CN110257350B - Aldehyde ketone reductase BmAKR1, mutant and application thereof - Google Patents
Aldehyde ketone reductase BmAKR1, mutant and application thereof Download PDFInfo
- Publication number
- CN110257350B CN110257350B CN201910375807.6A CN201910375807A CN110257350B CN 110257350 B CN110257350 B CN 110257350B CN 201910375807 A CN201910375807 A CN 201910375807A CN 110257350 B CN110257350 B CN 110257350B
- Authority
- CN
- China
- Prior art keywords
- leu
- glu
- mutant
- val
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
Abstract
The invention relates to the field of biotechnology, and relates to aldehyde ketone reductase BmAKR1, a mutant and application thereof, wherein the mutant is obtained by carrying out mutation on wild Bacillus megaterium aldehyde ketone reductase 1 (Bacillus megaterium aldo-keto reductase 1, bmAKR 1), and the invention also relates to a preparation method of the aldehyde ketone reductase BmAKR1 and the mutant thereof. Also relates to a method for obtaining the optically active secondary alcohol compound with S or R configuration by catalyzing the reduction of ethyl benzoylformate by the aldehyde ketone reductase BmAKR1 and the mutant thereof. Compared with wild type, the mutant of the invention has improved activity and stereoselectivity, can catalyze the substrate to obtain optically pure chiral alcohol, and has good application value in the field of chiral alcohol preparation.
Description
Technical Field
The invention relates to the field of biotechnology, and relates to aldehyde ketone reductase BmAKR1, a mutant and application thereof, wherein the mutant is obtained by carrying out mutation on wild Bacillus megaterium aldehyde ketone reductase 1 (Bacillus megaterium aldo-keto reductase 1, bmAKR 1), and the invention also relates to a preparation method of the aldehyde ketone reductase BmAKR1 and the mutant thereof. Also relates to a method for obtaining the optically active S or R configuration secondary alcohol compound by catalyzing the reduction of ethyl benzoylformate through the aldehyde ketone reductase BmAKR1 and the mutant thereof.
Background
The alpha-keto ester compound is a compound with simple and special structure, has two carbonyl groups, and the optical alcohol compound obtained by reduction is widely applied to the fields of chemical industry and medicine as an important synthetic intermediate, for example, (R) -mandelate obtained by reduction is a raw material of a plurality of medicines such as semi-synthetic penicillin and cephalosporin and a synthetic intermediate of medicines such as ephedrine, cyclamate and the like. Precious metals are often used in the traditional reduction route of the alpha-keto ester, so that the production cost is increased, the pollution is large, the yield of products obtained by some reactions is low, and the post-treatment is complex. Compared with a chemical method, the biological method has the advantages of mild reaction conditions, high conversion rate, high enantioselectivity and the like, particularly, the application of the biocatalytic asymmetric carbonyl reduction reaction in chiral alcohol synthesis is more and more emphasized, and the aldehyde ketoreductase belonging to ketoreductase has application value in the reduction of alpha-keto ester.
Aldo Keto Reductases (AKRs) are a type that depends on NAD (P) + The oxidoreductase of (1), comprising more than 190 members. The structure is composed of (alpha/beta) 8 The structure comprises a barrel-shaped structure and a loop region, an active center consists of loop 4, loop 7 and loop C, and a catalytic active site comprises Tyr, asp, lys and His. The types of substrates that aldoketoreductase enzymes can catalyze include many, for example, furfural, steroids, prostaglandins, carbonyl compounds, ketonate compounds, and the like. The aldehyde ketone reductase from different genera can catalyze different types of substrates to obtain corresponding redox products with chiral centers, however, the aldehyde ketone reductase with high activity and stereoselectivity reported in the literature still accounts for a few times. Recently, the catalytic performance of aldehyde ketoreductase enzymes has been improved by modifying naturally occurring aldehyde ketoreductase enzymes through protein engineering, for example, by modifying the loop region of aldehyde ketoreductase enzymes, but there are still few successful examples. The need to discover and engineer aldoketoreductases to improve their catalytic performance is therefore pressing.
The aldehyde ketone reductase BmAKR1 which is obtained by gene mining and derived from bacillus megaterium in the laboratory shows poorer activity and stereoselectivity to ethyl benzoylformate in a wild state, the stereoselectivity of the enzyme is improved by rational design and directed protein evolution, the biocatalytic preparation of optically pure chiral alcohol is realized, and the application value is very important.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention provides the aldehyde ketone reductase BmAKR1 and a reductase mutant obtained by mutating the aldehyde ketone reductase, wherein the aldehyde ketone reductase BmAKR1 and the mutant can improve the enantioselectivity and the activity of the aldehyde ketone reductase to alpha-keto acid ester compounds, so that the route for obtaining the corresponding chiral alcohol by aldehyde ketone reductase reduction is efficient and feasible.
The invention provides aldehyde ketone reductase BmAKR1 which is determined as wild type bacillus megaterium aldehyde ketone reductase 1 through sequencing, and the sequence of the aldehyde ketone reductase is shown as SEQ ID NO. 1.
The invention also provides a mutant of the aldehyde ketone reductase with improved properties, which is obtained by mutation of the wild bacillus megaterium aldehyde ketone reductase 1 (BmAKR 1) gene (SEQ ID NO. 1), the enzyme is expressed in escherichia coli engineering bacteria, and the aldehyde ketone reductase and the mutant thereof can reduce alpha-keto acid ester compounds to obtain S or R configuration secondary alcohols with optical activity.
Further, the aldehyde ketone reductase gene is connected into an expression plasmid to obtain the recombinant aldehyde ketone reductase. The expression plasmid is: pET-28b-MBP.
The recombinant aldo-keto reductase comprises an amino acid sequence with at least 75% of identity with SEQ ID NO. 2.
Further, the present invention provides mutants of aldehyde-ketone reductase BmAKR1, which are obtained by mutating 24 or 112, or both 24 and 112 of recombinant aldehyde-ketone reductase (SEQ ID NO. 2).
The mutant of aldehyde ketone reductase BmAKR1 corresponds to the 24 th residue of SEQ ID NO.2 as a smaller amino acid residue, and the 112 th residue as a larger amino acid residue, and the amino acids are important for improving the activity and the enantioselectivity of the aldehyde ketone reductase.
The smaller amino acids involved in the present invention are Ala, ser, thr, val, ile and Leu, preferably serine (Ser); the larger amino acid residues involved are Pro, phe, try, leu, preferably phenylalanine (Phe).
In some embodiments of the invention, the aldoketoreductase mutants containing mutations that exhibit higher activity and stereoselectivity for alpha-ketonate compounds comprise one or two mutations, i.e., a 24-position or 112-position mutation, or a 24-position and 112-position simultaneous mutation, wherein the 24-position mutation of the amino acid sequence is Ser; 112 th amino acid sequence is mutated into Phe.
The amino acid sequence of the aldone reductase mutant is preferably shown in SEQ ID NO.4,6 and 8.
Embodiments of the invention include nucleic acids encoding the aldo-keto reductase mutants having at least 75% sequence identity to the nucleic acid sequence encoding the BmAKR1 mutant of the invention.
The sequence of the nucleic acid capable of coding the mutant is shown in SEQ ID NO.3,5 and 7.
Related embodiments of the invention also include vectors comprising these nucleic acids and host cells comprising such vectors.
The invention also provides application of the aldehyde ketone reductase and the mutant thereof in reduction of alpha-keto acid ester compounds. The wild aldehyde ketone reductase BmAKR1 and the mutant thereof, or the cell containing the wild or mutant enzyme can be used as a catalyst to catalyze the asymmetric reduction of alpha-keto acid ester compounds to obtain corresponding optical pure chiral products.
The alpha-keto acid ester compound preferably has a structure shown in (II):
R 1 is C1-C4 alkyl or phenyl;
R 2 is C1-C4 alkyl;
the preferred structure is as follows:
one embodiment of the present invention provides a method for asymmetrically reducing an α -keto acid ester compound, comprising:
in a phosphate buffer solution of pH5-7, in the presence of glucose dehydrogenase, glucose and NADP + In the presence of aldehyde ketone reductase or its mutant, reducing alpha-keto acid ester compound to produce optically active chiral secondary alcohol.
The aldone reductase or its mutant is 0.02-40g/L, glucose dehydrogenase is 0.01-5g/L, glucose is 6-200g/L, and NADP + The dosage is 0.1-0.5mmol, the concentration of the alpha-ketonic acid ester compound is 3-100g/L, the buffer solution is phosphate buffer solution with pH of 5-7, and the reaction temperature is 30-40 ℃.
The aldehyde ketone reductase or the mutant thereof can exist in various forms such as cells, crude enzyme powder, enzyme solution, immobilized enzyme and the like in various feasible ways.
The invention has the beneficial technical effects that: compared with a naturally-existing ketoreductase wild type, the activity and enantioselectivity of the aldehyde ketoreductase mutant on alpha-ketonate compounds are reversed and improved by mutating bacillus megaterium aldehyde ketoreductase 1 (BmAKR 1).
Drawings
FIG. 1 shows the construction of genes of wild-type aldone reductase BmAKR1 and its mutant enzyme and recombinant expression vector containing the genes.
FIG. 2 shows the HPLC detection result of the aldehyde ketone reductase BmAKR1 mutant enzyme catalyzing the reduction of the substrate 1 a;
sub1: substrate 1a control; rac-1: comparing the product racemate; HPLC detection result of the wild type Y24S mutant (SEQ ID NO. 4); HPLC detection result of wild type Y24S-W112F double-site mutant (SEQ ID NO. 8).
Detailed Description
The aldehyde ketone reductase mutant of the present invention and the reduction of α -keto acid esters using the enzyme are described below by way of specific embodiments. Unless otherwise indicated, the protocols used in the present invention are well known to those skilled in the art. Furthermore, the examples are to be construed as illustrative, and not restrictive.
Definitions of certain terms.
Asymmetric reduction is a method for reducing prochiral compounds to obtain optically pure corresponding reduction products, and in the invention, aldehyde ketone reductase catalyzes alpha-keto ester compounds to selectively obtain corresponding alcohols with S or R configuration.
Enantiomeric excess is defined as the amount of one isomer a in an enantiomeric mixture which is more abundant than the other isomer B in the total amount, abbreviated ee, and is expressed by the formula (a-B)/(a + B) × 100%, and the enantiomeric excess is used to indicate the optical purity of a chiral compound. The higher the ee value, the higher the optical purity.
The 20 amino acids are abbreviated as follows
Asp D aspartic acid Ile I isoleucine
Thr T threonine Leu L leucine
Ser S serine Tyr Y tyrosine
Glu E glutamic acid Phe F phenylalanine
Pro P proline His H histidine
Gly G Glycine Lys K lysine
Ala A alanine Arg R arginine
Cys C cysteine Trp W Tryptophan
Val V valine Gln Q Glutamine
Met M methionine Asn N asparagine
The amino acids are classified into larger and smaller amino acids according to the steric hindrance of amino acid side chain groups, the smaller amino acids involved in the invention are Ala, ser, thr, val, ile and Leu, and the larger amino acid residues are Pro, phe, try and Leu.
The examples relate to the formulation of the culture medium.
LB liquid medium: 0.5% yeast extract, 1% peptone and 1% sodium chloride (for example, preparing solid medium, adding 1.5% agar before sterilization), and autoclaving at 115 deg.C for 30min.
Example 1 extraction of Bacillus megaterium genomic DNA
After the bacillus megatherium is cultured by LB liquid overnight, the fermentation liquor is centrifuged for 5min by 3000r/min in a 1mL centrifuge tube, the supernatant is discarded to collect the bacteria, and the steps can be repeated for several times to obtain enough cells; b) Extracting the bacillus megaterium genome according to the operation instruction of the bacterial genome DNA extraction kit.
Example 2 cloning of wild-type BmAKR1 Gene
The PCR reaction was carried out using the Bacillus megaterium genomic DNA obtained in example 1 as a template, and the reaction system was as follows:
and (3) amplification procedure: 94 ℃ below zero: 10min (94 ℃ 30s,45 ℃ 30s,72 ℃ 30 s) for 30 cycles, 72 ℃ for 10min.
Primer 1: bmAKR1-EcoR I-F: CCGGAATTCGATGGAAAACTTACAGTCA；
Primer 2: bmAKR1-Xho I-R: CCGCTCGAGAAAGTCAAAGTTATCTGG；
Restriction sites are underlined;
the DNA fragment obtained by PCR amplification was purified with a gel recovery kit. E.coli DH 5. Alpha. Containing pET28b MBP Plasmid was cultured overnight in LB broth at 37 ℃ and 220r/min, and Plasmid extraction was performed using the reference TIANPrep Mini Plasmid Kit.
The target fragment and the plasmid pET28b MBP plasmid are subjected to restriction enzyme digestion, and the restriction enzyme digestion system is as follows:
and recovering fragments of the enzyme digestion product by using a gel recovery kit, and connecting the fragments by using T4 ligase.
Example 3 E.coli Rosetta (DE 3) preparation and transformation of competent cells
a) Taking 0.4mL of the seed culture medium, inoculating the seed culture medium into 20mL of LB liquid culture medium, and culturing for 3h; b) 2mL of thalli are enriched in two times at 3000r/min for 5min in a 1.5mL EP tube, and the supernatant is discarded; c) Adding 100 μ l ice-cold TSS solution, re-suspending thallus, ice-cooling for 30min; d) Adding 20 μ L of the connecting solution, gently rotating and mixing, and performing ice bath for 30min; e) The mixture was heat-shocked at 42 ℃ for 60s, ice-washed for 2min, and 600. Mu.L of LB liquid medium was added. Culturing at 37 ℃, and performing shaking culture at 150r/min for 1h; f) 150 μ L of each was spread on LB-resistant plates.
EXAMPLE 4 construction of mutants
The construction of the mutant pools was performed by overlap extension PCR using the mutant primers and flanking primers. (designed mutation primers are as follows:.)
PCR amplification conditions: 94 ℃ below zero: 10Min (94 ℃ 30s,45 ℃ 30s,72 ℃ 30 s) 35 cycles, 72 ℃: for 10min. The resulting gene fragment was purified and amplified by PCR as follows
The fragment of interest was obtained by PCR as described in example 2 and ligated into pET28b MBP vector and transformed into e.coli Rosetta (DE 3) as described in example 3. Respectively obtaining wild aldehyde ketone reductase BmAKR1 and mutants thereof.
Example 5 mutant expression
a) Inoculating a single colony in 4ml of a kanamycin-resistant LB liquid culture medium, and culturing at 37 ℃ and 200rpm for 6 hours to obtain a seed solution; b) Inoculating 20 μ l seed solution into 20ml LB liquid culture medium with kanamycin resistance, culturing at 37 deg.C and 200rpm until OD600 of the culture solution reaches 0.8-1.0, adding 0.5mM IPTG, and cooling to 20 deg.C for inducing expression for 20 hr; c) Collecting thallus by centrifuging culture solution at 4000rpm × 15min, washing twice with normal saline, reselecting thallus with 0.1M pH6.0 sodium phosphate buffer solution, adding lysozyme with final concentration of 1mg/ml, crushing at 30 deg.C and 200rpm for 1h, centrifuging at 4 deg.C and 10000rpm, collecting supernatant, and screening.
Example 6 expression of glucose dehydrogenase
Coli Rosetta (DE 3) containing the pET22b-GDH plasmid was expressed as described in example 5 to obtain glucose dehydrogenase.
Example 7 catalytic reduction of crude enzyme solution
Typical substrates referred to in this example are shown below:
reaction system: the supernatants as described in examples 5 and 6 were mixed together in 450. Mu.l portions, to a final concentration of 0.3mM NADP +,8mg glucose, 4mg substrate (100. Mu.l methanol solubilization), reacted at 30 ℃ for 6 hours; extracted three times with equal volumes of ethyl acetate.
Example 8 high performance liquid phase analysis of substrates and products
The conditions for detecting the substrate 1a and the product are as follows: a chromatographic column: OD-H, mobile phase: n-hexane: isopropanol =98, flow rate: 0.8ml/min, wavelength: 254nm, column temperature: 25 ℃, detector: and a UV detector.
EXAMPLE 9 determination of the Selectivity of the wild-type Y24S mutant (SEQ ID NO. 4) for the substrate 1a
a) Conversion [% ]; b) Reduction product alcohol enantiomer excess (ee%); c) Absolute configuration of reduction product alcohol
NA-No activity was detected.
The liquid phase diagram of the catalytic substrate 1a of SEQ ID NO.4 is shown in FIG. 2.
EXAMPLE 10 determination of the Selectivity of the wild-type Y24S-W112F double-site mutant (SEQ ID NO. 8) for the substrate 1a
a) Conversion [% ]; b) Reduction product alcohol enantiomer excess (ee%); c) Absolute configuration of reduction product alcohol
NA No activity was detected.
The liquid phase diagram of the catalytic substrate 1a of SEQ ID NO.8 is shown in FIG. 2.
Sequence listing
<110> Shenyang university of pharmacy
<120> aldehyde ketone reductase BmAKR1, mutant and application thereof
<141> 2019-01-08
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 825
<212> DNA
<213> Bacillus megaterium
<400> 1
atggaaaact tacagtcaac gacgacctta gcaaacggcg ttaaaatgcc ttggttaggt 60
ttaggtgttt ataaagtaga agatggtcaa gaagttgtag attcagttaa atatgcaatc 120
aaagctggat ataaaagcat tgatacggct aaaatttatg aaaatgaaga aggcgtggga 180
caagcgatca aagaatcagg tgtttctcgc gaagaactat ttgttacatc aaaagtgtgg 240
aatgcagatc aaggatatga cacaactctt caagcgtttg aaacaagctt aaacaagctg 300
ggtcttgaat atttagattt atacttaatt cactggccag ttcaaggtaa gtataaagat 360
acgtggaaag cacttgaaaa gctttataaa gacgggaaaa ttcgtgcaat cggcgtatcg 420
aatttccaag ttcatcattt agaagactta attgcagatg cagaagtcaa gccgatggta 480
aaccaaatcg aatttcatcc acttttaaca caaacagaag tgcgtgaata ctgcaaaaaa 540
caaggaatcc aagtggaagc atggtcaccg cttgcacaag gtgagctgct tgataacgaa 600
gtgttaactc aaattgctga aaagcacgga aaatcaactg ctcaagttat cttacgttgg 660
gacttacaaa acgaagtagt aactattcct aagtcaacaa aagaacatcg tattatccaa 720
aatgcagacg tatttgattt tgaattaaat gcagaagaag ttgaaaaaat taacgcatta 780
aatcaaaatc atcgcgtagg tccagatcca gataactttg acttt 825
<210> 2
<211> 275
<212> PRT
<213> Bacillus megaterium
<400> 2
Met Glu Asn Leu Gln Ser Thr Thr Thr Leu Ala Asn Gly Val Lys Met
1 5 10 15
Pro Trp Leu Gly Leu Gly Val Tyr Lys Val Glu Asp Gly Gln Glu Val
20 25 30
Val Asp Ser Val Lys Tyr Ala Ile Lys Ala Gly Tyr Lys Ser Ile Asp
35 40 45
Thr Ala Lys Ile Tyr Glu Asn Glu Glu Gly Val Gly Gln Ala Ile Lys
50 55 60
Glu Ser Gly Val Ser Arg Glu Glu Leu Phe Val Thr Ser Lys Val Trp
65 70 75 80
Asn Ala Asp Gln Gly Tyr Asp Thr Thr Leu Gln Ala Phe Glu Thr Ser
85 90 95
Leu Asn Lys Leu Gly Leu Glu Tyr Leu Asp Leu Tyr Leu Ile His Trp
100 105 110
Pro Val Gln Gly Lys Tyr Lys Asp Thr Trp Lys Ala Leu Glu Lys Leu
115 120 125
Tyr Lys Asp Gly Lys Ile Arg Ala Ile Gly Val Ser Asn Phe Gln Val
130 135 140
His His Leu Glu Asp Leu Ile Ala Asp Ala Glu Val Lys Pro Met Val
145 150 155 160
Asn Gln Ile Glu Phe His Pro Leu Leu Thr Gln Thr Glu Val Arg Glu
165 170 175
Tyr Cys Lys Lys Gln Gly Ile Gln Val Glu Ala Trp Ser Pro Leu Ala
180 185 190
Gln Gly Glu Leu Leu Asp Asn Glu Val Leu Thr Gln Ile Ala Glu Lys
195 200 205
His Gly Lys Ser Thr Ala Gln Val Ile Leu Arg Trp Asp Leu Gln Asn
210 215 220
Glu Val Val Thr Ile Pro Lys Ser Thr Lys Glu His Arg Ile Ile Gln
225 230 235 240
Asn Ala Asp Val Phe Asp Phe Glu Leu Asn Ala Glu Glu Val Glu Lys
245 250 255
Ile Asn Ala Leu Asn Gln Asn His Arg Val Gly Pro Asp Pro Asp Asn
260 265 270
Phe Asp Phe
275
<210> 3
<211> 825
<212> DNA
<213> Bacillus megaterium
<400> 3
atggaaaact tacagtcaac gacgacctta gcaaacggcg ttaaaatgcc ttggttaggt 60
ttaggtgtta gcaaagtaga agatggtcaa gaagttgtag attcagttaa atatgcaatc 120
aaagctggat ataaaagcat tgatacggct aaaatttatg aaaatgaaga aggcgtggga 180
caagcgatca aagaatcagg tgtttctcgc gaagaactat ttgttacatc aaaagtgtgg 240
aatgcagatc aaggatatga cacaactctt caagcgtttg aaacaagctt aaacaagctg 300
ggtcttgaat atttagattt atacttaatt cactggccag ttcaaggtaa gtataaagat 360
acgtggaaag cacttgaaaa gctttataaa gacgggaaaa ttcgtgcaat cggcgtatcg 420
aatttccaag ttcatcattt agaagactta attgcagatg cagaagtcaa gccgatggta 480
aaccaaatcg aatttcatcc acttttaaca caaacagaag tgcgtgaata ctgcaaaaaa 540
caaggaatcc aagtggaagc atggtcaccg cttgcacaag gtgagctgct tgataacgaa 600
gtgttaactc aaattgctga aaagcacgga aaatcaactg ctcaagttat cttacgttgg 660
gacttacaaa acgaagtagt aactattcct aagtcaacaa aagaacatcg tattatccaa 720
aatgcagacg tatttgattt tgaattaaat gcagaagaag ttgaaaaaat taacgcatta 780
aatcaaaatc atcgcgtagg tccagatcca gataactttg acttt 825
<210> 4
<211> 275
<212> PRT
<213> Bacillus megaterium
<400> 4
Met Glu Asn Leu Gln Ser Thr Thr Thr Leu Ala Asn Gly Val Lys Met
1 5 10 15
Pro Trp Leu Gly Leu Gly Val Ser Lys Val Glu Asp Gly Gln Glu Val
20 25 30
Val Asp Ser Val Lys Tyr Ala Ile Lys Ala Gly Tyr Lys Ser Ile Asp
35 40 45
Thr Ala Lys Ile Tyr Glu Asn Glu Glu Gly Val Gly Gln Ala Ile Lys
50 55 60
Glu Ser Gly Val Ser Arg Glu Glu Leu Phe Val Thr Ser Lys Val Trp
65 70 75 80
Asn Ala Asp Gln Gly Tyr Asp Thr Thr Leu Gln Ala Phe Glu Thr Ser
85 90 95
Leu Asn Lys Leu Gly Leu Glu Tyr Leu Asp Leu Tyr Leu Ile His Trp
100 105 110
Pro Val Gln Gly Lys Tyr Lys Asp Thr Trp Lys Ala Leu Glu Lys Leu
115 120 125
Tyr Lys Asp Gly Lys Ile Arg Ala Ile Gly Val Ser Asn Phe Gln Val
130 135 140
His His Leu Glu Asp Leu Ile Ala Asp Ala Glu Val Lys Pro Met Val
145 150 155 160
Asn Gln Ile Glu Phe His Pro Leu Leu Thr Gln Thr Glu Val Arg Glu
165 170 175
Tyr Cys Lys Lys Gln Gly Ile Gln Val Glu Ala Trp Ser Pro Leu Ala
180 185 190
Gln Gly Glu Leu Leu Asp Asn Glu Val Leu Thr Gln Ile Ala Glu Lys
195 200 205
His Gly Lys Ser Thr Ala Gln Val Ile Leu Arg Trp Asp Leu Gln Asn
210 215 220
Glu Val Val Thr Ile Pro Lys Ser Thr Lys Glu His Arg Ile Ile Gln
225 230 235 240
Asn Ala Asp Val Phe Asp Phe Glu Leu Asn Ala Glu Glu Val Glu Lys
245 250 255
Ile Asn Ala Leu Asn Gln Asn His Arg Val Gly Pro Asp Pro Asp Asn
260 265 270
Phe Asp Phe
275
<210> 5
<211> 825
<212> DNA
<213> Bacillus megaterium
<400> 5
atggaaaact tacagtcaac gacgacctta gcaaacggcg ttaaaatgcc ttggttaggt 60
ttaggtgttt ataaagtaga agatggtcaa gaagttgtag attcagttaa atatgcaatc 120
aaagctggat ataaaagcat tgatacggct aaaatttatg aaaatgaaga aggcgtggga 180
caagcgatca aagaatcagg tgtttctcgc gaagaactat ttgttacatc aaaagtgtgg 240
aatgcagatc aaggatatga cacaactctt caagcgtttg aaacaagctt aaacaagctg 300
ggtcttgaat atttagattt atacttaatt cactttccag ttcaaggtaa gtataaagat 360
acgtggaaag cacttgaaaa gctttataaa gacgggaaaa ttcgtgcaat cggcgtatcg 420
aatttccaag ttcatcattt agaagactta attgcagatg cagaagtcaa gccgatggta 480
aaccaaatcg aatttcatcc acttttaaca caaacagaag tgcgtgaata ctgcaaaaaa 540
caaggaatcc aagtggaagc atggtcaccg cttgcacaag gtgagctgct tgataacgaa 600
gtgttaactc aaattgctga aaagcacgga aaatcaactg ctcaagttat cttacgttgg 660
gacttacaaa acgaagtagt aactattcct aagtcaacaa aagaacatcg tattatccaa 720
aatgcagacg tatttgattt tgaattaaat gcagaagaag ttgaaaaaat taacgcatta 780
aatcaaaatc atcgcgtagg tccagatcca gataactttg acttt 825
<210> 6
<211> 275
<212> PRT
<213> Bacillus megaterium
<400> 6
Met Glu Asn Leu Gln Ser Thr Thr Thr Leu Ala Asn Gly Val Lys Met
1 5 10 15
Pro Trp Leu Gly Leu Gly Val Tyr Lys Val Glu Asp Gly Gln Glu Val
20 25 30
Val Asp Ser Val Lys Tyr Ala Ile Lys Ala Gly Tyr Lys Ser Ile Asp
35 40 45
Thr Ala Lys Ile Tyr Glu Asn Glu Glu Gly Val Gly Gln Ala Ile Lys
50 55 60
Glu Ser Gly Val Ser Arg Glu Glu Leu Phe Val Thr Ser Lys Val Trp
65 70 75 80
Asn Ala Asp Gln Gly Tyr Asp Thr Thr Leu Gln Ala Phe Glu Thr Ser
85 90 95
Leu Asn Lys Leu Gly Leu Glu Tyr Leu Asp Leu Tyr Leu Ile His Phe
100 105 110
Pro Val Gln Gly Lys Tyr Lys Asp Thr Trp Lys Ala Leu Glu Lys Leu
115 120 125
Tyr Lys Asp Gly Lys Ile Arg Ala Ile Gly Val Ser Asn Phe Gln Val
130 135 140
His His Leu Glu Asp Leu Ile Ala Asp Ala Glu Val Lys Pro Met Val
145 150 155 160
Asn Gln Ile Glu Phe His Pro Leu Leu Thr Gln Thr Glu Val Arg Glu
165 170 175
Tyr Cys Lys Lys Gln Gly Ile Gln Val Glu Ala Trp Ser Pro Leu Ala
180 185 190
Gln Gly Glu Leu Leu Asp Asn Glu Val Leu Thr Gln Ile Ala Glu Lys
195 200 205
His Gly Lys Ser Thr Ala Gln Val Ile Leu Arg Trp Asp Leu Gln Asn
210 215 220
Glu Val Val Thr Ile Pro Lys Ser Thr Lys Glu His Arg Ile Ile Gln
225 230 235 240
Asn Ala Asp Val Phe Asp Phe Glu Leu Asn Ala Glu Glu Val Glu Lys
245 250 255
Ile Asn Ala Leu Asn Gln Asn His Arg Val Gly Pro Asp Pro Asp Asn
260 265 270
Phe Asp Phe
275
<210> 7
<211> 825
<212> DNA
<213> Bacillus megaterium
<400> 7
atggaaaact tacagtcaac gacgacctta gcaaacggcg ttaaaatgcc ttggttaggt 60
ttaggtgtta gcaaagtaga agatggtcaa gaagttgtag attcagttaa atatgcaatc 120
aaagctggat ataaaagcat tgatacggct aaaatttatg aaaatgaaga aggcgtggga 180
caagcgatca aagaatcagg tgtttctcgc gaagaactat ttgttacatc aaaagtgtgg 240
aatgcagatc aaggatatga cacaactctt caagcgtttg aaacaagctt aaacaagctg 300
ggtcttgaat atttagattt atacttaatt cactttccag ttcaaggtaa gtataaagat 360
acgtggaaag cacttgaaaa gctttataaa gacgggaaaa ttcgtgcaat cggcgtatcg 420
aatttccaag ttcatcattt agaagactta attgcagatg cagaagtcaa gccgatggta 480
aaccaaatcg aatttcatcc acttttaaca caaacagaag tgcgtgaata ctgcaaaaaa 540
caaggaatcc aagtggaagc atggtcaccg cttgcacaag gtgagctgct tgataacgaa 600
gtgttaactc aaattgctga aaagcacgga aaatcaactg ctcaagttat cttacgttgg 660
gacttacaaa acgaagtagt aactattcct aagtcaacaa aagaacatcg tattatccaa 720
aatgcagacg tatttgattt tgaattaaat gcagaagaag ttgaaaaaat taacgcatta 780
aatcaaaatc atcgcgtagg tccagatcca gataactttg acttt 825
<210> 8
<211> 275
<212> PRT
<213> Bacillus megaterium
<400> 8
Met Glu Asn Leu Gln Ser Thr Thr Thr Leu Ala Asn Gly Val Lys Met
1 5 10 15
Pro Trp Leu Gly Leu Gly Val Ser Lys Val Glu Asp Gly Gln Glu Val
20 25 30
Val Asp Ser Val Lys Tyr Ala Ile Lys Ala Gly Tyr Lys Ser Ile Asp
35 40 45
Thr Ala Lys Ile Tyr Glu Asn Glu Glu Gly Val Gly Gln Ala Ile Lys
50 55 60
Glu Ser Gly Val Ser Arg Glu Glu Leu Phe Val Thr Ser Lys Val Trp
65 70 75 80
Asn Ala Asp Gln Gly Tyr Asp Thr Thr Leu Gln Ala Phe Glu Thr Ser
85 90 95
Leu Asn Lys Leu Gly Leu Glu Tyr Leu Asp Leu Tyr Leu Ile His Phe
100 105 110
Pro Val Gln Gly Lys Tyr Lys Asp Thr Trp Lys Ala Leu Glu Lys Leu
115 120 125
Tyr Lys Asp Gly Lys Ile Arg Ala Ile Gly Val Ser Asn Phe Gln Val
130 135 140
His His Leu Glu Asp Leu Ile Ala Asp Ala Glu Val Lys Pro Met Val
145 150 155 160
Asn Gln Ile Glu Phe His Pro Leu Leu Thr Gln Thr Glu Val Arg Glu
165 170 175
Tyr Cys Lys Lys Gln Gly Ile Gln Val Glu Ala Trp Ser Pro Leu Ala
180 185 190
Gln Gly Glu Leu Leu Asp Asn Glu Val Leu Thr Gln Ile Ala Glu Lys
195 200 205
His Gly Lys Ser Thr Ala Gln Val Ile Leu Arg Trp Asp Leu Gln Asn
210 215 220
Glu Val Val Thr Ile Pro Lys Ser Thr Lys Glu His Arg Ile Ile Gln
225 230 235 240
Asn Ala Asp Val Phe Asp Phe Glu Leu Asn Ala Glu Glu Val Glu Lys
245 250 255
Ile Asn Ala Leu Asn Gln Asn His Arg Val Gly Pro Asp Pro Asp Asn
260 265 270
Phe Asp Phe
275
Claims (11)
1. The mutant of aldehyde ketone reductase is characterized in that the amino acid sequence is shown as SEQ ID No.4,8.
2. A nucleic acid encoding the aldoketoreductase mutant of claim 1.
3. The nucleic acid of claim 2, having a nucleic acid sequence as set forth in SEQ ID No.3,7.
4. An expression vector comprising the nucleic acid of claim 2 or 3 and capable of expression in a host cell.
5. A host cell comprising the nucleic acid of claim 2 or 3 or the expression vector of claim 4.
6. The host cell of claim 5, wherein the host cell is E.coli.
7. The use of the aldoketoreductase mutant of claim 1 in the reduction of alpha-keto acid esters.
8. The use of claim 7, wherein the reduction process comprises: in a phosphate buffer solution of pH5-7, in the presence of glucose dehydrogenase, glucose and NADP + In the presence of the aldehyde ketone reductase mutant as described in claim 1, an optically active chiral secondary alcohol is produced by reducing an α -keto acid ester compound.
9. The use as claimed in claim 8, wherein the aldone reductase is used in an amount of 0.02-40g/L, the glucose dehydrogenase is used in an amount of 0.01-5g/L, the glucose is used in an amount of 6-200g/L, NADP + The dosage is 0.1-0.5mmol, the concentration of the alpha-keto acid ester compound is 3-100g/L, the buffer solution is phosphate buffer solution with the pH value of 5-7, and the reaction temperature is 30-40 ℃.
10. Use according to claim 8 or 9, wherein the α -keto ester compound is of formula (I):
R 1 is C 1 -C 4 Alkyl or phenyl;
R 2 is C 1 -C 4 An alkyl group.
11. The use of claim 8 or 9, wherein in the α -keto acid ester compound, R is 1 Is phenyl; r 2 Is ethyl.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375807.6A CN110257350B (en) | 2019-05-07 | 2019-05-07 | Aldehyde ketone reductase BmAKR1, mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375807.6A CN110257350B (en) | 2019-05-07 | 2019-05-07 | Aldehyde ketone reductase BmAKR1, mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110257350A CN110257350A (en) | 2019-09-20 |
| CN110257350B true CN110257350B (en) | 2022-10-11 |
Family
ID=67914287
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910375807.6A Active CN110257350B (en) | 2019-05-07 | 2019-05-07 | Aldehyde ketone reductase BmAKR1, mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257350B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058248A (en) * | 2017-04-26 | 2017-08-18 | 浙江工业大学 | One kind restructuring aldehyde Ketoreductase mutant, gene, carrier, engineering bacteria and its application |
-
2019
- 2019-05-07 CN CN201910375807.6A patent/CN110257350B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058248A (en) * | 2017-04-26 | 2017-08-18 | 浙江工业大学 | One kind restructuring aldehyde Ketoreductase mutant, gene, carrier, engineering bacteria and its application |
Non-Patent Citations (3)
| Title |
|---|
| Acceleration of an aldo-keto reductase by minimal loop engineering;C.Krump等;《Protein Engineering, Design & Selection》;20141231;第27卷(第7期);第245-248页 * |
| MULTISPECIES: aldo/keto reductase [Bacillus];佚名;《NCBI》;20180113;NCBI Reference Sequence: WP_013055620.1 * |
| 佚名.MULTISPECIES: aldo/keto reductase [Bacillus].《NCBI》.2018,NCBI Reference Sequence: WP_013055620.1. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110257350A (en) | 2019-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111094557B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohol | |
| CN108546690B (en) | Short-chain dehydrogenase and mutant thereof, and preparation and application of gene | |
| CN112941043B (en) | Carbonyl reductase mutant and application thereof in preparation of chiral beta' -hydroxy-beta-amino acid ester | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| CN113293152B (en) | Short-chain dehydrogenase mutant and use thereof | |
| CN113355367B (en) | Application of ketoacid reductase in synthesis of chiral aromatic 2-hydroxy acid | |
| CN110592035B (en) | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol | |
| CN111100851B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of chiral diaryl alcohol compound | |
| CN110257350B (en) | Aldehyde ketone reductase BmAKR1, mutant and application thereof | |
| CN110283799B (en) | Aldehyde ketone reductase BsAKR (YvgN) and mutant and application thereof | |
| CN110257349B (en) | Aldehyde ketone reductase BmAKR2, mutant and application thereof | |
| CN113174377B (en) | Carbonyl reductase, mutant and application of carbonyl reductase in preparation of diltiazem intermediate | |
| CN110272879B (en) | Aldehyde ketone reductase BcAKR and mutant and application thereof | |
| CN113528592B (en) | Enzyme-catalyzed (2)S,3R) Synthesis method of (E) -2-substituted aminomethyl-3-hydroxybutyrate | |
| CN111944774B (en) | Alcohol dehydrogenase, encoding gene thereof and application of alcohol dehydrogenase in catalytic synthesis of (R) -styrene glycol | |
| CN114908129A (en) | Dehydrogenase for preparing (R) -4-chloro-3-hydroxybutanoate ethyl ester | |
| CN110669743A (en) | P450 monooxygenase mutant from deinococcus radiodurans and application thereof | |
| CN114774491B (en) | Method for preparing (2S, 3R) -2- (phthalimidomethyl) -3-hydroxybutyrate | |
| CN112813040B (en) | Old yellow enzyme OYE1 mutant protein and application thereof in enzyme-catalyzed asymmetric reduction of 2-aryl acrylic acid derivatives | |
| CN112852770B (en) | Alcohol dehydrogenase mutant and application thereof in preparing chiral diaryl alcohol compound by efficient asymmetric reduction | |
| CN114736882B (en) | Monoamine oxidase and application thereof | |
| CN113444702B (en) | Enone reductase mutant and application thereof | |
| CN111518789B (en) | Recombinant lipase mutant, gene, vector and application thereof | |
| CN108588043B (en) | Monooxygenase complex and application thereof in chiral sulfoxide synthesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |