CN110305936B - Specificity amplification primer of sika deer microsatellite locus M009 and application thereof - Google Patents
Specificity amplification primer of sika deer microsatellite locus M009 and application thereof Download PDFInfo
- Publication number
- CN110305936B CN110305936B CN201910722097.XA CN201910722097A CN110305936B CN 110305936 B CN110305936 B CN 110305936B CN 201910722097 A CN201910722097 A CN 201910722097A CN 110305936 B CN110305936 B CN 110305936B
- Authority
- CN
- China
- Prior art keywords
- deer
- microsatellite locus
- antler
- sika deer
- pilose antler
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific amplification primer of a sika deer microsatellite locus M009 and application thereof, and relates to a specific amplification primer of a sika deer microsatellite locus M009 and application thereof. The invention aims to provide a specific amplification primer of a spotted deer microsatellite locus M009 and application thereof. The nucleotide sequence of the sika deer microsatellite locus M009 primer is shown as SEQ.ID.NO: 1 and seq.id no: 2, respectively. The sika deer microsatellite locus M009 is applied to analysis of the growth traits of the pilose antler. The method selects the growth character of the pilose antler according to the genotype, can screen out the high-yield character individuals and the low-yield character individuals of the pilose antler, has high accuracy, simple operation and low cost, can start to select the growth character of the pilose antler in the early life of the spotted deer, shortens the generation interval, improves the selection strength and accelerates the breeding process of the spotted deer. The invention is suitable for the breeding field of sika deer.
Description
Technical Field
The invention relates to a specific amplification primer of a sika deer microsatellite locus M009 and application thereof.
Background
The spotted deer antler serving as a traditional and rare medical health-care medicinal material has high economic value. The key problem influencing the economic benefit of the sika deer breeding industry in China at present is to improve the antler production. However, the high-yield character of the pilose antler is controlled by multiple genes and is a quantitative character with low heritability. The traditional breeding technology is applied, the period is long, for example, the breeding of the double-yang sika deer is as long as 50 years, and early selection is difficult to carry out. Therefore, at present, many scholars study the production traits of the deer antlers from the molecular level by using a molecular genetic marker method, the molecular genetic marker effectively overcomes the defects of the traditional method, can screen functional genes which directly or indirectly act on the deer antlers, is beneficial to improving the variety of the deer antlers, and improves the antler production quantity of the deer antlers.
So far, more than 200 SSR sites have been found in sika deer, and the SSR sites are mainly applied to the research on the aspects of genetic diversity, genetic structure analysis, population introgression detection and the like. However, the research on SSR molecular markers related to the growth traits of antler produced by sika deer is not many: the researchers use 16 microsatellite genetic markers to carry out correlation analysis between different genotypes of 3 sika deer populations and antler production quantity, and find that the BC and CE genotypes of a microsatellite locus BM1225 and the AA genotype of T172 can be used as molecular genetic markers of fresh antler weight characters of the Xingkuchu sika deer populations. Meanwhile, researchers also find that the microsatellite locus associated with the antler production traits of the red deer cannot be used for marking the northeast spotted deer, and the NVHRT16 microsatellite locus marker can be used for marking the antler production quantity of the spotted deer. The DRB3 is found to be obviously and positively correlated with the antler producing performance on the MHC-DRB gene exon 2 of the sika deer, while the DRB8 and the DRB11 are obviously and negatively correlated with the yield of the Buckthorn antler and are not obvious to the weight of the Buckthorn antler. It can be seen that the SSR molecular markers available in breeding of spotted deer for antler are still very limited.
The research on the molecular breeding markers of the spotted deer for antler is combined, and still has some problems, such as limited population samples, lack of development of molecular markers of spotted deer of different varieties, unrefined production property records, generally only antler weight data, no antler other parameter information, incomplete overall evaluation indexes and the like. Due to the reasons, only limited SSR molecular markers related to the growth traits of the deer antlers are screened at present, and the construction of physical maps of the deer and the further deep research on molecular breeding of the deer for antler are greatly limited. Therefore, the effectiveness of molecular assisted breeding of the sika deer is improved, more novel SSR molecular markers are developed, and the molecular assisted breeding method becomes an important topic in the field of molecular breeding of the sika deer for antler at present.
Disclosure of Invention
The invention aims to provide a specific amplification primer of a spotted deer microsatellite locus M009 and application thereof.
The nucleotide sequence of the specific amplification primer of the microsatellite locus M009 of the spotted deer is shown as SEQ.ID.NO: 1 and seq.id no: 2, respectively.
The invention discloses application of a sika deer microsatellite locus M009 in analysis of the growth traits of pilose antler.
The method for screening the spotted deer microsatellite locus M009 comprises the following steps: (1) transcriptome sequencing developed EST-SSR: extracting total RNA of a sika deer sample, synthesizing cDNA, completing the synthesis of a cDNA first chain, the synthesis of a cDNA second chain, the repair of a cDNA double-chain end, the adenylation of a cDNA 3' end, the splicing of a sequencing joint, the agarose electrophoresis separation and the fragment recovery, the amplification of a cDNA fragment, the quality detection of a sequencing library, and obtaining an original sequence of the sika deer; secondly, the original sequence obtained in the step I is subjected to primary processing on a sequencing result according to the following steps: removing low quality segments (reads): removing fragments with lower mass fraction according to Illumina self-contained software, analyzing and removing the linker: removing the sequence containing the joint, and removing reads with the base content which cannot be identified being more than 5 percent to obtain reads with the low-quality fragment and the joint removed; using software SOAP, positioning the low quality segment and joint removed and processed reads to database reference gene, and allowing 2 base mismatch at most. Evaluation of mRNA disruption randomness: distribution of reads on genes was used to assess mRNA disruption randomness. Because different reference genes have different lengths, the positions of reads on the genes are normalized to relative positions, and then the numbers of reads on different position alignments of the genes are counted to obtain unigenes. And fourthly, removing repeated reads through comparison of professional software such as picard-tools and samtools, and filtering unigenes. Using MISA to unigenes is used for EST-SSR detection, 1-6 base repeated EST-SSR sites are searched, and parameters are set as defaults. EST-SSR site analysis of cDNA sequence data of unigenes in the spotted deer transcriptome using software MISA, the main criteria for screening: the length of the repeating unit is 2-6 bp, and the number of times of the dinucleotide repetition is more than or equal to 10 times; thirdly, the number of times of the tetranucleotide repetition is more than or equal to 9; and fifthly, the number of times of the repeated hexanucleotide is more than or equal to 8. Fifthly, designing EST-SSR primers in batches by using software primer3 software, wherein the set standard is as follows: the length of the primer is 18-23bp, the GC content is 40% -60%, the Tm value is 55 ℃ -65 ℃, and the upstream primer T and the downstream primer T aremThe difference in values does not exceed 5 ℃ and the product size is 150-400 bp. (2) And (3) identifying the effectiveness of the EST-SSR primer pair: extraction of genomic DNA: the extraction method of sika deer genomic DNA is carried out according to the specification of the whole blood genomic DNA extraction kit. The extracted DNA solution was loaded on a 1% agarose gel, and the position, brightness and regularity of the DNA were examined to roughly estimate the quality of the DNA. Fluorescence labeling PCR amplification: PCR amplification products are detected by agarose gel electrophoresis, and target band products are selected and detected on an ABI3730xl gene analyzer. PCR amplification reaction System: mu.L of 10 XBuffer I, 0.4. mu.L of TP-M13(5M), 2. mu.L of specific primer (5M), 0.2. mu.L of LTaq enzyme, 2. mu.L of DNA, 7.6. mu.L of ddH 2O. Reaction procedure: 30 cycles of 95 ℃ for 5min and 94 ℃ for 30s, 10 cycles of 56 ℃ for 45s, 72 ℃ for 45s, 94 ℃ for 30s, 53 ℃ for 45s, 72 ℃ for 12 min. Thirdly, performing capillary electrophoresis sequencing by using a full-automatic genetic analyzer ABI3730xl, wherein the total volume of electrophoresis is 13 mu L: 3 u LPCR product, 10 u L loading buffer Hi-DiFormamide, 0.5 u LGS-500Size Standard (Standard internal reference). Mixing, loading into 96-well plate, high temperature denaturing, and electrophoresis detecting. Microsatellite fragment length was determined and microsatellite genotypes were identified by analysis using genotypersion 3.7 software.
The invention has the beneficial effects that: (1) the method selects the growth character of the pilose antler according to the genotype, can screen out the high-yield character individuals and the low-yield character individuals of the pilose antler, has high accuracy, simple operation and low cost, has the cost of about 1 yuan/head under the condition of large-scale selection, and can carry out automatic scale detection; (2) the microsatellite molecular marker method can be used for selecting the growth character of the antler in the early life (within l weeks after birth) of the sika deer, shortening the generation interval, improving the selection strength and accelerating the breeding process of the sika deer.
Detailed Description
The first embodiment is as follows: the nucleotide sequence of the specific amplification primer of the microsatellite locus M009 of the spotted deer in the embodiment is shown as SEQ.ID.NO: 1 and seq.id no: 2, respectively.
The beneficial effects of the embodiment are as follows: (1) the embodiment selects the growth traits of the pilose antler according to the genotype, has high precision, simple operation and low cost, has the cost of about 1 yuan/head under the condition of large-scale selection, and can carry out automatic scale detection; (2) by using the microsatellite molecular marker method of the embodiment, the deer antler growth character can be selected at the early life (within l weeks after birth) of the sika deer, the generation interval is shortened, the selection strength is improved, and the breeding process of the sika deer is accelerated.
The second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: the sequence of the sika deer microsatellite locus M009 gene is shown as SEQ.ID.NO: 3, respectively. The rest is the same as the first embodiment.
The sika microsatellite locus M009 is located at the position of sequence 468-504 bp.
The third concrete implementation mode: the application of the microsatellite locus M009 of the spotted deer in the analysis of the growth traits of the pilose antler is provided.
The fourth concrete implementation mode: the third difference between the present embodiment and the specific embodiment is that: the growth character of the pilose antler is the weight of the pilose antler. The rest is the same as the third embodiment.
The fifth concrete implementation mode: the third or fourth embodiment is different from the first or fourth embodiment in that the growing character of the pilose antler is the length of the trunk. The other is the same as the third or fourth embodiment.
The sixth specific implementation mode: the difference between this embodiment and one of the first to fifth embodiments is: a method for analyzing the growth character of the antler by adopting a sika deer microsatellite locus M009 comprises the following steps: extracting sika deer blood genome DNA, adopting primers of sika deer microsatellite locus M009 to perform fluorescence PCR amplification reaction, taking amplification products to perform capillary electrophoresis sequencing on an ABI3730xl gene analyzer, and screening 9 genotype individuals including 357/363, 357/361, 359/361, 359/363, 357/357, 357/359, 361/363, 359/359 and 361/361, wherein 357/363 is an individual with high-yield character of the pilose antler, and 361/361 is an individual with low-yield character of the pilose antler. The rest is the same as one of the first to fifth embodiments.
Wherein the high-yield character of cornu Cervi Pantotrichum refers to heavy cornu Cervi Pantotrichum and long main trunk length, and the low-yield character refers to light cornu Cervi Pantotrichum and short main trunk length.
The seventh embodiment: the method for screening the microsatellite molecular markers of the sika deer comprises the following steps:
transcriptome sequencing developed EST-SSR: (1) construction of transcriptome libraries: the Sequencing platform is HiSeqTM 2500Sequencing System, and the specific steps are as follows: and (3) purifying, enriching and fragmenting mRNA of the high-quality sika deer sample, and completing the synthesis of a first strand of cDNA, the synthesis of a second strand of cDNA, the repair of a double-stranded end of the cDNA, the adenylation of the 3' end of the cDNA, the splicing of a sequencing joint, the agarose electrophoresis separation and the fragment recovery, the amplification of the cDNA fragment and the quality detection of a sequencing library. After the sequencing is finished, carrying out primary processing on a sequencing result according to the following steps: removing low quality segments (reads): removing fragments with lower mass fraction according to Illumina self-contained software, analyzing and removing the linker: the sequence containing the linker was removed, and reads having a base content of not more than 5% could not be recognized were removed.
(2) Acquisition of transcriptome data: using software SOAP, the preliminary processed reads with low quality fragments and adapters removed were mapped to database reference genes, allowing for up to 2 base mismatches. Evaluation of mRNA disruption randomness: distribution of reads on genes was used to assess mRNA disruption randomness. Because different reference genes have different lengths, positions of reads on the genes are normalized to relative positions, and then the numbers of the reads on different position alignments of the genes are counted to obtain unigenes, wherein the nucleotide sequences of the unigenes are shown in a sequence table SEQ ID No: 3, respectively.
(3) SSR locus searching: duplicate reads were removed and unigenes filtered by alignment with professional software such as picard-tools and samtools. And (3) carrying out EST-SSR detection on unigenes by using MISA, searching for 1-6 base repeated EST-SSR sites, and setting parameters as defaults. EST-SSR site analysis of cDNA sequence data of unigenes in the spotted deer transcriptome using software MISA, the main criteria for screening: the length of the repeating unit is 2-6 bp, and the number of times of the dinucleotide repetition is more than or equal to 10 times; thirdly, the number of times of the tetranucleotide repetition is more than or equal to 9; and fifthly, the number of times of the repeated hexanucleotide is more than or equal to 8.
(4) Designing an EST-SSR primer: the software primer3 is used for designing EST-SSR primers in batches, and the set standard is as follows: the length of the primer is 18-23bp, the GC content is 40% -60%, the Tm value is 55 ℃ -65 ℃, and the upstream primer T and the downstream primer T aremThe difference in values does not exceed 5 ℃ and the product size is 150-400 bp.
And (3) identifying the effectiveness of the EST-SSR primer pair: (1) extraction of genomic DNA: the extraction method of sika deer genomic DNA is carried out according to the specification of the whole blood genomic DNA extraction kit. The extracted DNA solution was loaded on a 1% agarose gel, and the position, brightness and regularity of the DNA were examined to roughly estimate the quality of the DNA. (2) Fluorescence labeling PCR amplification: PCR amplification products are detected by agarose gel electrophoresis, and target band products are selected and detected on an ABI3730xl gene analyzer. PCR amplification reaction System: mu.L of 10 XBuffer I, 0.4. mu.L of TP-M13(5M), 2. mu.L of specific primer (5M), 0.2. mu.L of LTaq enzyme, 2. mu.L of DNA, 7.6. mu.L of ddH 2O. Reaction procedure: 30 cycles of 95 ℃ for 5min and 94 ℃ for 30s, 10 cycles of 56 ℃ for 45s, 72 ℃ for 45s, 94 ℃ for 30s, 53 ℃ for 45s, 72 ℃ for 12 min. (3) Performing capillary electrophoresis sequencing by using a full-automatic genetic analyzer ABI3730xl, wherein the total volume of electrophoresis is 13 mu L: 3 u LPCR product, 10 u L loading buffer Hi-DiFormamide, 0.5 u LGS-500Size Standard (Standard internal reference). Mixing, loading into 96-well plate, high temperature denaturing, and electrophoresis detecting. Genotypersion 3.7 software analysis determines microsatellite fragment length and identifies microsatellite genotypes.
The specific implementation mode is eight: the correlation analysis method of the production traits of the pilose antler and the microsatellite markers in the embodiment comprises the following steps: the SPSS19.0 software is used for carrying out single-marker regression analysis on the screened microsatellite loci M009 and the characteristics (antler weight, trunk length, trunk girth, eyebrow branch length, eyebrow branch girth, mouth head length and mouth head girth) of the antler individuals so as to test the association degree of the markers and the characteristics. The mean value of the growth-related traits of a certain genotype of the microsatellite loci is obviously higher than the mean values of other genotypes, and the mean value of the growth traits of the microsatellite loci is higher than the mean value of the population growth traits to serve as the evaluation standard of the population dominant genotypes.
The following examples were used to demonstrate the beneficial effects of the present invention:
example 1: the method for selecting the antler growth traits of the double-yang spotted deer by applying the microsatellite M009 locus comprises the following steps:
(1) and designing a specific fluorescent primer of the microsatellite M009 locus. A forward primer: M13-CCACTAACTCTCCTGGCTGC, reverse primer: AAGATGGTTTACTCAGTAATCGATG are provided.
(2) Measuring the growth character of the pilose antler: randomly selecting 140 healthy 2-year-old male double-yang spotted deer, and performing general anesthesia on the spotted deer by injecting deer sleep treasure No. 3 (0.02 mg/kg). After about 10min, the sika deer enters an anesthetic state, and blood is collected under jugular vein. After the blood is taken, the root of the pilose antler is tied by a hemp rope, the pilose antler is sawn off from the root of the pilose antler by a disinfected saw, and the sika deer is revived by injecting a deer sober-up No. 3 (0.02 mg/kg). And finally, measuring relevant parameters of the antler, including antler weight, trunk length, trunk girth, eyebrow branch length, eyebrow branch girth, tip length and tip girth.
(3) Fluorescence labeling PCR amplification: extraction of genomic DNA: the extraction method of sika deer genomic DNA is carried out according to the specification of the whole blood genomic DNA extraction kit. The extracted DNA solution was loaded on a 1% agarose gel, and the position, brightness and regularity of the DNA were examined to roughly estimate the quality of the DNA. Further PCR amplification: PCR amplification reaction System: mu.L of 10 XBuffer I, 0.4. mu.L of TP-M13(5M), 2. mu.L of specific primer (5M), 0.2. mu.L of LTaq enzyme, 2. mu.L of DNA, 7.6. mu.L of ddH 2O. Reaction procedure: 30 cycles of 95 ℃ for 5min and 94 ℃ for 30s, 10 cycles of 56 ℃ for 45s, 72 ℃ for 45s, 94 ℃ for 30s, 53 ℃ for 45s, 72 ℃ for 12 min.
(4) Polymorphism analysis of PCR amplification products: performing capillary electrophoresis sequencing by using a full-automatic genetic analyzer ABI3730xl, wherein the total volume of electrophoresis is 13 mu L: 3 u LPCR product, 10 u L loading buffer Hi-DiFormamide, 0.5 u LGS-500Size Standard (Standard internal reference). Mixing, loading into 96-well plate, high temperature denaturing, and electrophoresis detecting. Then, the molecular weight of an allelic genotyping standard (ROX) is standard, the allelic type is confirmed according to the length variation range and the peak shape characteristic of the DNA fragment, and 9 genotype sika deer individuals including 357/363, 357/361, 359/361, 359/363, 357/357, 357/359, 361/363, 359/359 and 361/361 are screened out at the M009 locus. As shown in Table 1, the correlation analysis between microsatellite M009 of Cervus Nippon Temminck and cornu Cervi Pantotrichum growth traits shows that the average values of antler weight and trunk length of genotype 357/363 are higher than those of other genotype individuals, and the difference between the genotype and the genotype 361/361 is significant. In combination with the mean of individuals containing alleles 357, 359, 361 and 363, it can be speculated that alleles 357 and 363 positively influence the bushy weight and trunk length of sika deer. Genotype 361/361 is the lowest average of antler weight and trunk length, and therefore allele 361 may negatively affect antler weight and trunk length in sika deer.
TABLE 1 correlation analysis of microsatellite M009 of Cervus Nippon Temminck and growth traits of cornu Cervi Pantotrichum
(5) Selecting high-yield antler individuals: m009 site 357/363 is used as the individual dominant genotype of high-yield Dacron antler, and is preferentially selected, and 361/361 is used as the individual genotype of low-yield Dacron antler, and is recommended to be eliminated.
The growth traits of the spotted deer antler are referred to the national standards of the people's republic of China (GB/T6935-. Measuring parameters related to cornu Cervi Pantotrichum comprises: antler weight, trunk length, trunk girth, eyebrow branch length, eyebrow branch girth, tip length, and tip girth.
In conclusion, in the embodiment, the pilose antler growth character selection is carried out according to the genotype, so that the pilose antler high-yield character individuals and the pilose antler low-yield character individuals can be screened out, the accuracy is high, and the operation is simple; by using the microsatellite molecular marker method of the embodiment, the deer antler growth character can be selected immediately in the early life (within l weeks after birth), the generation interval is shortened, the selection strength is improved, and the breeding process of the deer is accelerated.
Sequence listing
<110> Jilin university of agriculture
<120> specific amplification primer of sika deer microsatellite locus M009 and application thereof
<160> 3
<210> 1
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> Forward primer at M009 position from microsatellite.
<400> 1
M13-CCACTAACTCTCCTGGCTGC 24
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> reverse primer at M009 site of microsatellite.
<400> 2
AAGATGGTTTACTCAGTAATCGATG 25
<210> 3
<211> 855
<212> DNA
<213> Spotted deer
<400> 3
tccaaggaac aagcgtcttt taataacata taatttaccc agtcatcatc cttattgtct 60
actttcccct actgaagttt cataaaggaa gagaatttta gtctctcttg ttcactagta 120
tatctcaagc cctataggtg gcacatagga agcactgaat aactatttgt tgaacaaata 180
ggaattttgc acatgataaa cgtcatatct caaatcagtg gtgaaaagat ggtttactca 240
gtaatcgatg atatttctgt ggagccatgt ggaaaaagat gaagttgaat ccatacctca 300
cactttacat tagaactgtc ttcaaattga tcaaatattt aaatttaaat atttttgatt 360
taatttttgt gaaaaactaa gccacagaag ttacacaaga aaaaaatggg agaattcctt 420
tataacttac aactgagaat ccagaagcca taaaagaaaa gattgatgag agagagagag 480
acaggagaga gagagagaga gagagccagc taagcaaagg gcagaagaca gaaaggaaaa 540
gattattttt ggaaccataa agggcagcca ggagagttag tggggcccta aaggaccttt 600
cacaggactt aaaggataat aaggaaaatc ttgtcatgag ctgaagaaag ggaacacttg 660
aagaaggaat tttggttaac agtgtcacct tcagtaacaa gaaaaatagg aactatactt 720
aatggaatca atgatatatt taaggagatt ttcaggtaga agattgaaag tgtcagctgt 780
cagcttctgg ctggttaaag taaaatgtga gaggaaaaga taaactaaat aaagaactgt 840
tacatataaa ggaag 855
Claims (3)
1. An application of a microsatellite locus M009 of Cervus Nippon Temminck in the analysis of the growth traits of cornu Cervi Pantotrichum is characterized in that the growth traits of cornu Cervi Pantotrichum are weight of Buckoo and length of trunk; the nucleotide sequence of the specificity amplification primer of the spotted deer microsatellite locus M009 is shown as SEQ.ID.NO: 1 and seq.id no: 2, respectively.
2. The use of the microsatellite locus M009 of Cervus Nippon Temminck as claimed in claim 1 for analyzing the growth traits of deer antler, wherein the sequence of the microsatellite locus M009 of Cervus Nippon Temminck is as shown in SEQ. ID. NO: 3, respectively.
3. The use of the microsatellite locus M009 of Cervus Nippon Temminck in the analysis of the growth traits of pilose antler according to claim 1, wherein the microsatellite locus M009 of Cervus Nippon Temminck is adopted in the analysis of the growth traits of pilose antler: extracting sika deer blood genome DNA, carrying out fluorescence PCR amplification reaction by adopting a primer of a sika deer microsatellite locus M009, carrying out capillary electrophoresis sequencing on an amplification product on an ABI3730xl gene analyzer, and screening 9 genotype individuals including 357/363, 357/361, 359/361, 359/363, 357/357, 357/359, 361/363, 359/359 and 361/361, wherein 357/363 is an individual with a high-yield character of the pilose antler, and 361/361 is an individual with a low-yield character of the pilose antler.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910722097.XA CN110305936B (en) | 2019-08-06 | 2019-08-06 | Specificity amplification primer of sika deer microsatellite locus M009 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910722097.XA CN110305936B (en) | 2019-08-06 | 2019-08-06 | Specificity amplification primer of sika deer microsatellite locus M009 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110305936A CN110305936A (en) | 2019-10-08 |
| CN110305936B true CN110305936B (en) | 2022-02-22 |
Family
ID=68083249
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910722097.XA Active CN110305936B (en) | 2019-08-06 | 2019-08-06 | Specificity amplification primer of sika deer microsatellite locus M009 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110305936B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114231644B (en) * | 2022-01-21 | 2023-08-18 | 中国农业科学院特产研究所 | SNP molecular marker related to heavy character of spotted deer antler, detection primer, kit and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586257A (en) * | 2012-01-20 | 2012-07-18 | 吉林农业大学 | Sika deer IGF (Insulin-like Growth Factor)-1 polypeptide and preparation method thereof |
| CN107164468A (en) * | 2017-05-16 | 2017-09-15 | 中国农业科学院特产研究所 | Polymorphic micro-satellite DNA molecular marker for deer and application thereof |
-
2019
- 2019-08-06 CN CN201910722097.XA patent/CN110305936B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586257A (en) * | 2012-01-20 | 2012-07-18 | 吉林农业大学 | Sika deer IGF (Insulin-like Growth Factor)-1 polypeptide and preparation method thereof |
| CN107164468A (en) * | 2017-05-16 | 2017-09-15 | 中国农业科学院特产研究所 | Polymorphic micro-satellite DNA molecular marker for deer and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Development of novel EST microsatellite markers for genetic diversity analysis and correlation analysis of velvet antler growth characteristics in Sika deer;Boyin Jia 等;《Hereditas》;20200626;第157卷(第24期) * |
| 中国鹿茸分子遗传多样性研究;邢秀梅;《中国优秀博硕士学位论文全文数据库（博士）农业科技辑》;20061015;第24-57页 * |
| 鹿微卫星遗传分析的研究现状;张苏云 等;《草食家畜》;20050630(第2期);第30-33页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110305936A (en) | 2019-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114214426B (en) | SNP molecular marker influencing alpine merino wool length traits and application thereof | |
| CN112359093B (en) | Method and kit for preparing and expressing and quantifying free miRNA library in blood | |
| CN114752680B (en) | SNP marker affecting diameter of wool fibers of merino sheep in alpine and application thereof | |
| CN111500763A (en) | SNP molecular marker related to palmitoleic acid content in oil tea seed oil and application thereof | |
| CN113684301B (en) | SNP (Single nucleotide polymorphism) marker and primer for identifying apricot pericarp Mao Xingzhuang and application of SNP marker and primer | |
| CN112176076A (en) | NFAT5 gene molecular marker related to goat growth traits and application thereof | |
| CN110305936B (en) | Specificity amplification primer of sika deer microsatellite locus M009 and application thereof | |
| CN110331216B (en) | Specificity amplification primer of sika deer microsatellite locus M027 and application thereof | |
| CN114262741A (en) | SNP molecular marker related to disease resistance traits of silurus meridionalis and application thereof | |
| CN113528677A (en) | Leaf-specific notopterygium plateau loach microsatellite molecular marker, and primer and application thereof | |
| CN110878376B (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| CN114657266B (en) | SNP molecular marker for identifying shearing quantity of merino sheep in the whole year and application thereof | |
| CN112251516B (en) | Method for detecting standard weight and day-age of pigs by using chromosome 7 of pigs and kit thereof | |
| CN104762373A (en) | Chicken muscle fiber-type property-related gene molecule marker and use thereof | |
| KR20150056407A (en) | SNP molecular markers associated with distinction of grape understock variety and uses thereof | |
| CN111763668B (en) | Sequencing primer group and PCR-based whole genome sequencing method | |
| CN110438245B (en) | SNP (single nucleotide polymorphism) marker of clam and application thereof | |
| CN109468407B (en) | SSR molecular marker of holboellia latifolia as well as application and preparation method thereof | |
| CN114107443B (en) | Method for researching paulownia arbuscular disease based on m6A methylation sequencing | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN112538533B (en) | Molecular marker related to long-hair rabbit hair length and application thereof | |
| CN114525345B (en) | Castor silkworm SSR molecular marker and application thereof | |
| CN116103413B (en) | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof | |
| US20240191296A1 (en) | SPECIFIC DNA FRAGMENTS FOR SEX IDENTIFICATION OF MASTACEMBELUS ARMATUS, GENETIC sex MARKER PRIMERS AND APPLICATIONS THEREOF | |
| Tinio et al. | Development of microsatellite markers from genomic DNA of Parashorea malaanonan (Dipterocarpaceae) using next-generation sequencing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jia Boyin Inventor after: Du Rui Inventor after: Liu Yuan Inventor after: Li Qining Inventor after: Tan Zehao Inventor after: Liu Honglang Inventor after: Liu Xinyu Inventor after: Liu Dongdong Inventor after: Yang Fuhe Inventor before: Jia Boyin Inventor before: Liu Yuan Inventor before: Li Qining Inventor before: Tan Zehao Inventor before: Liu Honglang Inventor before: Liu Xinyu Inventor before: Liu Dongdong Inventor before: Yang Fuhe |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |