CN110257536A - A kind of highly sensitive, rapid detection method the foundation and application of MTB new target drone mts90 - Google Patents
A kind of highly sensitive, rapid detection method the foundation and application of MTB new target drone mts90 Download PDFInfo
- Publication number
- CN110257536A CN110257536A CN201910587059.8A CN201910587059A CN110257536A CN 110257536 A CN110257536 A CN 110257536A CN 201910587059 A CN201910587059 A CN 201910587059A CN 110257536 A CN110257536 A CN 110257536A
- Authority
- CN
- China
- Prior art keywords
- mts90
- mtb
- dna
- detection
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention establishes highly sensitive, the rapid detection method of a kind of MTB new target drone mts90.The detection method carries out augmentation detection to mts90 based on RPA technology, and including the optimal primer using different method screening RPA amplification mts90 targets, design specific probe is measured in real time mts90.Using the genomic DNA of mts90 recombinant plasmid standard items, related mycobacteria and common causative as template, the sensitivity and specificity of this method are analyzed.And by detecting doubtful tuberculosis clinical sample, establishes Receiver operating curve and evaluate the accuracy of this method, while being compared and analyzed with the testing result of qPCR, evaluate the clinical application performance of the above method.Detection method of the invention does not depend on expensive instrument and equipment, it is easy to operate, it is at low cost, mts90 can rapidly, sensitively, specifically be detected, it is high with clinical detection result coincidence rate in detecting doubtful tuberculosis sample, can accurately, quickly detect MTB, with potential Clinical practicability, it is expected to the tool as screening earlier T B.
Description
Technical field
The present invention relates to detection of nucleic acids bioassay technique fields, more particularly to a kind of detection mycobacterium tuberculosis
(MTB) highly sensitive, rapid detection method the foundation and application of molecular target (mts90).
Background technique
The epidemic spreads of tuberculosis (Tuberculosis, TB) have seriously endangered public safe and healthy, especially exist
TB is high-incidence and the poor countries and regions of health resources.It, cannot be in time to morning due to lacking fast and accurately TB detection method
Phase TB carries out diagnoses and treatment, this exacerbates the propagation of epidemic situation, and may cause multidrug resistance bacterial strain, to delay control TB
Popular paces.Therefore, there is an urgent need to research and develop highly sensitive, quick TB diagnostic method.
In our early-stage study, it was found that a new M. tuberculosis mycobacteria (Mycobacterium
Tuberculosis, MTB) molecular target --- mts90, and about the detection method of mts90, that there are sensitivity is inadequate at present
The problems such as height, detection time is long and relies on expensive special equipment.Therefore, it is necessary to establish a kind of easily operated and not depend on
The method of highly sensitive, the quick detection mts90 of the energy of expensive instrument and equipment.
Summary of the invention
In view of the foregoing deficiencies of prior art, the purpose of the present invention is to provide a kind of MTB new target drone mts90's
Highly sensitive, rapid detection method foundation and application, for solve lack in the prior art fast and accurately TB detection method,
The problems such as MTB molecular target object detection method sensitivity is not high, time-consuming, equipment is expensive.
To achieve the above object and other related purposes, the present invention provide one kind based on RPA technology to mts90 into
The method of row augmentation detection, comprising: screen optimal primer, the sensitivity and specificity of analysis method, accuracy, evaluate simultaneously
The clinical application performance of this method.
Optionally, described to screen optimal primer according to RPA design scheme (the see Appendix of TwistDx company, Britain
At https: //www.twistdx.co.uk/en/support/rpa-assay-design-2) RPA primer and spy, are designed
Needle.
Optionally, the analysis method is with mts90 recombinant plasmid standard items, related mycobacteria and common causative
Genomic DNA is template, analyzes the sensitivity and specificity of this method.
Optionally, the accuracy of described evaluation this method includes establishing subject by detecting doubtful tuberculosis clinical sample
Performance curve (Receiver Operating Characteristic, ROC) and the accuracy for evaluating this method.
Optionally, the clinical application performance of described evaluation this method includes, while comparing with the testing result of qPCR
Analysis, evaluates the clinical application performance of this method.
Highly sensitive, rapid detection method the foundation and application of a kind of MTB new target drone mts90 provided by the present invention, packet
Include following steps:
(a) screening of primer and detection probe
Optionally, according to the RPA design scheme of TwistDx company, Britain, RPA primer and probe is designed.Wherein, primer
Amplicon contain the full sequence of MTB recruit's target mts90.
Optionally, for the purpose of detecting mts90 sequence, probe is designed.
Optionally, experiment screening is carried out to the secondary structure that have passed through primer and probe designed by on-line analysis, to contract
Small candidate drugs range.(the selection result: primers F: CCTCTGACCAGGCGACATAGACAACAGTACCC；R:
GTCGGTGAGCCATGCTTCGGCGTCGATCTTG；Probe P:CAGAGACGCAAATTCGGTCGCATCCGACAGT (FAM-
dT)(THF)AAC(BHQ-dT)CCGGCCGCTGGCAA G-Spacer C3)
(b) sensitivity analysis of mts90RPA detection method in real time
Optionally, the serial dilution of the mts90 plasmid standard of building is detected.
Optionally, 6 × 105~6 × 100The plasmid dilution of copies/ μ L concentration range can be expanded in 20min
Increase signal, the fluorescence signal after the plasmid template amplification of each reaction 6 minimum copies of concentration is apparently higher than blank control production
Raw background fluorescence signal
Optionally, repeatedly to the reaction retest (n >=3) of various concentration, the plasmid template of 6 copies is detected at 5 times
In obtain positive findings
Optionally, reaction starts that 8min or so is rear apparent positive amplification signal occurs, higher anti-of initial template concentration
It answers, the time for positive amplification occur is shorter
(c) the specificity analysis of mts90RPA detection method in real time
Optionally, relevant bacterial strain and some common respiratory pathogen genomic DNAs are extracted as template.
Optionally, using the plasmid of mts90 as positive control, discovery only observes the positive in MTB reference culture H37Rv
Amplified signal, and other bacterial strains have no positive amplification signal.
(d) the ROC curve analysis of the clinical sample of mts90RPA method in real time
Optionally, the clinical sample for collecting 45 Tuberculosis patients carries out DNA detection.
Optionally, ROC curve is established to the clinical sample testing result of real-time mts90RPA method, and carries out evaluation point
Analysis.
Optionally, the area under the curve of real-time mts90RPA detection method is 0.876 (0.754~0.998), with clinic
Inspection result compares, and the present invention is to diagnosis accuracy with higher lungy.
Optionally, the excellent diagnostics circle point of real-time mts90RPA detection method is determined using ROC curve.When cut-off value
When taking 378 fluorescence relative units, sensitivity and specificity are 96.4%, 76.5% respectively, accuracy at this time and
Youden ' s index is 88.9%, 0.729 respectively.
(e) the clinical sample detection performance comparative analysis of mts90RPA method in real time
Optionally, mts90qPCR detection and analysis are carried out to 45 clinical samples of collection.
Optionally, the sensitivity and specificity of qPCR detection method are 100% (28/28) and 88.2% (15/ respectively
17).The sensitivity (96.4%) of real-time mts90RPA method and specific (76.5%) are close with qPCR detection method.
Optionally, in the clinical sample of 27 equal test positive, the detection time mean value of qPCR detection method is
26.1min completes detection and needs 73min, and the detection time mean value of mts90RPA method is 11.8min in real time, entire to examine
Survey process can be completed in 20min.
Optionally, DNA microarray chip method clinically is basic with round pcr, but complex for operation step, single detection
At least need 6 hours.
Therefore, the present invention provides aforementioned the highly sensitive of MTB new target drone mts90, rapid detection methods in diagnosis of tuberculosis
In purposes.
The invention has the benefit that
(1) present invention establishes the real-time analysis method of highly sensitive, quick detection MTB new target drone mts90 of energy a kind of.It is first
First mts90 is expanded using RPA technology, which depends on recombinase, single-stranded DNA binding protein
(Single-stranded DNA-binding Protein, SSB) and strand displacement DNA polymerase.Under normal temperature conditions, they
Also active, optimal reaction temperature is 37 DEG C of degree left and right, and reaction temperature of this experiment by preliminary experiment selection is 39 DEG C.Draw
Object and recombinase combine the compound for forming DNA- albumen, and homologous sequence can be found in target.It is carried out after finding homologous sequence
Exchange reaction of chain simultaneously starts DNA synthesis, carries out amplification amplification to targeting regions.SSB and the DNA chain being replaced combine, and prevent
Further replaced.RPA realizes specific detection in combination with probe.When probe combination target sequence forms DNA double chain, tool
There is the Exonuclease III of DNA repair enzyme function that can identify gap and the cutting in the site THF, separates quenching group, release
Fluorescence signal.Entire augmentation detection process progress is very fast, achievable in 20 minutes.
(2) at the same time, the present invention has found the party by the serial dilution of the mts90 plasmid standard of detection building
The sensitivity of method is that each reaction can detecte the DNA profiling copied down to 6.
(3) in conclusion the present invention, which successfully constructs, can be used for detecting highly sensitive, the quick inspection of MTB new target drone mts90
Survey method.Using detection method of the invention, high sensitivity, specificity are good, steady to be shown to the measurement of MTB new target drone mts90
Fixed ability.Compared with the prior art, MTB new target drone mts90 detection method of the invention does not need special instrument, is applicable in
In current most of existing equipment of clinical labororatory, and operate quick and easy, high sensitivity, specific good and clinical identification
As a result be highly consistent, accuracy it is good.It can be used as the supplement of existing TB nucleic acid detection method, there is potential development to become screening early
Phase tool lungy is suitble to promote in the countries and regions that tuberculosis is high-incidence and health resources are poor.
Detailed description of the invention
Fig. 1 is the principle of the present invention figure.
Fig. 2 is electrophoresis analytical method figure, and F3/R2 primer pair amplifies effect is best as the result is shown.
Fig. 3 is that fluorescent dye real-time monitoring screens primer figure, as the result is shown the positive amplification and feminine gender of F3/R5 primer pair
Control area is most obvious.
Fig. 4 is the secondary structure on-line analysis result figure of 2 probes designed by the present invention.
Fig. 5 is that the present invention is tested with probe and compares different primers to the fluorescence signal intensity figure of generation.
Fig. 6 is to be compared test as template using the reference culture H37Rv of MTB to 3 pairs of different primers, is sieved by probe P2
The product band of the primer pair F3/R10 of choosing is most bright.
Fig. 7 is the sensitivity analysis result figure of the real-time RPA augmentation detection mts90 of the present invention.
Fig. 8 is the time diagram that the present invention obtains positive amplification with various concentration template.
Fig. 9 is specificity analysis result figure (real-time fluorescence detection) of mts90RPA method of the present invention.
Figure 10 is specificity analysis result figure (electrophoresis) of mts90RPA method of the present invention.
Figure 11 is the ROC curve figure of present invention detection clinical sample.
Figure 12 is the diagnostic figure of present invention detection clinical sample.
Figure 13 is the comparative analysis figure of real-time mts90RPA method and qPCR in detection clinical sample.
Figure 14 is time comparison diagram needed for real-time mts90RPA method and the clinical tuberculosis positive sample of qPCR detection.
Specific embodiment
Illustrate embodiments of the present invention below by way of specific specific example, those skilled in the art can be by this explanation
Other advantages and efficacy of the present invention can be easily understood for content disclosed by book.The present invention can also pass through in addition different tools
Body embodiment is embodied or practiced, and the various details in this specification can also not had based on different viewpoints and application
Various modifications or alterations are carried out under spirit of the invention.
It should be clear that the process equipment or device that do not indicate specifically in the following example are all made of conventional equipment in the art
Or device；All pressure values and range all refer to absolute pressure.
In addition, it should also be understood that, one or more method and step mentioned in the present invention does not repel before the combination step
Other methods step can also be inserted into there may also be other methods step or between these explicitly mentioned steps afterwards, is removed
It is non-to be otherwise noted；It should also be understood that the combination connection relationship between one or more equipment/devices mentioned in the present invention is not
Two for repelling there may also be other equipment/device before and after the unit equipment/device or specifically mentioning at these set
Other equipment/device can also be inserted between standby/device, unless otherwise indicated.Moreover, unless otherwise indicated, various method steps
Number be only identify various method steps convenient tool, rather than for limitation various method steps arrangement order or limit this hair
Bright enforceable range, relativeness are altered or modified, without material changes in technical content, when being also considered as
The enforceable scope of the present invention.
Embodiment 1 establishes highly sensitive, the rapid detection method of MTB new target drone mts90
1. materials and methods
1.1 material
RTaq archaeal dna polymerase and pMD19-T Vector Cloning Kit (Takara, Dalian, China), Plasmid
Mini kit (Omega Bio-Tek, USA), High Pure PCR Product Purification Kit (Roche,
Switzerland), TwistFpg kit andExo kit (TwistDx Inc., Cambridge, UK),
20×Dye (Biotum, USA).Other preparation of reagents: 1. LB liquid medium: by 1g sodium chloride, 0.5g ferment
Female extract and 10g tryptone are all dissolved in 100mL deionized water, adjust pH to 7.0, and room temperature is cooling after high pressure sterilization,
4 DEG C are placed in save backup.2. the preparation of the X-Gal selection agar plate of Amp resistance: in the LB liquid medium of every 100ml,
1.5g agar powder is added, when being cooled to about 40 DEG C after high pressure sterilization, is separately added into 100 μ L Amp solution (100mg/ml), 100
μ L IPTG (24mg/ml) and 200 μ L X-gal solution (20mg/ml), plate processed after mixing are placed in 4 DEG C and are kept in dark place.
1.2 detecting instrument
T100TM Thermal Cycler PCR instrument (Bio-Rad, USA), electrophoresis apparatus (6 1 instrument plants, China), coagulates
Glue imager (Bio-Rad, USA), NanoDrop 1000UV/Vis spectrophotometer (Thermo
Scientific, USA), fluorescence quantitative PCR instrument: Rotor Gene Q (Qiagen, Germany) and CFX ConnectTM
Real-time System (Bio-Rad, USA), constant water bath box (Rui Hua company, China), aseptic superclean bench (Suzhou
Purify Co., Ltd, China), centrifuge (Thermo scentific, USA), low-temperature and high-speed centrifuge (Heraeus,
Germany)。
1.3 testing principle
The present invention carries out the testing principle of augmentation detection using RPA technology to mts90.The amplification technique depends on
Recombinase, single-stranded DNA binding protein (Single-stranded DNA-binding Protein, SSB) and strand displacement DNA are poly-
Synthase.Under normal temperature conditions, they are also active, and optimal reaction temperature is 37 DEG C of degree left and right, and the present invention is selected by preliminary experiment
The reaction temperature selected is 39 DEG C.Primer and recombinase combine the compound for forming DNA- albumen, and homologous sequence can be found in target
Column.Exchange reaction of chain is carried out after finding homologous sequence and starts DNA synthesis, and amplification amplification is carried out to targeting regions.SSB and by
The DNA chain of replacement combines, and prevents from further being replaced.RPA realizes specific detection in combination with probe.When probe combines
When target sequence forms DNA double-strand, the Exonuclease III with DNA repair enzyme function can identify the gap in the site THF and cut
It cuts, separates quenching group, release fluorescence signal.Entire augmentation detection process carries out very fast, achievable in 20 minutes, original
Reason figure is as shown in Figure 1.
Highly sensitive, rapid detection method the use of 2.MTB new target drone mts90
(1) kit used based on the RPA of electrophoretic analysis result and fluorescent dye real-time monitoring reaction is Twistfpg kit(TwistDx Inc.)。
(2) the RPA reaction system based on electrophoretic analysis result is 50 μ L, first prepares 47.5 μ L premixs, including voluntarily
Upstream and downstream primer (10nM) each 2.1 μ L, the 29.5 μ L buffer of design, the template and ddH of 13.2 μ L2O。
(3) premix is added to reaction tube, aquation TwistAmp fpg lyophilized enzyme pellets,
Add 2.5 μ L magnesium acetate solutions (280mM) in pipe lid
(4) reaction mixture is quickly transferred to constant-temperature incubation 20min in 39 DEG C of water baths and completes reaction, and following adds
Sample operation is identical.
(5) the RPA reaction based on fluorescent dye real-time monitoring is executed in Rotor Gene Q, and the program of setting is:
39 DEG C of incubation 15s of each circulation, the channel Green read fluorescent value 5s, at least 60 circulation more than.
(6) wherein 50 μ L systems include each 2.1 μ L of upstream and downstream primer (10nM), 29.5 μ L buffer, and 2.5 μ L 20 ×Dye (Biotum), the template and ddH2O of 10.7 μ L, 2.5 μ L magnesium acetate solutions ((280mM).
(7) it is detected, is used using the real-time RPA of probeExo kit (TwistDx Inc.) reagent
Box.
(8) its system is 50 μ L, including each 2.1 μ L of upstream and downstream primer (10nM), 0.6 μ L probe (10nM), 29.5 μ L
Buffer, the template and ddH of 13.2 μ L2O, 2.5 μ L magnesium acetate solutions ((280mM).
(9) reaction mixture is quickly transferred to CFX ConnectTM Real-time System and carries out augmentation detection,
The program of setting is: 39 DEG C of incubation 15s of each circulation, and fluorescent value 5s is read in the channel FAM, totally 60 circulations.
(10) last obtained product uses electrophoretic analysis, that is, uses 2.5% Ago-Gel, the DNA of 500bp
Maker, the applied sample amount of sample are ultraviolet imagery analysis after 4 μ L, 120v × 25min~30min.Wherein, RPA amplified production
After the High Pure PCR Product Purification Kit kits of Roche company, then carry out electrophoresis
Analysis.
Highly sensitive, rapid detection method the sensitivity analysis of embodiment 2MTB new target drone mts90
In order to probe into whether the present invention can quickly obtain testing result, the mts90 plasmid that we are constructed by detection
The serial dilution of standard items analyzes the sensitivity of real-time mts90RPA detection method.As the result is shown by using the present invention, 6
×105~6 × 100The plasmid dilution of copies/ μ L concentration range can obtain amplified signal in 20min, and concentration is minimum
Each reaction 6 copy plasmid templates amplification after fluorescence signal be apparently higher than blank control reasons for its use fluorescence letter
Number, see Fig. 7.
We have carried out the reaction of various concentration test (n >=3) is repeated several times, wherein the plasmid template of 6 copies exists
Positive findings are obtained in 5 detections, reaction starts the rear apparent positive amplification signal of appearance of 8min or so, and starting template is dense
Higher reaction is spent, the time for positive amplification occur is shorter, as shown in Figure 8.The above result shows that the sensitivity of the inventive method
It is that each reaction can detecte the DNA profiling copied down to 6.
Highly sensitive, rapid detection method the specific analyzing molecules target mts90 of embodiment 2MTB new target drone mts90
Advantage with specific recognition MTB, and method established by the present invention in detection molecules target mts90 with important
Effect.Using the plasmid of mts90 as positive control, we only observe positive amplification signal in MTB reference culture H37Rv, and
Non- MTB bacterial strain in MTC includes BCG vaccine BCG and stomach and intestine mycobacteria as blank control, and positive expansion is not observed
Increase signal.Positive amplification signal is also had no in other bacteriums other than mycobacteria, sees Fig. 9.
Visible group of positive amplification signal: M. tuberculosis branch bar H37Rv (ATCC27294)
Invisible group of positive amplification signal: African mycobacterium tuberculosis (CMCC95049), stomach and intestine mycobacterium tuberculosis
(CMCC95006), mycobacterium bovis BCG vaccine, common respiratory pathogen (such as staphylococcus aureus, pneumonia
Streptococcus D39, pseudomonas aeruginosa and Escherichia coli)
The analysis of the accuracy of the clinical sample of the real-time mts90RPA method of embodiment 3
Currently, Receiver operating curve (Receiver Operating Characteristic, ROC) is analysis
Evaluate the standard method of diagnostic test.In order to assess real-time mts90RPA method clinical sample accuracy, with clinic mirror
Determining detection method is standard, establishes ROC curve to the clinical sample testing result of real-time mts90RPA method, and evaluated
Analysis.
DNA is carried out to the clinical sample of the Tuberculosis patient of collection with the real-time mts90RPA detection method of foundation
Detection, has detected altogether 45 clinical samples.The clinical identification of sample is the results show that there is 28 to reflect through DNA microarray chip method
It is set to the MTC positive, 1 is accredited as NTM, mycobacterium avium.There are 16 to be accredited as mycobacteria feminine gender through MGIT cultivation.It is real
When mts90RPA detection method area under the curve (Area Under the Cure, AUC) be 0.876 (0.754~0.998),
To diagnosis accuracy with higher lungy.The best of real-time mts90RPA detection method is determined using ROC curve simultaneously
Boundary's point is diagnosed, as shown in figure 11.
In summary evaluation index, real-time mts90RPA detection method established by the present invention have good detection quasi-
True property.
The clinical sample detection performance of the real-time mts90RPA method of embodiment 4 is analyzed
Molecular diagnostic techniques are fast-developing at present, wherein being clinically most widely used with round pcr.With clinic mirror
Determining detection method is standard, we are compared analysis to the detection performance of real-time mts90RPA method and qPCR method.To receipts
45 clinical samples of collection carry out qPCR detection and analysis, and the molecular target of amplification is still mts90.
The sensitivity and specificity of qPCR detection method are 100% (28/28) and 88.2% (15/17) respectively.In real time
The sensitivity (96.4%) of mts90RPA method and specific (76.5%) are close with qPCR detection method, as shown in figure 13.
However when detecting between on, real-time mts90RPA method possesses apparent advantage.Such as Figure 14, detected at 27
For in positive clinical sample, the detection time mean value of real-time mts90RPA method is 11.8min, and entire detection process can
It is completed in 20min, and the detection time mean value of qPCR detection method is 26.1min, completes detection and needs 73min.Clinically
DNA microarray chip method with round pcr basis, but complex for operation step, single detection at least needs 6 hours.
The above result shows that real-time mts90RPA method possesses sensitivity similar with qPCR, but easy to operate, detection
More quickly.
Claims (10)
1. a kind of highly sensitive, the rapid detection method of MTB new target drone mts90.Mts90 is carried out first based on RPA technology
Augmentation detection, the optimal primer of screening RPA amplification mts90 target, including design specific probe examine mts90 in real time
It surveys.Using the genomic DNA of mts90 recombinant plasmid standard items, related mycobacteria and common causative as template, this method is analyzed
Sensitivity and specificity.By detecting doubtful tuberculosis clinical sample, establishes Receiver operating curve and evaluate this method
Accuracy, while being compared and analyzed with the testing result of qPCR, evaluate the clinical application performance of this method.
2. the detection method of MTB new target drone mts90 according to claim 1, which is characterized in that designed RPA primer
Amplicon contains the full sequence of MTB recruit's target mts90.And for the purpose of detecting mts90 sequence, probe is designed.
3. the detection method of MTB new target drone mts90 according to claim 1, which is characterized in that primer and recombinase combine
The compound for forming DNA- albumen, can find homologous sequence in target.Exchange reaction of chain is carried out after finding homologous sequence and is opened
Targeting regions are carried out amplification amplification by the synthesis of beginning DNA.SSB and the DNA chain being replaced combine, and prevent from further being replaced.
RPA realizes specific detection in combination with probe.When probe combination target sequence forms DNA double chain, has the function of DNA repair enzyme
Exonuclease III can identify gap and the cutting in the site THF, separate quenching group, release fluorescence signal.
4. the detection method of MTB new target drone mts90 according to claim 1, which is characterized in that pass through detection building
The serial dilution of mts90 plasmid standard analyzes the sensitivity of real-time mts90RPA detection method.As the result is shown 6 × 105~
The plasmid dilution of 6 × 100copies/ μ L concentration range can obtain amplified signal in 20min, and it is anti-that each of concentration is minimum
Fluorescence signal after answering the plasmid template amplification of 6 copies is apparently higher than blank control reasons for its use fluorescence signal, shows this
The sensitivity of Fang Faming is that each reaction can detecte the DNA profiling copied down to 6.
5. the detection method of MTB new target drone mts90 according to claim 1, which is characterized in that some correlations out of MTC
Bacterial strain and some common respiratory pathogens in extract genomic DNA be used as template, analysis mts90RPA method it is special
Property.Using the plasmid of mts90 as positive control, we only observe positive amplification signal in MTB reference culture H37Rv, and MTC
Interior non-MTB bacterial strain includes BCG vaccine BCG and stomach and intestine mycobacteria as blank control, and positive amplification letter is not observed
Number.Positive amplification signal is also had no in other bacteriums other than mycobacteria.
6. the detection method of MTB new target drone mts90 according to claim 1, which is characterized in that the method is established main
Include the following steps:
(a) according to the design of the RPA design scheme of TwistDx company, Britain and synthetic primer and probe, the amplification of designed primer
Son contains the full sequence of MTB recruit's target mts90.And for the purpose of detecting mts90 sequence, probe is designed；It is set
The secondary structure of meter primer and probe all have passed through on-line analysis and experiment screening.
(b) bacterial genomes DNA is extracted using pyrolysis method, saved backup.
(c) mts90 plasmid standard is prepared, by preparing the E.coliDH5 α of competence, it is cloned and is identified, is finally extracted
Mts90 plasmid standard.
(d) it is expanded respectively using PCR system RPA system.
(e) electrophoretic analysis is carried out to corresponding amplified production.
7. according to the method described in claim 5, it is characterized in that, the primer and probe sequence of the step (a) all pass through
On-line analysis (http://www.nupack.org/) has been crossed, has then carried out experiment screening again.All primer and probes by
The synthesis of Sangon Biotech company (through screening, primers F: CCTCTGACCAGGCGACATAGACAACAGTACCC；R:
GTCGGTGAGCCATGCTTCGGCGTCGATCTTG；Probe P:CAGAGACGCAAATTCGGTCGCATCCGACAGT (FAM-dT)
(THF) combination of AAC (BHQ-dT) CCGGCCGCTGGCAAG-Spacer C3 is used for subsequent invention).
And/or in the step (b), bacterial genomes DNA, reaction condition are extracted using pyrolysis method are as follows: 100 DEG C of water-baths,
15min, then ice bath 10min.4 DEG C of 13000rpm are centrifuged 5min, and the genomic DNA that Aspirate supernatant is extracted as bacterium makes
With preceding remaining stored in -20 DEG C or less.
And/or in the step (c), the E.coliDH5 α of the preparation competence includes: the LB of 1ml DH5 α bacterium solution, 50ml
The pre-cooling CaCl2 solution mixing of fluid nutrient medium, 30ml, 50% glycerol.Reaction condition are as follows: bacterium solution is mixed with CaCl2 solution, ice
30min is bathed, supernatant is abandoned, is added CaCl2 solution and 50% glycerol, after ice bath 4h, -80 DEG C of preservations.
And/or in the step (c), it is described clone and identification include: the 1. target sequence containing mts90 DNA fragmentation: with standard bacteria
Strain M.tuberculosis H37Rv is template, and with the DNA fragmentation of a length of 461bp of PCR amplification, which contains mts90's
Full sequence.2. reaction condition are as follows: by 16 DEG C in water of mixed liquor, 30min.3. by above-mentioned connection liquid and competence DH5 α ice bath
5min.It is inoculated with 4. above-mentioned mixed liquor is coated on the X-Gal selection agar plate of Amp resistance, reaction condition are as follows: 37 DEG C, 18
~for 24 hours.5. white colony on picking plate is placed in the LB culture medium of Amp resistance and cultivates.Using bacterium solution as template, verified through PCR
It is sequenced and confirms with Chengdu TSINGKE Biological Technology company.
And/or in the step (c), the extraction of the mts90 plasmid standard includes: to train mts90 positive colony bacterium overnight
It supports, collects bacterium solution, extract plasmid using Plasmid Mini kit kit, measurement extracts the concentration of plasmid and calculates copy
Number, (6.02 × 1014 × ng/ μ L)/(length × 660 DNA) copies/ μ L=.Plasmid is carried out to 10 times of continuous multiple proportions
Dilution, obtains a series of mts90 plasmid standard of concentration gradients.
And/or in the step (d), PCR system: 2.5 μ L10 × PCR buffer, 1.5mM MgCl2,0.2mM dNTP,
0.2 μM of upstream and downstream primer, 2.5U rTaq archaeal dna polymerase, template, ddH2O, totally 25 μ L.The response procedures of PCR are as follows
(T100TM Thermal Cycler PCR, Bio-Rad): 94 DEG C of 5min, 94 DEG C of 30s, 63 DEG C of 30s, 72 DEG C of 15s expand 30
After circulation, 72 DEG C of extension 10min.
And/or in the step (d), RPA system: 50 μ L, including each 2.1 μ L of upstream and downstream primer (10nM), 0.6 μ L probe
(10nM), 29.5 μ L buffer, the template and ddH2O of 13.2 μ L, 2.5 μ L magnesium acetate solutions ((280mM).Reaction mixture quilt
It is quickly transferred to CFX ConnectTM Real-time System and carries out augmentation detection, the program of setting is: each circulation 39
DEG C be incubated for 15s, the channel FAM read fluorescent value 5s, totally 60 circulation.
And/or in the step (e), using 2.5% Ago-Gel, the DNA Maker of 500bp, the applied sample amount of sample is equal
It is analyzed for ultraviolet imagery after 4 μ L, 120v × 25min~30min.RPA amplified production uses the High Pure of Roche company
After PCR Product Purification Kit kits, then carry out electrophoretic analysis.
8. a kind of highly sensitive, the rapid detection system of MTB new target drone mts90, including as any one of claim 1~6 right is wanted
Ask the most suitable primer of screening and probe, sensitivity of analytical method and specificity.
9. a kind of method for detecting MTB new target drone mts90, for using the height as described in any one of claim 1~6 claim
Sensitive, rapid detection system detects the MTB new target drone mts90 in sample.
10. use of the detection method in detection MTB new target drone mts90 as described in any one of claim 1~6 claim
On the way.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910587059.8A CN110257536A (en) | 2019-07-01 | 2019-07-01 | A kind of highly sensitive, rapid detection method the foundation and application of MTB new target drone mts90 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910587059.8A CN110257536A (en) | 2019-07-01 | 2019-07-01 | A kind of highly sensitive, rapid detection method the foundation and application of MTB new target drone mts90 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110257536A true CN110257536A (en) | 2019-09-20 |
Family
ID=67923842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910587059.8A Pending CN110257536A (en) | 2019-07-01 | 2019-07-01 | A kind of highly sensitive, rapid detection method the foundation and application of MTB new target drone mts90 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257536A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111286551A (en) * | 2020-01-04 | 2020-06-16 | 昆明理工大学 | Primer and kit for rapidly detecting mycobacterium tuberculosis and using method thereof |
-
2019
- 2019-07-01 CN CN201910587059.8A patent/CN110257536A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111286551A (en) * | 2020-01-04 | 2020-06-16 | 昆明理工大学 | Primer and kit for rapidly detecting mycobacterium tuberculosis and using method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110541022B (en) | Mycobacterium tuberculosis complex detection kit based on CRISPR-Cas12a system | |
| Folgueira et al. | Detection of Mycobacterium tuberculosis DNA in clinical samples by using a simple lysis method and polymerase chain reaction | |
| CN109811072A (en) | CRISPR detection primer group and application thereof for mycobacterium tuberculosis complex | |
| Shah et al. | Allele-specific PCR method based on rfbS sequence for distinguishing Salmonella gallinarum from Salmonella pullorum: serotype-specific rfbS sequence polymorphism | |
| CN102533959A (en) | Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis | |
| CN102634575A (en) | Rapid identification method and kit of novel mycobacterium strain | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN109680083A (en) | A kind of primer sets, the method and its application of quick detection excrement Fusobacterium nucleatum | |
| CN102947467A (en) | Assays and kits for serotyping pseudomonas aeruginosa and oligonucleotide sequences useful in such methods and kits | |
| Matero et al. | Real‐time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis | |
| Zhang et al. | Loop-mediated isothermal amplification assay targeting the mpb70 gene for rapid differential detection of Mycobacterium bovis | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN109439781A (en) | For detecting the application of the Primer composition, kit and kit of clostridium difficile gene | |
| CN106434935B (en) | Compositions and methods for identifying Pasteurella multocida and/or Haemophilus parasuis | |
| Li et al. | Preliminary evaluation of rapid visual identification of Burkholderia pseudomallei using a newly developed lateral flow strip-based recombinase polymerase amplification (LF-RPA) system | |
| CN110408727A (en) | A kind of CPA primer sets, CPA nucleic acid test strip kit and its application detecting J subgroup avian leucosis virus | |
| Paton et al. | Methods for detection of STEC in humans: an overview | |
| CN110438205A (en) | Joint multiplex PCR nest-type PRC and touchdown PCR are used for the kit of pathogenic mycobacterium tuberculosis detection | |
| Xiao et al. | A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting | |
| CN110257536A (en) | A kind of highly sensitive, rapid detection method the foundation and application of MTB new target drone mts90 | |
| Si et al. | A LAMP-based system for rapid detection of eight common pathogens causing lower respiratory tract infections | |
| JP4899009B2 (en) | Clostridium difficile toxin B gene detection method using LAMP method and primer set used in this method | |
| KR101765677B1 (en) | Primer set for detection of mycobacterium tuberculosis and non-Tuberculosis mycobacteria and use thereof | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 | |
| Thenmozhi et al. | Development of species-specific primers for detection of Streptococcus pyogenes from throat swabs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190920 |