsa-miR-199a-5p, hsa-miR-642a-3p and hsa-miR-4299 respectively.
FIG. 2 is a graph showing the performance evaluation of 4 differential miRNAs and combinations thereof in the differential diagnosis of tubercular meningitis, viral meningitis, and normal population; wherein A is an ROC curve for differential diagnosis by taking a viral meningitis patient control group and a tuberculous meningitis patient as a disease group; and B is an ROC curve for differential diagnosis by taking a normal human control group and a tubercular meningitis patient as a disease group.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the following examples patients with tubercular meningitis (TBM), Viral Meningitis (VM) had the following symptoms:
tubercular meningitis: the patient has clinical manifestations of fever, headache, jet vomiting, meningeal irritation and increased intracranial pressure, accompanied by either: (1) positive culture of Mycobacterium tuberculosis of cerebrospinal fluid, positive PCR or positive meningeal pathology; (2) the clinical diagnosis of meningitis (negative examination of cerebrospinal fluid bacteria and fungi) with negative indexes is combined with the following 3 expressions that intracranial MRI has intracranial nodules, hydrocephalus, encephaledema, basal cisterna and other areas exudation increase and the like; and combining tuberculosis at other parts: chest CT lung is frequently sent with millet granular nodules, or lung plaque cavitary lesion with sputum-collecting bacteria or positive culture; the kidney and bone joint CT shows that the typical tuberculosis is accompanied by the M.TB culture or pathological positive of urine, lymph node and joint effusion; ③ the antituberculosis treatment effect is good.
Viral meningitis: acute or subacute onset, with/without a history of viral infection 1-3 weeks before onset. The patient has symptoms of impaired brain parenchyma such as fever, headache, seizures, mental changes, disturbance of consciousness, and/or signs of nervous system positioning. Electroencephalograms and cranial MRIs have abnormal lesions. Specific viral antibodies are detected in blood or cerebrospinal fluid, or viral DNA is detected by PCR. The cerebrospinal fluid pressure is normal or increased, the leucocyte is slightly increased, and the antiviral and symptomatic treatment effects are good. There was no evidence of bacterial, tubercular and fungal infections.
The sequences of the 4 mirnas in the following examples are as follows: the nucleotide sequence of hsa-miR-126-3p is 5'-CAGUGCAAUGUUAAAAGGGCAU-3' (SEQ ID NO: 1), the nucleotide sequence of hsa-miR-130a-3p is 5'-UCGUACCGUGAGUAAUAAUGCG-3' (SEQ ID NO: 2), the nucleotide sequence of hsa-miR-151a-3p is 5'-CUAGACUGAAGCUCCUUGAGG-3' (SEQ ID NO: 3) and the nucleotide sequence of hsa-miR-199a-5p is 5'-CCCAGUGUUCAGACUACCUGUUC-3' (SEQ ID NO: 4).
Example 1, screening and validation of differential miRNA expression profiles:
firstly, identifying and obtaining 6 differential miRNAs by a high-throughput microarray chip
High-throughput microarray chip identification and comparative analysis of differential miRNA expression profiles in 4 cases of peripheral blood mononuclear cells of patients with tuberculous meningitis (TBM), patients with Viral Meningitis (VM) and healthy people (HCs) are carried out, and the results are shown in Table 1, 28 differential miRNAs (P is less than 0.05) are obtained by screening between tuberculous meningitis and viral meningitis, and 11 differential miRNAs (P is less than 0.05) are obtained between tuberculous meningitis and healthy people; wherein 6 miRNAs (hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p, hsa-miR-199a-5p, hsa-miR-642a-3p and hsa-miR-4299) are tuberculous meningitis specific miRNAs, and are statistically different from viral meningitis and healthy people.
TABLE 1 analysis results of differential miRNAs
Two, qPCR verification of differential expression of 6 differential miRNAs among groups
qPCR verification is carried out on 6 tubercular meningitis specific expression miRNAs (namely hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p, hsa-miR-199a-5p, hsa-miR-642a-3p and hsa-miR-4299), and the specific test steps are as follows:
first), Peripheral Blood Mononuclear Cells (PBMCs) isolation:
1) the EDTA anticoagulation blood collection tube collects 4ml of peripheral blood.
2) Within 2h after blood collection, the whole blood sample is mixed uniformly with RPMI1640 culture solution or normal saline with equal volume, carefully added on the upper layer of the Ficoll lymphocyte separation solution according to the volume ratio of 2-3: 1, and centrifuged for 22 minutes at 1000g at 18 ℃.
3) The white, cloudy PBMCs layer was pipetted and transferred to a 15ml conical centrifuge tube and 10ml AIM-V or RPMI1640 medium was added and centrifuged at 600g at 18 ℃ for 7 min.
4) After centrifugation, the supernatant was carefully removed, 1ml of 1xPBS was added, the cell pellet was gently resuspended, 1XPBS was added to 10ml, and centrifugation was carried out at 18 ℃ and 350g for 7 minutes.
5) After centrifugation, the supernatant was carefully discarded, and 700ul of QIAZOL (QIAGEN #79306) was used to sufficiently lyse the cells and extract RNA.
Two), RNA extraction (QIAGEN #217004 kit):
1) after cell lysis by QIAZOL, vortex well, add 140ul chloroform, vortex, shake well for 15s, and stand at room temperature for 2 min.
2)12000g, 4 degrees centrifugal 20 min.
3) Carefully sucking the supernatant to about 300ul, adding 1.5 times of anhydrous ethanol, mixing uniformly, adding onto a centrifugal column, and centrifuging at 10000g at room temperature for 15 s.
4) 700ul of RWT buffer was added to the spin column and 10000g were centrifuged at room temperature for 15 s.
5) 500ul RPE buffer was added to the column and centrifuged at 10000g for 15s at room temperature.
6) 500ul of 80% ethanol was added to the column, and 10000g was centrifuged at room temperature for 2 min.
7) The column was placed in a clean collection tube and centrifuged at 15000g for 2min at room temperature.
8) The column was placed in a clean EP tube and 25ul of RNase-free ddH was added to the column 2 O, standing at room temperature for 2min, centrifuging at 10000g for 1min, and collecting RNA.
Third), qPCR detection:
reverse transcription is carried out by adopting a reverse transcription kit (the reverse transcription kit is a product of ABI company, and the product number is 4366596);
hsa-miR-126-3p adopts Assay ID * 002228 detecting with probe set, adopting Assay ID for hsa-miR-130a-3p * 000454 Probe set for detection, hsa-miR-151a-3p adopts Assay ID * 002254 Probe kit, hsa-miR-199a-5p adopts Assay ID * 000498 Probe kit, hsa-miR-642a-3p adopts Assay ID * 474715_ mat probe set for detection and hsa-miR-4299 adopting Assay ID * 241744_ mat probe set, wherein the probe set is manufactured by ABI company of America;
the reference gene is U6SnRNA (Taqman probe set, cat #4395470, ABI company), and the target sequence corresponding to the reference gene is (found from ABI probe library): GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAU6 ACACACGCAAUUCGGUGAAGCGUUCCAUAUUU.
1) Preparing a reverse transcription reaction solution in a 0.2ml PCR tube according to the following proportion:
wherein 100mM dNTPs, Multiscript Reverse Transcriptase, 10 Xreverse Transcription Buffer and RNase Inhibitor (20U/ul) are all from a Reverse Transcription kit; the 5 × RT primers corresponding to the different mirnas were from the corresponding probe sets.
2) Placing the PCR tube in a PCR instrument, and operating the following procedures to obtain a reverse transcription product:
16℃ 30min
42℃ 50min
85℃ 5min
4℃ ∞
3) preparing PCR detection solution according to the following proportion, and adding the PCR detection solution into a 96-well reaction plate:
| reagent composition | Volume (ul) |
| 2×Taqman Universal PCR Buffer | 10 |
| 20×Taqman MicroRNA Assay Mix | 1 |
| Reverse transcription product | 1.25 |
| ddH 2 O | 7.75 |
| Total amount of | 20 |
Wherein, the 2 XTaqman Universal PCR Buffer is a product of ABI company, and the product number is 4440038; 20 × Taqman MicroRNA Assay Mix corresponding to different miRNAs were from the corresponding probe sets.
4) The 96-well plate was placed in an ABI 7900 fluorescent quantitative PCR instrument and the following program was run:
the relative expression amounts of the respective miRNAs were 2 -ΔCt The method is calculated according to the following formula 2 -ΔCT ＝2 - (CT target gene-CT reference gene) The detection results are shown in table 2, and the expression trend among groups of 6 differential mirnas is consistent with the chip results.
Table 2 real-time fluorescent quantitative PCR (polymerase chain reaction) verification results of 6 differential expression miRNAs
Third, expanding the sample to verify the differential expression of differential miRNAs among groups
Verifying the expression difference of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p, hsa-miR-199a-5p, hsa-miR-642a-3p and hsa-miR-4299 in three groups of patients with tuberculous meningitis, patients with viral meningitis and normal people by adopting qPCR (quantitative polymerase chain reaction), and specifically comprising the following steps of:
selecting 32 cases of tubercular meningitis patients, 30 cases of viral meningitis patients and 34 cases of healthy people, and detecting the expression of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p, hsa-miR-199a-5p, hsa-miR-642a-3p and hsa-miR-4299 in the people according to the method in the step two, wherein the results are shown in Table 3; the results of the differential analysis between the two groups were shown in fig. 1 and table 4, and the expression of 4 mirnas (hsa-miR-126-3P, hsa-miR-130a-3P, hsa-miR-151a-3P and hsa-miR-199a-5P) in the tuberculous meningitis group (indicated as "TBM group" in the table) was still significantly lower than that in the viral meningitis group (indicated as "VM group" in the table) and healthy human group (indicated as "HCs group" in the table), and the difference was statistically significant (n 96, P < 0.01).
Table 3 qPCR detection method expression results (relative expression 1000) of 4 mirnas among different groups (TBM 32, VM 30, HCs 34)
Table 46 differential analysis of expression of mirnas (TBM 32, VM 30, HCs 34) among different groups
Performance evaluation of four, 4 miRNAs and combination thereof in distinguishing and identifying TBM and other two groups of people
One) distinguishing and identifying method
1. The method for distinguishing the patients with tuberculous meningitis from the patients with viral meningitis by using the expression quantity of hsa-miR-126-3p relative to U6SnRNA (the method is called as the method for distinguishing the patients with tuberculous meningitis from the patients with viral meningitis for short) is characterized in that when the expression quantity of hsa-miR-126-3p is less than or equal to 1.49, the patients with tuberculous meningitis are obtained; when the expression level of hsa-miR-126-3p is more than 1.49, the patient is the viral meningitis patient.
2. The method for distinguishing patients with tuberculous meningitis from patients with viral meningitis by using the expression quantity of hsa-miR-130a-3p relative to U6SnRNA (the method is called as the method for distinguishing the patients with tuberculous meningitis from the patients with viral meningitis by using the hsa-miR-130a-3 p) is that when the expression quantity of hsa-miR-130a-3p is less than or equal to 18.19, the patients with tuberculous meningitis are identified; when the expression level of hsa-miR-130a-3p is more than 18.19, the patient is the viral meningitis patient.
3. The method for distinguishing patients with tuberculous meningitis from patients with viral meningitis by using the expression quantity of hsa-miR-151a-3p relative to U6SnRNA (the method is called as a method for distinguishing the patients with tuberculous meningitis from the patients with viral meningitis for short) is that when the expression quantity of hsa-miR-151a-3p is less than or equal to 120.1, the patients with tuberculous meningitis are identified; when the expression level of hsa-miR-151a-3p is more than 120.1, the patient is the viral meningitis patient.
4. The method for distinguishing patients with tubercular meningitis from patients with viral meningitis by using the expression amount of hsa-miR-199a-5p relative to U6SnRNA (the method is called the method for distinguishing tubercular meningitis patients from viral meningitis patients for short) is that when the expression amount of hsa-miR-199a-5p is less than or equal to 0.0006, the patients with tubercular meningitis are obtained; when the expression level of hsa-miR-199a-5p is more than 0.0006, the patient is the viral meningitis patient.
5. The combined expression levels of 4 miRNA combinations are used for distinguishing patients with tuberculous meningitis from patients with viral meningitis:
4 miRNA (hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p and hsa-miR-199a-5p) combined expression amounts (namely, the probability value) are obtained by adopting a Logistic regression method, and the probability value is 0.61. When the probability value is more than 0.61, the patient is the tuberculous meningitis patient; when the probability value is less than or equal to 0.61, the patient is the viral meningitis patient.
II), evaluation of Performance
Receiver operator characteristic curve (ROC curve), which was originally used to evaluate radar performance, is also known as receiver operating characteristic curve. The ROC curve is a curve drawn based on a series of different two classification methods (cut-off values or decision thresholds) with true positive rate (sensitivity) as ordinate and false positive rate (1-specificity) as abscissa. According to SPSS16.0 knowledge, the measurement results of a disease group and a reference group are analyzed, the upper and lower limits, the group distance and the cut-off point (cut-off point) of the measurement value are determined, a cumulative frequency distribution table is listed according to the selected group distance interval, and the sensitivity, the specificity and the false positive rate (1-specificity) of all the cut-off points are respectively calculated. Sensitivity is taken as an ordinate to represent true positive rate, and (1-specificity) is taken as an abscissa to represent false positive rate, and an ROC curve is drawn by plotting.
And calculating ROC curve evaluation statistics. The area under the ROC curve is between 1.0 and 0.5. In the case of AUC > 0.5, the closer the AUC is to 1, the better the diagnostic effect. AUC has lower accuracy when being 0.5-0.7, AUC has certain accuracy when being 0.7-0.9, and AUC has higher accuracy when being more than 0.9. When AUC is 0.5, the diagnostic method is completely ineffective and is not valuable. AUC < 0.5 does not correspond to the real case, and rarely occurs in practice. Therefore, ROC curve analysis was performed on the differential diagnosis results of hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-151a-3p and hsa-miR-199a-5p and their combinations, respectively, using viral meningitis patients and normal human control groups, tubercular meningitis patients as disease groups (i.e., TBM vs. VM and TBM vs. HCs), as shown in Table 5 and FIG. 2:
the areas under the ROC curves (AUC) of the 4 miRNAs used for distinguishing and identifying tuberculous meningitis and viral meningitis are all larger than 0.70, the sensitivities are all larger than 78%, and the specificities are all larger than 56%.
In addition, the combination of 4 mirnas has better ability to distinguish tuberculous meningitis from viral meningitis [ AUC ═ 0.893(0.788-0.957) ], sensitivity of 90.6% (75.0% -98.0%) and specificity of 86.7% (69.3% -96.2%).
Performance evaluation of Table 54 miRNAs and combinations thereof in differential diagnosis of TBM and two other groups of populations
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
SEQUENCE LISTING
<110> the university of capital medical sciences, affiliated to the Beijing thoracic Hospital, the research institute of tuberculosis and breast tumor in Beijing City
Application of miRNA expression quantity detection system in preparation of products for distinguishing tuberculous meningitis and viral meningitis
<130> GNCFY191406
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cagugcaaug uuaaaagggc au 22
<210> 2
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ucguaccgug aguaauaaug cg 22
<210> 3
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cuagacugaa gcuccuugag g 21
<210> 4
<211> 23
<212> RNA
<213> Artificial sequence (artificial sequence)
<400> 4
cccaguguuc agacuaccug uuc 23
Claims (9)
1. The application of the system for detecting the miRNA expression quantity in preparing products for distinguishing or assisting in distinguishing patients with tuberculous meningitis and patients with viral meningitis;
the miRNA is any one of the following groups:
（1）hsa-miR-199a-5p；
(2) hsa-miR-199a-5p and hsa-miR-126-3 p;
(3) hsa-miR-199a-5p, hsa-miR-126-3p and hsa-miR-130a-3 p;
(4) hsa-miR-199a-5p, hsa-miR-126-3p, hsa-miR-130a-3p and hsa-miR-151a-3 p;
(5) hsa-miR-199a-5p and hsa-miR-130a-3 p;
(6) hsa-miR-199a-5p and hsa-miR-130a-3p and hsa-miR-151a-3 p;
(7) hsa-miR-199a-5p and hsa-miR-151a-3 p.
2. Use according to claim 1, characterized in that: the system for detecting the expression level of miRNA is M1) or M2):
m1) a system for detecting the miRNA expression level by quantitative PCR;
m2) a system for detecting the miRNA expression by using a high-throughput microarray chip.
3. Use according to claim 2, characterized in that: the system for detecting the expression quantity of the miRNA by using the quantitative PCR comprises a set of primers, a set of probes, a kit and/or other reagents and/or instruments required for performing the quantitative PCR.
4. Use according to claim 1 or 2, characterized in that: the system for detecting the miRNA expression quantity further comprises a data processing device, wherein the data processing device is used for converting the miRNA expression quantity from a to-be-detected object into a distinguishing result of the to-be-detected object.
5. Use according to claim 4, characterized in that: the object to be detected is a meningitis patient to be detected.
6. Use of a system for distinguishing or aiding in distinguishing between patients with tubercular meningitis and patients with viral meningitis, comprising the miRNA of claim 1 as a marker, in the manufacture of a product for distinguishing or aiding in distinguishing between patients with tubercular meningitis and patients with viral meningitis.
7. Use according to claim 6, characterized in that: the system for distinguishing or assisting in distinguishing patients with tubercular meningitis from patients with viral meningitis is the system for detecting the expression level of miRNA in any one of claims 1-4.
8. Use according to claim 1 or 2 or 6 or 7, characterized in that: the miRNA expression level is the expression level of miRNA in blood.
9. Use according to claim 8, characterized in that: the miRNA expression amount is the miRNA expression amount in peripheral blood mononuclear cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910608612.1A CN110305953B (en) | 2019-07-05 | 2019-07-05 | Application of system for detecting miRNA expression quantity in preparation of products for distinguishing tubercular meningitis and viral meningitis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910608612.1A CN110305953B (en) | 2019-07-05 | 2019-07-05 | Application of system for detecting miRNA expression quantity in preparation of products for distinguishing tubercular meningitis and viral meningitis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110305953A CN110305953A (en) | 2019-10-08 |
| CN110305953B true CN110305953B (en) | 2022-08-23 |
Family
ID=68079312
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910608612.1A Active CN110305953B (en) | 2019-07-05 | 2019-07-05 | Application of system for detecting miRNA expression quantity in preparation of products for distinguishing tubercular meningitis and viral meningitis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110305953B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951870A (en) * | 2020-01-03 | 2020-04-03 | 中国人民解放军总医院 | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel |
| CN114369656B (en) * | 2022-01-24 | 2023-10-03 | 首都医科大学附属北京胸科医院 | Molecular marker for auxiliary diagnosis of tubercular meningitis, application thereof and kit |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105943048A (en) * | 2016-06-27 | 2016-09-21 | 首都医科大学附属北京胸科医院 | Method for distinguishing tubercular meningitis and virus meningitis based on nuclear magnetic resonance technology and application thereof |
| CN107022643A (en) * | 2017-06-12 | 2017-08-08 | 首都医科大学附属北京胸科医院 | The 5p of miR 31 and miR 99a 5p distinguish the application in active tuberculosis and tuberculosis latent infection |
| CN108504736A (en) * | 2018-04-09 | 2018-09-07 | 中国人民解放军第三0九医院 | Detect application of the system of ORM1 gene expression amounts in diagnosis of tuberculosis |
| CN109825575A (en) * | 2019-04-08 | 2019-05-31 | 首都医科大学附属北京胸科医院 | Auxiliary diagnosis miRNA marker lungy and its application |
| CN109913544A (en) * | 2019-03-26 | 2019-06-21 | 哈尔滨医科大学 | It is a kind of for the real-time fluorescence quantitative PCR kit of auxiliary diagnosis tuberculous pleurisy and its application |
-
2019
- 2019-07-05 CN CN201910608612.1A patent/CN110305953B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105943048A (en) * | 2016-06-27 | 2016-09-21 | 首都医科大学附属北京胸科医院 | Method for distinguishing tubercular meningitis and virus meningitis based on nuclear magnetic resonance technology and application thereof |
| CN107022643A (en) * | 2017-06-12 | 2017-08-08 | 首都医科大学附属北京胸科医院 | The 5p of miR 31 and miR 99a 5p distinguish the application in active tuberculosis and tuberculosis latent infection |
| CN108504736A (en) * | 2018-04-09 | 2018-09-07 | 中国人民解放军第三0九医院 | Detect application of the system of ORM1 gene expression amounts in diagnosis of tuberculosis |
| CN109913544A (en) * | 2019-03-26 | 2019-06-21 | 哈尔滨医科大学 | It is a kind of for the real-time fluorescence quantitative PCR kit of auxiliary diagnosis tuberculous pleurisy and its application |
| CN109825575A (en) * | 2019-04-08 | 2019-05-31 | 首都医科大学附属北京胸科医院 | Auxiliary diagnosis miRNA marker lungy and its application |
Non-Patent Citations (2)
| Title |
|---|
| MicroRNA-135a participates in the development of astrocytes derived from bacterial meningitis by downregulating HIF-1α;Yan Dong等;《Am J Physiol Cell Physiol》;20190501;第316卷(第5期);C711-C721 * |
| 一.干扰素释放试验对于结核性脑膜炎的诊断价值以及诊断模型的建立二.结核性脑膜炎差异miRNA的初步筛选;刘菲;《中国优秀博士论文全文数据库 医药科技辑》;20150228;第42页第1-2段，第45页倒数1-2段，第50页第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110305953A (en) | 2019-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110904225A (en) | Combined marker for liver cancer detection and application thereof | |
| CN104293914A (en) | MiRNA marker combination for detecting primary hepatocellular carcinoma serum and application thereof | |
| CN110804669A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| CN110305953B (en) | Application of system for detecting miRNA expression quantity in preparation of products for distinguishing tubercular meningitis and viral meningitis | |
| CN109161593B (en) | Application of circular RNA and microRNA in colorectal cancer screening and diagnosis | |
| KR20200002241A (en) | Biomarker microRNA-26b or microRNA-4449 for diagnosing obesity and use thereof | |
| CN114369656B (en) | Molecular marker for auxiliary diagnosis of tubercular meningitis, application thereof and kit | |
| Hasanoğlu et al. | Investigating differential miRNA expression profiling using serum and urine specimensfor detecting potential biomarkers for early prostate cancer diagnosis | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| CN104694623A (en) | Plasma miRNA marker for diagnosis of lung cancer and application | |
| WO2019117257A1 (en) | Method for assisting in detection of breast cancer | |
| CN111424085B (en) | Application of tRNA source fragment in preparation of breast cancer diagnostic reagent | |
| CN117568481A (en) | Group of plasma exosome tsRNAs markers related to liver cancer and application thereof | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN110373457B (en) | mRNA marker for ulcerative colitis diagnosis and application thereof | |
| CN111733227B (en) | Molecular marker circRNA for diagnosing idiopathic optic neuritis, kit and application | |
| CN113416784A (en) | Serum exosome tsRNA marker related to breast cancer diagnosis and application thereof | |
| US20220033906A1 (en) | Mirnas as biomarkers for parkinson's syndrome | |
| WO2018219998A1 (en) | Mirnas as biomarkers for a systemic inflammatory response syndrome | |
| KR102602133B1 (en) | Kit for diagnosing metastasis of cervical cancer | |
| CN112852811B (en) | lncRNA molecule and application thereof | |
| WO2023120524A1 (en) | Method for screening tuberculosis-infected sample and probe set to be used therefor | |
| CN114686587B (en) | Molecular marker for diagnosing tuberculous pleurisy and application thereof | |
| CN114686586B (en) | Molecular marker composition for diagnosing tuberculous pleurisy and application thereof | |
| CN110218795B (en) | Application of miR-766-3p and miR-766-5p in preparation of high-grade glioma and intracranial lymphoma diagnosis and differential diagnosis preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |