CN110305875A

CN110305875A - Rice mediator subunit OsMED25 gene, its coding albumen and its application

Info

Publication number: CN110305875A
Application number: CN201910395080.8A
Authority: CN
Inventors: 卜庆云; 任月坤; 田晓杰; 李秀峰; 王臻昱
Original assignee: Northeast Institute of Geography and Agroecology of CAS
Current assignee: Northeast Institute of Geography and Agroecology of CAS
Priority date: 2019-05-13
Filing date: 2019-05-13
Publication date: 2019-10-08
Anticipated expiration: 2039-05-13
Also published as: CN110305875B

Abstract

Rice mediator subunit OsMED25 gene, its encode albumen and its application, be related to a kind of OsMED25 gene, its encode albumen and its application.The present invention provides rice mediator subunit OsMED25 gene, its coding albumen and its application.The nucleotide sequence of OsMED25 gene is as shown in SEQ ID NO:1 in sequence table.The amino acid sequence of albumen is encoded as shown in SEQ ID NO:2.Rice mediator subunit OsMED25 participates in rice BR signal pathway.Expression of the rice mediator subunit OsMED25 for adjusting and controlling rice Leaf angle and adjusting and controlling rice BR synthesis gene.

Description

Rice mediator subunit OsMED25 gene, its coding albumen and its application

Technical field

The present invention relates to a kind of OsMED25 gene, its coding albumen and its applications.

Background technique

For rice as one of China's staple food crop, plant type of rice is most important to rice yield, and Leaf angle is regulation One of impact factor of plant type of rice, upright blade can make plant capture more luminous energy, and then improve rice yield.Oil Dish element sterol (Brassinosteroid, BR) is a kind of important plant hormone, is played in the plant type of rice determines main Regulating and controlling effect, brassinosteroid BRs can regulate and control growth and development and the annidation of plant, send out in terms of controlling plant type of rice Wave important function.Along with the generation of various transcriptional controls in Plant hormone signal transductive process.Intermediary's nanocrystal composition is in base Function served as bridge is played between the transcriptional machinery based on RNA polymerase II because of special transcription factor, is weight during transcriptional control The component part wanted.

Therefore, the relevant regulatory factor of research BR signal pathway, nutrient growth and reproductive development to rice etc. have weight The meaning wanted.

Summary of the invention

The object of the present invention is to provide rice mediator subunit OsMED25 gene, its coding albumen and its applications, participate in water Rice BR signal pathway.

The nucleotide sequence of rice mediator subunit OsMED25 gene of the present invention is as shown in SEQ ID NO:1 in sequence table.

The amino acid sequence such as SEQ ID NO:2 institute of the coding albumen of rice mediator subunit OsMED25 gene of the present invention Show.

Application of the rice mediator subunit OsMED25 gene of the present invention in adjusting and controlling rice BR signal pathway.

Application of the rice mediator subunit OsMED25 gene of the present invention in adjusting and controlling rice Leaf angle.

Application of the rice mediator subunit OsMED25 gene of the present invention in the expression of adjusting and controlling rice BR synthesis gene.

Beneficial effects of the present invention:

The present invention successfully clones rice mediator subunit OsMED25 gene for the first time on a molecular scale.

The present invention is by genetic transformation means, and by OsMED25 gene, overexpression or knockout or RNA are interfered in rice, OsMED25RNA interference is proved by BR sensitivity experiments and knocks out sensibility reduction of the transgenic paddy rice to BR.And OsMED25 Overexpression transgenic plant does not change to the sensibility of BR.

By transgenic technology rice mediator subunit OsMED25 is subjected to RNA interference and knockout in rice, and obtained The advanced lines transgenic line of stable heredity.Phenotype experimental analysis shows OsMED25RNA interference and knocks out transgenic line , heading stage delay more upright than control material Leaf angle.BR sensitivity experiments the result shows that, and compare OryzasativaLcv.Nipponbare non-transgenic material It compares, OsMED25RNA interference and knockout transgenic line reduce the sensibility of BR.Genetic analysis the result shows that, OsMED25 is located at the downstream of OsBZR1.Biochemical studies show OsMED25 and BR transcription factor OsBZR1 in plant There are interactions, and can be enriched in the promoter region of OsBZR1 target gene OsD2.And it lacks OsMED25 and has significantly dropped Transcriptional repression activity of the low OsBZR1 to target gene OsD2.RNA-seq the result shows that, OsMED25 significantly affects nearly 45% OsBZR1 controlling gene expression, show that OsMED25 to OsBZR1 regulation downstream gene be function is being indispensable. Rice mediator subunit OsMED25 participates in the discovery of rice BR signal pathway, and the cognition of agency body function and rice BR are believed The molecular mechanism of number transduction has important value, and provides important theoretical foundation to plant type of rice breeding, has wide Application prospect.

Detailed description of the invention

Fig. 1 is OsMED25RNA interference of transgene plant expression testing result；

Fig. 2 is heading stage OsMED25RNA interference of transgene rice phenotypic results；

Fig. 3 is heading stage OsMED25RNA interference of transgene rice phenotypic analysis histogram；

Fig. 4 is target practice effect detection result；

Fig. 5 is osmed25 mutation type surface result；

Fig. 6 is OsMED25RNA interference of transgene rice BR sensitivity Detection result；

Fig. 7 is the BR sensitivity Detection result of osmed25 mutant plants；

Fig. 8 is the horizontal testing result of OsMED25RNA interference of transgene plant BR synthetic gene expression；

Fig. 9 is the horizontal testing result of osmed25 mutant BR synthetic gene expression；

Figure 10 is that OsMED25 is overexpressed transgenic plant expression testing result；

Figure 11 is that OsMED25 is overexpressed transgenic plant phenotypic results；

Figure 12 is that OsMED25 is overexpressed the horizontal testing result of transgenic plant BR synthetic gene expression；

Figure 13 is that OsMED25-GFP is overexpressed transgenic plant expression testing result；

Figure 14 is that OsMED25-GFP is overexpressed transgenic plant phenotypic results；

Figure 15 is that OsMED25-GFP is overexpressed transgenic plant protein level testing result；

Figure 16 is OsMED25 and OsBZR1 science of heredity relationship analysis result.

Figure 17 is the BR sensitivity Detection result of OsMED25-RNAi Osbzr1-D double-mutant plant；

Figure 18 is the horizontal testing result of BR synthetic gene expression of OsMED25-RNAi Osbzr1-D double-mutant plant；

Figure 19 is OsMED25 and OsBZR1 interaction result；

Figure 20 is OsMED25 in OsBZR1 target gene OsD2 promoter region enrichment result；

Figure 21 is OsD2 promoter region link position schematic diagram；

Figure 22 is that OsMED25 reduces OsBZR1 to the transcriptional repression activity result of OsD2；

Figure 23 is that OsBZR1 raises gene and the intersection of OsMED25 down-regulated gene is analyzed；

Figure 24 is that OsBZR1 down-regulated gene and OsMED25 raise gene intersection analysis.

Specific embodiment

The technical solution of the present invention is not limited to the following list, further includes between each specific embodiment Any combination.

Specific embodiment 1: the nucleotide sequence such as sequence of present embodiment rice mediator subunit OsMED25 gene In table shown in SEQ ID NO:1.

Specific embodiment 2: the amino acid of the coding albumen of present embodiment rice mediator subunit OsMED25 gene Sequence is as shown in SEQ ID NO:2.

Specific embodiment 3: present embodiment rice mediator subunit OsMED25 gene is on adjusting and controlling rice BR signal way Application in diameter.

Specific embodiment 4: present embodiment rice mediator subunit OsMED25 gene is in adjusting and controlling rice Leaf angle Application.

Specific embodiment 5: present embodiment rice mediator subunit OsMED25 gene synthesizes base in adjusting and controlling rice BR Application in the expression of cause.

Elaborate below to the embodiment of the present invention, following embodiment under the premise of the technical scheme of the present invention into Row is implemented, and gives detailed embodiment and specific operating process, but protection scope of the present invention is not limited to following realities Apply example.

Embodiment 1: the clone of rice Os MED25 gene

One, using rice varieties OryzasativaLcv.Nipponbare as material, with the operation bought from the TRIzol kit of Invitrogen company Handbook extracts blade total serum IgE；

Two, the total serum IgE extracted using I processing step one of DNase；

Three, take 1 μ g step 2 treated total serum IgE to be used for the synthesis of cDNA, the synthetic operation of cDNA is according to purchase from BD The BD SMART of Biosciences Clontech company^TMRACE cDNA Amplification Kit kit uses hand Volume carries out, and obtains cDNA；

Four, OsMED25 gene is expanded by forward primer F1 and reverse primer R1 using the cDNA of acquisition as template, PCR is anti- Answer condition as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2.5min 38 are recycled totally, then PCR product is sequenced 72 DEG C of extension 10min in ABI3130 sequenator (ABI company)；Sequencing result shows in rice Mediator subunit OsMED25 gene is by 2529 base compositions, and as shown in SEQ ID NO:1, coding has SEQ in sequence table The protein of the amino acid sequence of ID NO:2.

Forward primer F1:GTTACTTCTGCACTAGGTACCATGGCGGCGGCGGCGGCCGA

Reverse primer R1:TCTTAGAATTCCCGGGGATCCAGATAGGTAGCCACCCCCAG

Embodiment 2: the acquisition of rice Os MED25RNA interference plant

One, it with rice varieties OryzasativaLcv.Nipponbare (NP) for material, is mentioned with purchase from the TRIzol and ultrapure RNA that health is ShiJi Co., Ltd Kit is taken, extracts blade total serum IgE according to operating instruction.

Two, take 1 μ g step 1 treated total serum IgE to be used for the synthesis of cDNA, the synthetic operation of cDNA is according to purchase from complete Formula King CompanyOne-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription The service manual of kit carries out, and obtains cDNA.

Three, using the cDNA of acquisition as template, the good 363bp segment of the gene coding region OsMED25 C-terminal specificity, root are chosen According to the restriction enzyme site design primer on pTCK303 interference carrier, pass through the part piece of F2 and R2 primer amplification OsMED25 gene Section, PCR reaction condition is as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, and 58 DEG C of annealing 30s, 72 DEG C of extension 40s 38 are followed totally Ring, then 72 DEG C of extension 10min.Segment is recycled after PCR amplification, with after BamH I and Kpn I and Sac I and Sal I digestion points Two steps are connected into pTCK303 carrier, construct recombinant vector pTCK303-OsMED25-RNAi.

The OsMED25RNA interference carrier built is transferred in control rice varieties OryzasativaLcv.Nipponbare by agrobacterium-mediated transformation.

Forward primer F2:5'-CTCTAACCTTGAGTACCTATCCGGACTACGTCGAGAAGATC-3'

Reverse primer R2:5'-CGATCGGGGAAATTCGAGCTCGGTAGACAGGCGTAGGCAGT-3'

The identification of embodiment 3:OsMED25RNA interference of transgene rice molecular

It one, is century public affairs with buying from health using OsMED25RNA interference of transgene rice to be identified and OryzasativaLcv.Nipponbare as material The TRIzol kit of department and the operation manual of ultrapure RNA extracts kit extract blade total serum IgE.

It three, is template by F3 and R3 primer amplification OsMED25 gene using the cDNA of acquisition, real-time fluorescence quantitative PCR, instead Answer condition as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s 38 are recycled totally, then 72 DEG C Extend 10min, calculation expression amount.Data are obtained from Bio-Rad chromo 4real-time PCR detector；With 2^-△△CTMethod analyzes multiple variation.

Forward primer F3:5'-GCTGCTATTTCTGAAGGTCT-3'

Reverse primer R3:5'-GTAGGCAGTGGATAAGGATT-3'

Qualification result:

As shown in Figure 1, in 5 strains of OsMED25RNA interference of transgene rice (OsMED25-RNAi), #1 plant Middle OsMED25 expression quantity is that OsMED25 expression quantity is control day in 20%, the #4 plant for compare OryzasativaLcv.Nipponbare non-transgenic material The 50% of this fine non-transgenic material.OsMED25 expression quantity is compare OryzasativaLcv.Nipponbare non-transgenic material 40% in #5 plant. Prove that experimental material used by this experiment is strictly what OsMED25 gene expression amount reduced.

OsMED25RNA interference of transgene rice phenotypic analysis result:

As shown in Fig. 2, left side is control rice plant, right side is OsMED25RNA interference of transgene plant.Heading stage, OsMED25RNA interference of transgene plant plant type is compact, and Leaf angle is upright.As shown in figure 3, OsMED25RNA interference of transgene is planted Strain sword-like leave Leaf angle is extremely significant to be less than control OryzasativaLcv.Nipponbare nontransgenic plants.

The acquisition of embodiment 4:osmed25 mutant

One, vector construction: the target practice sgRNAs of two sections of OsMED25 of design is sequentially connected into CRISPR/Cas9 binary vector In pYLCRISPR/Cas9Pubi-H, the target practice primers F 4 and R4 of U3 promoter are connected, and the target practice of connection U6a promoter is drawn The nucleotide sequence of object F5 and R5 are as follows:

Forward primer F4:5'-GGCA TTAGTCGTCTTCCATACCCA-3'

Reverse primer R4:5'-AATCAGCAGAAGGTATGGGTCAAA-3'

Forward primer F5:5'-GGCGCTTTTTGTGTGCAACGGAG-3'

Reverse primer R5:5'-GAAAAACACACGTTGCCTCCAAA-3'

Two, purpose carrier converts Agrobacterium EHA105, and agrobacterium-mediated transformation is transferred in Rice Varieties in Heilongjiang Province dragon round-grained rice 11, needle To OsMED25 gene, the mutant of OsMED25 gene knockout homozygosis is identified.

Embodiment 5:osmed25 Mutant Rice Molecular Identification

Genetically modified plants DNA is extracted, in the both ends target practice sgRNAs design primer, does the piece that PCR amplification includes target practice region Section, sequencing analysis target practice effect.Target practice effect detection primers F 6 and R6 sequence are as follows:

Forward primer F6:5'-AAAAGAGCAGCAGTTAGCCA-3'

Reverse primer R6:5'-GAAAAGAACTGAACGATGCC-3'

Osmed25 mutant target practice site is as follows:

LJ11 5'-TTAGTCGTCTTCCATACCCATGGTCCTTATAGC-3'

osmed25-1(-16bp) 5'-TTAGTCG---------------------TATAGC-3'

osmed25-2(-1bp) 5'-TTAGTCGTCTTCCATA--CCATGGTCCTTATAGC-3'

Target practice effect detection result is shown in Fig. 4, and osmed25 mutation type surface result is shown in Fig. 5.Osmed25 is base deletion Mutant selects the osmed25 mutant of 2 different deletion types for studying in next step.

Embodiment 6:OsMED25RNA interference of transgene rice and osmed25 mutant BR sensitivity analysis

One, first to removal glume after OsMED25RNA interference of transgene plant, osmed25 Mutant Rice seed and Control OryzasativaLcv.Nipponbare rice paddy seed carries out disinfection processing, and 70% alcohol surface sterilization is primary, 30% hypochlorite disinfectant twice, every time 20min, 28 DEG C of shaking table 120rpm are rinsed 4~5 times after outwelling sodium hypochlorite with sterilized distilled water.

Two, the rice paddy seed after disinfection is seeded in the conical flask for filling 1/2MS solid medium with tweezers, each cone Shape bottle sows 12 seeds, and the operation of step 1 and step 2 carries out in sterile super-clean bench.

Three, conical flask is placed in 30 DEG C of illumination boxs, switchs to dark culturing after seed sprouting, grows 10 days left sides It is right.

Four, BR processing is carried out after the 3rd rice leaf is unfolded.Clip the 1st complete leaf (blade and the long 1.5cm of leaf sheath Left and right) it is placed in the culture dish added with various concentration BR, dark is incubated for 48h, takes pictures, and measures Leaf angle using ImageJ software Size.

As shown in Figure 6 and Figure 7 (in Fig. 6 ● indicate NP, ▲ indicate OsMED25RNAi；Curve a indicates LJ11 in Fig. 7, bent Line b indicates osmed25-1), in the case where being handled without BR, compare OryzasativaLcv.Nipponbare and OsMED25RNA interference of transgene plant, Osmed25 mutant plants Leaf angle is almost upright.With the increase of BR concentration, compares OryzasativaLcv.Nipponbare plant Leaf angle and constantly increase Add, and OsMED25RNA interference of transgene plant and osmed25 mutant plants Leaf angle do not generate significant change.This One the result shows that, the reduction of OsMED25 gene expression amount result in OsMED25RNA interference of transgene plant and osmed25 mutation The sensibility of body plant pair BR reduces.

Embodiment 7:OsMED25RNA interferes plant and the analysis of osmed25 mutant plants BR synthetic gene expression amount

One, by OsMED25RNA interference of transgene plant, osmed25 mutant plants seed and control OryzasativaLcv.Nipponbare rice seed Son carries out disinfection processing, and 70% alcohol surface sterilization is primary, 30% hypochlorite disinfectant twice, each 20min, 28 DEG C of shaking tables 120rpm is rinsed 4~5 times after outwelling sodium hypochlorite with sterilized distilled water.

Two, the seed after disinfection degerming is seeded in 1/2MS solid medium, artificial climate incubator (model: RXZ0450；Light:14h, dark:10h) 28 DEG C culture 2 weeks.

Three, OsMED25RNA interference of transgene plant and osmed25 mutant plants RNA are extracted, reverse transcription synthesizes cDNA Real-time fluorescence quantitative PCR detection is carried out using primers F 7 and R7, F8 and R8, F9 and R9 afterwards.Reaction condition is as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, totally 38 circulation, then 72 DEG C of extension 10min, calculation expression amount. Data are obtained from Bio-Rad chromo 4real-time PCR detector；With 2^-△△CTMethod analyzes multiple variation.

Forward primer F7:5'-ATGGTGTGGTGGCGATTGGGGTGGTTG-3'

Reverse primer R7:5'-ATGTTGTTCCGCCCCAGGATGTCCAGCA-3'

Forward primer F8:5'-GGCGACATTGAGAAGATTGC-3'

Reverse primer R8:5'-CAGAAGGCGATGACATTGACC-3'

Forward primer F9:5'-CGCTGACGGAGCTGATG-3'

Reverse primer R9:5'-ACTTGAGGTGGGAGGACTTG-3'

As shown in FIG. 8 and 9, in Fig. 8Indicate NP,Indicate OsMED25-RNAi；In Fig. 9Indicate LJ11,Table Show osmed25-1；Compared with compareing OryzasativaLcv.Nipponbare plant, OsMED25RNA interference of transgene plant and osmed25 mutant plants In the expression quantity of 3 BR synthesis genes have different degrees of rising, illustrate rice mediator subunit OsMED25 as one just Regulatory factor participates in rice BR signal pathway.

Embodiment 8: the acquisition of rice mediator subunit OsMED25 overexpression genetically modified plants

One, Overexpression vector constructs: by the cDNA of the OsMED25 gene of acquisition, being packed into plant expression vector In pCAMBIA1390, the OsMED25 fusion plasmid of Ubi promoter driving is formed；

Two, purpose carrier converts Agrobacterium EHA105, and agrobacterium-mediated transformation is transferred in Rice Varieties in Heilongjiang Province dragon round-grained rice 11, needle To OsMED25 gene, 20 plants of identification or more singly copies the homozygous overexpression transgenic paddy rice of insertion.

Embodiment 9:OsMED25 gene overexpression transgenic paddy rice Molecular Identification:

Pass through forward primer F3 and reverse primer R3 by template of the cDNA of OsMED25 gene overexpression transgenic plant, Real-time fluorescence quantitative PCR is carried out using SYBR Green PCR master mix (TransStart).Data are from Bio- It is obtained on Radchromo 4real-time PCR detector；With 2^-△△CTMethod analyzes multiple variation.

OsMED25 gene overexpression transgenic paddy rice Molecular Identification result such as Figure 10 (representative can be stablized with 2 plants For the OsMED25 gene overexpression transgenic paddy rice of heredity).OsMED25 gene is set in the expression compareed in imperial round-grained rice 11 It is 1；In 2 strains of OsMED25 gene overexpression transgenic paddy rice, OsMED25-OE1 expression quantity is 21 times of control, OsMED25-OE2 expression quantity is 27 times of control.Result above proves that experimental material used by this experiment is strictly OsMED25 Gene overexpression.

OsMED25 gene overexpression transgenic plant phenotypic analysis:

As shown in figure 11, the plant height of OsMED25 gene overexpression transgenic plant, Leaf angle, heading stage and imperial round-grained rice is compareed 11 compare, and there is no generate significant change.

Embodiment 10:OsMED25 gene overexpression transgenic plant BR synthetic gene expression horizontal analysis

The OsMED25 for extracting growth 10 days is overexpressed the RNA of transgenic plant, and reverse transcription utilizes primers F 7 after synthesizing cDNA Real-time fluorescence quantitative PCR detection is carried out with R7, F8 and R8, F9 and R9.Reaction condition is as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of changes Property 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, totally 38 circulations, then 72 DEG C of extension 10min, calculation expression amount.Data are from Bio- It is obtained on Rad chromo 4real-time PCR detector；With 2^-△△CTMethod analyzes multiple variation.

As shown in figure 12, Tu12ZhongIndicate LJ11,Indicate OsMED25-OE, OsMED25 gene overexpression transgenosis For the expression quantity of 3 BR synthesis gene OsDW, OsD11, OsD2 compared with compareing imperial round-grained rice 11, expression does not generate change in plant Change.

Embodiment 11: the acquisition of rice mediator subunit OsMED25-GFP overexpression genetically modified plants

One, the code area OsMED25 overall length is connected on entry vector pENTR/D-TOPO first, is then reacted by LR By in its homologous recombination to purpose carrier pGWB5 (- GFP), to obtain 35Spro:OsMED25-GFP.

Two, purpose carrier converts Agrobacterium EHA105, and agrobacterium-mediated transformation is transferred in rice varieties OryzasativaLcv.Nipponbare, for OsMED25 gene, 20 plants of identification or more singly copy the homozygous overexpression transgenic paddy rice of insertion.

The detection of embodiment 12:OsMED25-GFP gene overexpression transgenic paddy rice expression

Pass through forward primer F3 and reverse primer by template of the cDNA of OsMED25-GFP gene overexpression transgenic plant R3 carries out real-time fluorescence quantitative PCR using SYBR Green PCR master mix (TransStart).Data are from Bio-Rad It is obtained on chromo 4real-time PCR detector；With 2^-△△CTMethod analyzes multiple variation.

OsMED25-GFP is overexpressed transgenic paddy rice Molecular Identification result such as Figure 13 (representative can be stablized with 2 plants For the OsMED25 gene overexpression transgenic paddy rice of heredity).Expression of the OsMED25 gene in control OryzasativaLcv.Nipponbare is set It is 1；In 2 strains of OsMED25 gene overexpression transgenic paddy rice, OsMED25-OE1 expression quantity is the 270 of control Times, OsMED25-OE2 expression quantity is 260 times of control.Result above proves that experimental material used by this experiment is strictly OsMED25 gene overexpression.

OsMED25-GFP gene overexpression transgenic plant phenotypic analysis:

As shown in figure 14, it the plant height of OsMED25-GFP gene overexpression transgenic plant, Leaf angle, heading stage and compares OryzasativaLcv.Nipponbare is compared, and there is no generate significant change.

The detection of embodiment 13:OsMED25-GFP gene overexpression transgenic plant protein level

One, the OsMED25-GFP gene overexpression rotaring gene plant blade of growth 2 weeks is extracted, liquid nitrogen adds after being fully ground Enter SDS protein extract, 20mg tissue sample adds 100 μ L protein extraction buffer, is incubated for 30min on ice, every 10min acutely revolves Whirlpool oscillation once cracks albumen sufficiently, and 4 DEG C of centrifuge 12000rpm are centrifuged 10min, takes supernatant that 5 × loading is added Buffer, boils 10min, and 4 DEG C of centrifuge 12000rpm are centrifuged 10min, are placed in cooled on ice and wait for loading.

Two, the SDS-PAGE glue that preparation concentration is 8%, offset plate is installed in electrophoresis tank, and it is slow that 1 × glycine electrophoresis is added Fliud flushing first carries out electrophoresis with 80V voltage after loading, and it is 120V that voltage is changed after sample enters separation gel, to albumen loading After running out of offset plate, terminate electrophoresis, carries out transferring film.

Three, the clamping plate black in transferring film instrument is face-down, according to foam-rubber cushion-filter paper-glue-PVPP film-filter paper it is suitable Sequence is successively put well, is paid attention to there is not bubble generation in glue and PVPP film, after closing clamping plate, is placed in transferring film instrument, and transferring film liquid is added, It is placed in transferring film on ice, transferring film time 100V1h.

Four, after transferring film, PVPP film is dipped into transferring film liquid and impregnates 10min, is then put into confining liquid, is placed in and shakes Room temperature closes 1~2h on bed.It is then transferred in Anti-GFP antibody-solutions, shaking table is moved in low temperature chromatography cabinet, 4 DEG C overnight It is incubated for.

Five, next day is washed film 3 times, each 10min with BufferA solution, is then placed in 2~4h of incubation at room temperature in secondary antibody.With BufferA solution is washed film 3 times, each 10min, and luminol is enhanced agent solution and stable peroxide object solution equal proportion mixes, It is uniformly sprinkled upon on PVPP film with 1mL pipettor, after being incubated for 3~5min, is placed in the imaging of Full-automatic chemiluminescence image analysis system.

As shown in figure 15, OsMED25-GFP destination protein is able to detect that using Anti-GFP antibody, and compare OryzasativaLcv.Nipponbare The albumen that plant is extracted then can't detect any target stripe.

Embodiment 14:OsMED25 and the relationship analysis of OsBZR1 science of heredity

(1) by OsMED25 interference of transgene plant rice paddy seed and Osbzr1-D transgenic plant seed plate, 2~3 are grown Week left and right transplanting is set in potting bucket, short-day conditioned growth, illumination 10h, dark 14h.The Osbzr1-D transgenic plant is Article was published, seed is gifted by author.

(2) after rice plant is eared, it is female parent with Osbzr1-D plant, glume top half is cut before blooming, uses Tweezers carefully remove its stamen, award with OsMED25RNA interference of transgene plant pollen.

(3) Osbzr1-D transgenic plant is hybridized to the seed obtained with OsMED25RNA interference of transgene plant and is placed in 45 It is dried 3~5 days in DEG C thermostatic drying chamber, to break seed dormancy.Then it will be seeded in seedlings nursing plate after hybrid seed presoaking and germinating, At growth 2 weeks, extracts plant leaf DNA and RNA and identified.By firm correct offspring's transplanting in potting bucket, in rice Maturity period harvests seed.

(4) F2 of harvest is placed in 45 DEG C of thermostatic drying chambers for rice paddy seed and is dried 3~5 days, to break seed dormancy.So Presoaking and germinating is seeded into rice seeding tray afterwards, and carries out molecular level identification to Progeny plants.

As shown in figure 16, OsMED25-RNAi Osbzr1-D double-mutant plant plant height and Leaf angle phenotype are more nearly In OsMED25RNA interference of transgene plant, heading stage, Osbzr1-D transgenic plant Leaf angle reaches 90 degree, and OsMED25- The Leaf angle of RNAi Osbzr1-D double-mutant plant is close with OsMED25RNA interference of transgene plant Leaf angle, about 15 degree.Prove that OsMED25 is located at the science of heredity downstream of OsBZR1.

Embodiment 15:OsMED25-RNAi Osbzr1-D double-mutant plant BR sensitivity analysis

One, first to NP, OsMED25-RNAi, Osbzr1-D and OsMED25-RNAi Osbzr1-D after removal glume Plant rice paddy seed carries out disinfection processing, and 70% alcohol surface sterilization is primary, 30% hypochlorite disinfectant twice, each 20min, 28 DEG C of shaking table 120rpm are rinsed 4~5 times after outwelling sodium hypochlorite with sterilized distilled water.

As shown in figure 17, curve a indicates that Osbzr1-D, curve b indicate that NP, curve c indicate OsMED25-RNAi in Figure 17 Osbzr1-D, curve d indicate OsMED25-RNAi；In the case where being handled without BR, NP, OsMED25-RNAi and OsMED25- RNAi Osbzr1-D plant Leaf angle is almost upright, and only 10 degree or so, but Osbzr1-D Leaf angle has but obviously expanded , about 120 degree.With the increase of BR concentration for the treatment of, NP and Osbzr1-D Leaf angle is continuously increased, Osbzr1-D Leaf angle pair BR hypersensitization, and OsMED25-RNAi Osbzr1-D double-mutant Leaf angle variation tendency and OsMED25-RNAi single mutant It is close.When being handled using 1 μM of 24-epiBL, Osbzr1-D Leaf angle has been over 180 degree, and OsMED25-RNAi Osbzr1-D double-mutant Leaf angle is only 30 degree or so, and Osbzr1-D plant Leaf angle can be complete to the phenotype of BR hypersensitization Inhibited by OsMED25-RNAi.Illustrate that OsMED25 takes part in the regulation to rice leaf intersection angle of OsBZR1 mediation, missing OsBZR1 is unable to normally travel partial function after OsMED25 albumen.

Embodiment 16:OsMED25-RNAi Osbzr1-D double-mutant plant BR synthetic gene expression horizontal analysis

Extract NP, OsMED25-RNAi, Osbzr1-D and OsMED25-RNAi Osbzr1-D plant of growth 10 days RNA, reverse transcription utilize primers F 7 and R7, F8 and R8, F9 and R9 progress real-time fluorescence quantitative PCR detection after synthesizing cDNA.Reaction Condition is as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, totally 38 circulation, then 72 DEG C are prolonged Stretch 10min, calculation expression amount.Data are obtained from Bio-Rad chromo 4real-time PCRdetector；With 2^-△△CT Method analyzes multiple variation.

As shown in figure 18,1 expression NP in Figure 18,2 indicate OsMED25-RNAi, and 3 indicate Osbzr1-D, and 4 indicate OsMED25-RNAi Osbzr1-D.The expression quantity of 3 BR synthesis gene OsD2, OsD11 and OsDW are shown in Osbzr1-D plant Decline is write, is risen in OsMED25-RNAi plant, the table in Osbzr1-DOsMED25-RNAi double-mutant plant Control OryzasativaLcv.Nipponbare is closer to up to amount.Illustrate that OsMED25 takes part in the expression regulation of the BR synthesis gene of OsBZR1 mediation.

There is interaction in plant in embodiment 17:OsMED25 and OsBZR1

One, OsMED25 and OsBZR1 overall length is passed through into gateway system respectively and is cloned into entry vector pENTR/D-TOPO On, then pass through LR reaction forming to purpose carrier nGFP or cGFP.Agrobacterium strains GV3101 is converted after obtaining purpose plasmid, The Agrobacterium re-suspension liquid of purpose plasmid is mixed with both Agrobacterium re-suspension liquid containing p19 equal proportions.

Two, growth 4~5 weeks is chosen, is grown fine, the tobacco leaf of dark green leaf color, blade plumpness carries out Agrobacterium injection. An aperture is pricked on tobacco leaf with 1mL syringe needle first, then removes syringe needle, and bacterium solution is infused from tobacco leaf back It is mapped in tobacco leaf.

Three, 3 or more tobacco leafs are at least injected in each combination.48h after injection is carried out by laser confocal microscope The observation of GFP fluorescence.2h smears DAPI (4 ', the 6-diamidino-2- of 100ng/mL in injection site before observing Phenylindole) solution.

As shown in figure 19, interaction mainly occurs in nucleus for OsMED25 and OsBZR1.

Embodiment 18:OsMED25 is enriched in OsBZR1 target gene OsD2 promoter region and analyzes

One, OsMED25-GFP is overexpressed transgenic plant rice paddy seed and control OryzasativaLcv.Nipponbare rice paddy seed presoaking and germinating After be seeded into 96 hole PCR plates, every part of material sows 2 plates.Artificial climate incubator (model: RXZ0450；Light:14h, Dark:10h one time of nutrition liquid is changed in during which every 2 days in) 28 DEG C progress water planting culture 2~3 weeks.

Two, it is crosslinked: weighing 2g rice leaf tissue, shredded and be collected in 50mL centrifuge tube with scissors, 37mL crosslinking is added Buffer vacuumizes until rice leaf is dark green, and then addition 2.5mL 2M glycine, vacuumizes 5min to terminate crosslinking Reaction.It is rinsed vegetable material 3~5 times with distilled water, is layered on multilayer and considers on paper, sop up excessive moisture as far as possible.

Three, the sample after crosslinking is put into the mortar of Liquid nitrogen precooler by several times, liquid nitrogen is fully ground, by the sample after grinding Powder is transferred quickly in the 50mL pipe for filling the precooled nucleus extraction buffer of 25mL, slight to be vortexed, and ice bath 10~ 30min。

Four, in the off time of step 3,30 μ L Protein G magnetic beads are taken, 1mL Nuclei lysis buffer is added and washes It washs 3 times, after washing buffer is removed, 50 μ L cell karyorhexis extracting solutions and 3 μ L Anti-GFP antibody is added, are placed in mute Mixer, 4 DEG C of mixing are no less than 6h.Meanwhile the Protein G magnetic bead of antibody is not added as control.

Five, the liquid of step 3 is passed through into screen filtration into new 50mL pipe, discards residue, 4 DEG C of centrifugation 20min turn Fast 1940g.

Six, the supernatant of step 5 is carefully discarded, the nucleus extraction fluid of 1mL pre-cooling is added, bottom of the tube is precipitated outstanding It rises, moves in 1.5mL centrifuge tube, 4 DEG C of centrifugation 1min.Abandon supernatant, be added 1mL nucleus extraction fluid washing precipitating, 4 DEG C from Heart 1min.This step is repeated, until supernatant color is in light green.

Seven, 500 μ L cell karyorhexis extracting solutions are added in precipitating obtained by step 6, flick mixing, is sub-packed in two in equal volume In a 1.5mL centrifuge tube, bubble is not generated, otherwise influences ultrasonication efficiency.Bioruptor plus fully-automatic ultrasonic instrument Carry out ultrasonication, ultrasound condition: high frequency, 30s on, 30s off, it is 1 time, totally 6 times that 5, which are followed bad,.

Eight, by sample 4 DEG C of centrifugations 20min, revolving speed 12000rpm after ultrasonication, then absorption supernatant is incorporated in new In 1.5mL centrifuge tube.The deionized water and corresponding PMSF and PI of 2 times of volume pre-coolings, each sample will be added in gained supernatant Take 50 μ L as input, remaining sample average is distributed into the Protein G magnetic bead of step 4,4 DEG C of rotation mixing overnights.

Nine, the next morning, magnetic frame are collected Protein G magnetic bead, are washed 1 time with the less salt elution buffer of 1mL respectively, High salt elution buffer washs 1 time, and LiCl elution buffer washs 1 time, and TE buffer washs 2 times, each 2min.

Ten, remaining TE buffer is absorbed as far as possible, and the elution that 250 μ L65 DEG C preheating is added into Protein G magnetic bead is slow Fliud flushing, violent vortex concussion, 65 DEG C of water-bath 15min precipitate Protein G magnetic bead, supernatant are moved to new 1.5mL centrifuge tube In, repeat this step twice, supernatant is merged into same centrifuge tube.40 μ L 2.5M NaCl are added, 65 DEG C of solution crosslinkings are stayed overnight.

11,1 μ L 20mg/mL proteinase K (Roche), 20 μ L1M is added into the sample after solution crosslinking Tris (pH 6.5), 10 μ L0.5M EDTA, 45 DEG C of water-bath 1h.

12, isometric Tris is added and balances phenol, be vortexed and acutely mix, 4 DEG C of centrifugations 5min, revolving speed 12000g.It draws Supernatant is in new 1.5mL centrifuge tube.Isometric chloroform is added, is vortexed and acutely mixes, 4 DEG C of centrifugations 5min, revolving speed 12000g.It draws Supernatant is in new 1.5mL centrifuge tube.

13,1 μ L glycogen (20mg/mL) is added, the 3M NaAc (pH5.2) of 1/10 volume is eventually adding 2.5 times Volume dehydrated alcohol.It is vortexed and mixes, rear -80 DEG C of precipitating at least 1h.4 DEG C of centrifugation 10min, revolving speed 12000rpm are small with pipettor The heart removes supernatant, and 70% ethanol washing of 1mL precipitating, 4 DEG C of centrifugations 10min, revolving speed 12000rpm are added.Abandon supernatant, 12000rpm It is centrifuged 1min, supernatant is carefully absorbed with 10 μ L pipettors, is placed at room temperature for 5~10min and dries.It is water-soluble that 30~50 μ L deionizations are added Solve DNA precipitating.

14, the DNA obtained using step 13 utilizes primers F 10 and R10, F11 and R11, F12 and R12, F13 as template Real-time fluorescence quantitative PCR is carried out with R13, F14 and R14 and F15 and R15.Response procedures are as follows: 94 DEG C of initial denaturation 5min, and 94 DEG C It is denaturalized 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, totally 38 circulation, then 72 DEG C of extension 10min, calculation expression amount.

Forward primer F10:5'-TTACTACCCCTTCCTCCTCG-3'

Reverse primer R10:5'-TAGCTAGGCTCCTACGCAAG-3'

Forward primer F11:5'-ATCCATAATCCATTCCTCCC-3'

Reverse primer R11:5'-CCGAAAGTTAAACACCGATG-3'

Forward primer F12:5'-TAGGGACGAGTATGCGAACG-3'

Reverse primer R12:5'-ACCGGTCACCACCACCATAC-3'

Forward primer F13:5'-CGTCTCTACTCCCCCACTTG-3'

Reverse primer R13:5'-GAGGAGAGCAGAGCAGAGGA-3'

Forward primer F14:5'-CCAAGTGGTCCAAATGATGA-3'

Reverse primer R14:5'-GGATGATCAGGCGTACAGGA-3'

Forward primer F15:5'-CCTCGGACACCATCGACAACGTG-3'

Reverse primer R15:5'-CGCCCCCAAAGAACAGGAGCCTA-3'

As shown in figure 20, OsMED25 albumen can be in the BRRE motif richness of OsBZR1 target gene OsD2 promoter region Collection.

Embodiment 19: the influence of missing OsMED25 gene pairs OsBZR1 transcriptional activity

One, it chooses the 3rd leaf and is fully deployed period rice seedling, cut off root, strip external blade takes out innermost layer not The rice children's stem for developing into leaf, is placed on inverted culture dish and covers, and is cut into 0.5mm thin slice with blade, and the rice cut is thin Item is transferred to rapidly in the triangular flask for filling 0.6M D-Mannitol solution, is placed in 28 DEG C of 60~80rpm of constant-temperature table cultures 30min.During this period, enzyme solution is prepared, general 2 plate rice seedling takes around 10mL enzyme solution.By rice thin slice filter cloth (Miracloth) it filters, is transferred in sterilized 100mL triangular flask, prepared enzyme solution is added, by triangular flask masking foil It encases, is put into 28 DEG C of shaking tables, 60~80rpm digests 4~5h under dark condition.Then it is molten that the W5 isometric with enzyme solution is added Liquid firmly rocks 15s, sufficiently release protoplast.With W5 solution rinse strainer (35 μM, 100 mesh), by the protoplast of enzymatic hydrolysis It is filled into the 50mL pipe of sterilizing, then with a small amount of W5 solution flushing filtering net, sufficiently elutes the protoplast on strainer.450g is (big About 1500rpm) centrifugation 3min (noticing that adjustment lifting speed is 3), carefully remove supernatant.1mL W5 solution is added, plasm is resuspended Body, and 3min is centrifuged in 450g.After careful removal supernatant, protoplast is resuspended in MMg solution, makes final concentration of the 1 of cell ~5 × 10⁶cell/mL。

Two, the plasmid of 5~10 μ g mesh is added in 2mL centrifuge tube, 100 μ L protoplasts is then added, and gently Mixing is played in suction.110 μ L40%PEG are added, and soft mixing rapidly, do not make protoplast agglomerating.Be placed in 28 DEG C of water-baths 15~ 30min is added 1.8mLW5 solution and is resuspended, and terminates reaction, and 450g is centrifuged 3min.Supernatant is carefully absorbed with liquid-transfering gun, is then added Protoplast is resuspended in 750 μ LW5 solution.With liquid-transfering gun transfer protoplast into 24 porocyte culture plates, after being wrapped with tinfoil, It is placed in 28 DEG C of 12~16h of constant incubator culture.

Three, protoplast is drawn in 1.5mL centrifuge tube with liquid-transfering gun, 450g is centrifuged 3min, rice protoplast is collected, Careful removal supernatant, is added 80~100 μ L SDS lysates, and vortex oscillation is placed in 10min on ice, sufficiently cracking protoplast Albumen, 12000rpm are centrifuged 5min, draw isometric supernatant in 1.5mL centrifuge tube, pass through double luciferase report genes Detection kit carries out double luciferase report gene detections.80 μ L Fluc detection reagents are first added, after mixing It is put into measurement RLU value in microplate reader, 80 μ L Renilla luciferases detection buffer (Renilla luciferase) is then added, RLU value is measured after mixing.Using Renilla luciferase as internal reference, the RLU that is measured with Fluc The RLU value that value is measured divided by Renilla luciferase.According to obtained ratio come the different sample room purpose reporter genes of comparison Activation degree.

As shown in figure 21, the code area OsMED25 and OsBZR1 is connected respectively to the pRT107 carrier with 35S promoter It is upper to be used as effector plasmid, OsD2 promoter region is connected on II 0800 carrier of pGreen as report carrier.It is utilized respectively dragon Round-grained rice 11 and osmed25 mutant prepare rice protoplast, cotransformation pRT107-OsBZR1 and pGreen-OsD2 plasmid, by (1 indicates Control in Figure 22, and 2 indicate Effector) known to Figure 22, in imperial round-grained rice 11, OsBZR1 can significantly inhibit OsD2 Transcription, and under osmed25 mutant background, OsBZR1 loses the transcriptional repression activity to OsD2.As it can be seen that missing After OsMED25, OsBZR1 loses the inhibiting effect to target gene OsD2.Illustrate that OsMED25 influences the Transcription inhibition of OsBZR1 Activity.

The expression of embodiment 20:OsMED25 mediation OsBZR1 controlling gene

The total serum IgE for being extracted NP, Osbzr1-D and OsMED25-RNAi Osbzr1-D plant carries out transcript profile sequencing, turns Examining order is recorded to be completed by Beijing source Nuo Hezhi biological information Science and Technology Ltd..The original series that RNA-seq is sequenced (raw reads) is filtered, and carries out differential gene analysis after obtaining clean reads data.

As shown in figure 23 and figure 24, to differential gene and OsMED25-RNAi Osbzr1-D in Osbzr1-D vs NP Differential gene in vsOsbzr1-D is compared, and discovery has 1195 genes by the common up-regulated expression of OsBZR1 and OsMED25, That is OsMED25 participates in having activated the expression (Figure 23) of the OsBZR1 up-regulation gene of 45.6% (1195/2622).978 genes by OsBZR1 and OsMED25 lowers expression jointly, i.e. OsMED25 participates in inhibiting the OsBZR1 of 43.6% (978/2245) to lower base The expression (Figure 24) of cause.

Sequence table

<110>Northeast Institute of Geography and Agricultural Ecology, Chinese Academy of Sc

<120>rice mediator subunit OsMED25 gene, its coding albumen and its application

<160> 32

<210> 1

<211> 2529

<212> DNA

<213>Via-back puncture (Oryza sativa L. japonica. cv. Nipponbare)

<220>

<223>rice mediator subunit OsMED25 gene

<400> 1

atggcggcgg cggcggccga gaggcagctg gtggtggccg tggaggggac ggcggcgctg 60

gggccgtact ggcccgtcac cgtggcggac tacgtcgaga agatcgtgcg gagtttttgt 120

gcacatgaaa tggcaggaca gaagctcgca gggacacccc ctgaacttgc attagtcgtc 180

ttccataccc atggtcctta tagcgctttt tgtgtgcaac ggagtggatg gacaaaagat 240

atgaatgtgt ttctttcatg gttatctgga atatcattta gtggtggagg ctttagtgaa 300

gctgctattt ctgaaggtct tgctgaagca ttgatgatac tccaaggcag ttctagtaac 360

agtcagaatc atcaaagcca tgaagtacaa aaacattgca tacttgttgc agcaagtaat 420

ccttatccac tgcctacgcc tgtctaccgc ccccttgttc aaagtagcga tcacaaggag 480

aacaatgatg gagcaaaaga atcttgtctt gctgatgctg agactgttgc aaaatcattt 540

gctcagtgct ccgtttcatt gtcggtggta tctcctaaac agcttccaac tctgaaagca 600

atatacaatg cggcaaagag gaatcctcga gcggctgacc catcagtgga tcatgcaaaa 660

aatccacatt ttcttgtttt gttgtctgac aattttttgg aggctcgaac tgctctaagt 720

cgccctttac ctggcaactt ggtcacaaat caccccatta caaaaatgga tacagctgca 780

acatctgtgc cagtaccaac ttcaaatggc aacccctcag ttaatggacc tatgcttacc 840

cgccaaccaa atggtgttgt tgcaaatatt aaaacggagc caacaacttt accgcccatg 900

gtttctgcac ctgctttctc gcatgtaaca cctgttgcaa atggtgtttc acaaggatta 960

tcatcagtac aaagtccctc accgtccctt atttcacagg aaactaatct tgcaaatgat 1020

agtgtgcaag aacataagcc tttaataaac cctatccaac agtcaattcg acctggtggt 1080

ccagcaaatg tcagcatcct caacaatcta tcacagcatc ggtcagtggc aaccattata 1140

tcaggtggaa tgcctggcat ccctatgtct ggaacaggac agtcaattgg tagtcaacaa 1200

gtcgtacaaa acactgcttt tggatcaaac acacccataa caggcaattc aaatattgct 1260

gtgtcatctt ctttgggtgg catccaaagc aatatcggta tatcagggcc tcctgtgaca 1320

cagggaggtt caatgggtag tacgcaattg ggacaaggtg gaatcaatac aaaccaaaat 1380

atgataagta gccttgggac aacaactgtc tcttctgcac ctgcaatgat gccaacacca 1440

gggatggctc aacaggcagg tgtaaattct cttggtgtga ccaacagttc tgccatgaac 1500

atgcctatag tgcagcatcc taatgcgcag cagcagcaac agcaacagca acagcagcag 1560

cagcagcagc caccgccgaa gtacgtcaaa atttgggagg gaactttatc tgggcaaagg 1620

caaggacaac ctgtatttat ctgtaaactt gaaggttaca ggagtggaac agcatctgaa 1680

acacttgcag cagactggcc tgaaacaatg cagattgtgc gccttatagc tcaggagcat 1740

atgaacaata aacaatatgt tggaaaagca gactttctag tatttcggac attaaatcag 1800

cacggcttcc ttgggcaact gcaggaaaag aagctgtgcg cagtgattca actgccttcg 1860

caaactttgt tgttgtcagt gtcagacaaa gctgggcgcc tcattggcat gctgttccct 1920

ggggatatgg tggtgtttaa accgcaggta ccaacccagc agccaccaat gcagcaacaa 1980

cagttacaac agcagcagaa ccaactacaa cagcagaatc agctccacca gcagcaccag 2040

ctgcaaccac agaaccagct gcaacagcaa caccagctgc aacaacagtt acaacagcag 2100

caactacaac aacacatgca actgcagaca caaggccttc cgcttcagca gcagcaatcc 2160

caaggccatc cgcttcagca gcagcagatg cagcaaatgc agcaacaaca gcagcagcag 2220

cagattcagc aaatgcagca gcagcagcag atgcagcaga tgcaacagca gcagcagcag 2280

ccccaacagc ttcagcagca gcagcaaccg cagatggtcg gcacagggat ggggcagcag 2340

caaccacaga tggtcggcac ggggatgggg cagcagcaac cgcagatggt cggcgcaggg 2400

atggggcagc aatacatgca ggggcacggt aggacggtgc agcagatgat gcaagggaag 2460

atggcgccgc agggtccagg aagcatgccg ggtgcaggga gcatgcctgg gggtggctac 2520

ctatcttga 2509

<210> 2

<211> 842

<212> PRT

<213>Via-back puncture (Oryza sativa L. japonica. cv. Nipponbare)

<220>

<223>rice mediator subunit OsMED25 gene coded protein

<400> 2

Met Ala Ala Ala Ala Ala Glu Arg Gln Leu Val Val Ala Val Glu

5 10 15

Gly Thr Ala Ala Leu Gly Pro Tyr Trp Pro Val Thr Val Ala Asp

20 25 30

Tyr Val Glu Lys Ile Val Arg Ser Phe Cys Ala His Glu Met Ala

35 40 45

Gly Gln Lys Leu Ala Gly Thr Pro Pro Glu Leu Ala Leu Val Val

50 55 60

Phe His Thr His Gly Pro Tyr Ser Ala Phe Cys Val Gln Arg Ser

65 70 75

Gly Trp Thr Lys Asp Met Asn Val Phe Leu Ser Trp Leu Ser Gly

80 85 90

Ile Ser Phe Ser Gly Gly Gly Phe Ser Glu Ala Ala Ile Ser Glu

95 100 105

Gly Leu Ala Glu Ala Leu Met Ile Leu Gln Gly Ser Ser Ser Asn

110 115 120

Ser Gln Asn His Gln Ser His Glu Val Gln Lys His Cys Ile Leu

125 130 135

Val Ala Ala Ser Asn Pro Tyr Pro Leu Pro Thr Pro Val Tyr Arg

140 145 150

Pro Leu Val Gln Ser Ser Asp His Lys Glu Asn Asn Asp Gly Ala

155 160 165

Lys Glu Ser Cys Leu Ala Asp Ala Glu Thr Val Ala Lys Ser Phe

170 175 180

Ala Gln Cys Ser Val Ser Leu Ser Val Val Ser Pro Lys Gln Leu

185 190 195

Pro Thr Leu Lys Ala Ile Tyr Asn Ala Ala Lys Arg Asn Pro Arg

200 205 210

Ala Ala Asp Pro Ser Val Asp His Ala Lys Asn Pro His Phe Leu

215 220 225

Val Leu Leu Ser Asp Asn Phe Leu Glu Ala Arg Thr Ala Leu Ser

230 235 240

Arg Pro Leu Pro Gly Asn Leu Val Thr Asn His Pro Ile Thr Lys

245 250 255

Met Asp Thr Ala Ala Thr Ser Val Pro Val Pro Thr Ser Asn Gly

260 265 270

Asn Pro Ser Val Asn Gly Pro Met Leu Thr Arg Gln Pro Asn Gly

275 280 285

Val Val Ala Asn Ile Lys Thr Glu Pro Thr Thr Leu Pro Pro Met

290 295 300

Val Ser Ala Pro Ala Phe Ser His Val Thr Pro Val Ala Asn Gly

305 310 315

Val Ser Gln Gly Leu Ser Ser Val Gln Ser Pro Ser Pro Ser Leu

320 325 330

Ile Ser Gln Glu Thr Asn Leu Ala Asn Asp Ser Val Gln Glu His

335 340 345

Lys Pro Leu Ile Asn Pro Ile Gln Gln Ser Ile Arg Pro Gly Gly

350 355 360

Pro Ala Asn Val Ser Ile Leu Asn Asn Leu Ser Gln His Arg Ser

365 370 375

Val Ala Thr Ile Ile Ser Gly Gly Met Pro Gly Ile Pro Met Ser

380 385 390

Gly Thr Gly Gln Ser Ile Gly Ser Gln Gln Val Val Gln Asn Thr

395 400 405

Ala Phe Gly Ser Asn Thr Pro Ile Thr Gly Asn Ser Asn Ile Ala

410 415 420

Val Ser Ser Ser Leu Gly Gly Ile Gln Ser Asn Ile Gly Ile Ser

425 430 435

Gly Pro Pro Val Thr Gln Gly Gly Ser Met Gly Ser Thr Gln Leu

440 445 450

Gly Gln Gly Gly Ile Asn Thr Asn Gln Asn Met Ile Ser Ser Leu

455 460 465

Gly Thr Thr Thr Val Ser Ser Ala Pro Ala Met Met Pro Thr Pro

470 475 480

Gly Met Ala Gln Gln Ala Gly Val Asn Ser Leu Gly Val Thr Asn

485 490 495

Ser Ser Ala Met Asn Met Pro Ile Val Gln His Pro Asn Ala Gln

500 505 510

Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Pro Pro

515 520 525

Pro Lys Tyr Val Lys Ile Trp Glu Gly Thr Leu Ser Gly Gln Arg

530 535 540

Gln Gly Gln Pro Val Phe Ile Cys Lys Leu Glu Gly Tyr Arg Ser

545 550 555

Gly Thr Ala Ser Glu Thr Leu Ala Ala Asp Trp Pro Glu Thr Met

560 565 570

Gln Ile Val Arg Leu Ile Ala Gln Glu His Met Asn Asn Lys Gln

575 580 585

Tyr Val Gly Lys Ala Asp Phe Leu Val Phe Arg Thr Leu Asn Gln

590 595 600

His Gly Phe Leu Gly Gln Leu Gln Glu Lys Lys Leu Cys Ala Val

605 610 615

Ile Gln Leu Pro Ser Gln Thr Leu Leu Leu Ser Val Ser Asp Lys

620 625 630

Ala Gly Arg Leu Ile Gly Met Leu Phe Pro Gly Asp Met Val Val

635 640 645

Phe Lys Pro Gln Val Pro Thr Gln Gln Pro Pro Met Gln Gln Gln

650 655 660

Gln Leu Gln Gln Gln Gln Asn Gln Leu Gln Gln Gln Asn Gln Leu

665 670 675

His Gln Gln His Gln Leu Gln Pro Gln Asn Gln Leu Gln Gln Gln

680 685 690

His Gln Leu Gln Gln Gln Leu Gln Gln Gln Gln Leu Gln Gln His

695 700 705

Met Gln Leu Gln Thr Gln Gly Leu Pro Leu Gln Gln Gln Gln Ser

710 715 720

Gln Gly His Pro Leu Gln Gln Gln Gln Met Gln Gln Met Gln Gln

725 730 735

Gln Gln Gln Gln Gln Gln Ile Gln Gln Met Gln Gln Gln Gln Gln

740 745 750

Met Gln Gln Met Gln Gln Gln Gln Gln Gln Pro Gln Gln Leu Gln

755 760 765

Gln Gln Gln Gln Pro Gln Met Val Gly Thr Gly Met Gly Gln Gln

770 775 780

Gln Pro Gln Met Val Gly Thr Gly Met Gly Gln Gln Gln Pro Gln

785 790 795

Met Val Gly Ala Gly Met Gly Gln Gln Tyr Met Gln Gly His Gly

800 805 810

Arg Thr Val Gln Gln Met Met Gln Gly Lys Met Ala Pro Gln Gly

815 820 825

Pro Gly Ser Met Pro Gly Ala Gly Ser Met Pro Gly Gly Gly Tyr

830 835 840

Leu Ser

842

<210> 3

<211> 41

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F1

<400> 3

gttacttctgcactaggtaccatggcggcggcggcggccga 41

<210> 4

<211> 41

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R1

<400> 4

tcttagaattcccggggatccagataggtagccacccccag 41

<210> 5

<211> 41

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F2

<400> 5

ctctaaccttgagtacctatccggactacgtcgagaagatc 41

<210> 6

<211> 41

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R2

<400> 6

cgatcggggaaattcgagctcggtagacaggcgtaggcagt 41

<210> 7

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F3

<400> 7

gctgctatttctgaaggtct 20

<210> 8

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R3

<400> 8

gtaggcagtggataaggatt 20

<210> 9

<211> 24

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F4

<400> 9

ggcattagtcgtcttccataccca 24

<210> 10

<211> 24

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R4

<400> 10

aatcagcagaaggtatgggtcaaa 24

<210> 11

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F5

<400> 11

ggcgctttttgtgtgcaacggag 23

<210> 12

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R5

<400> 12

gaaaaacacacgttgcctccaaa 23

<210> 13

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F6

<400> 13

aaaagagcagcagttagcca 20

<210> 14

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R6

<400> 14

gaaaagaactgaacgatgcc 20

<210> 15

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F7

<400> 15

atggtgtggtggcgattggggtggttg 27

<210> 16

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R7

<400> 16

atgttgttccgccccaggatgtccagca 28

<210> 17

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F8

<400> 17

ggcgacattgagaagattgc 20

<210> 18

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R8

<400> 18

cagaaggcgatgacattgacc 21

<210> 19

<211> 17

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F9

<400> 19

cgctgacggagctgatg 17

<210> 20

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R9

<400> 20

acttgaggtgggaggacttg 20

<210> 21

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F10

<400> 21

ttactaccccttcctcctcg 20

<210> 22

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R10

<400> 22

tagctaggctcctacgcaag 20

<210> 23

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F11

<400> 23

atccataatccattcctccc 20

<210> 24

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R11

<400> 24

ccgaaagttaaacaccgatg 20

<210> 25

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F12

<400> 25

tagggacgagtatgcgaacg 20

<210> 26

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R12

<400> 26

accggtcaccaccaccatac 20

<210> 27

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F13

<400> 27

cgtctctactcccccacttg 20

<210> 28

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R13

<400> 28

gaggagagcagagcagagga 20

<210> 29

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F14

<400> 29

ccaagtggtccaaatgatga 20

<210> 30

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R14

<400> 30

ggatgatcaggcgtacagga 20

<210> 31

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>forward primer F15

<400>31

cctcggacaccatcgacaacgtg 23

<210> 32

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>reverse primer R15

<400> 32

cgcccccaaagaacaggagccta 23

Claims

1. rice mediator subunit OsMED25 gene, it is characterised in that in the nucleotide sequence of OsMED25 gene such as sequence table Shown in SEQ ID NO:1.

2. the amino acid sequence such as SEQ ID of the coding albumen of rice mediator subunit OsMED25 gene described in claim 1 Shown in NO:2.

3. application of the rice mediator subunit OsMED25 gene described in claim 1 in adjusting and controlling rice BR signal pathway.

4. application of the rice mediator subunit OsMED25 gene described in claim 1 in adjusting and controlling rice Leaf angle.

5. rice mediator subunit OsMED25 gene described in claim 1 is in the expression of adjusting and controlling rice BR synthesis gene Using.