CN110257266B

CN110257266B - Near-rose color-locked yeast strain and application thereof in production of lactase

Info

Publication number: CN110257266B
Application number: CN201910399170.4A
Authority: CN
Inventors: 王磊; 苑广伟; 姜峰
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2019-05-14
Filing date: 2019-05-14
Publication date: 2020-03-06
Anticipated expiration: 2039-05-14
Also published as: CN110257266A

Abstract

The invention relates to a Daisy color-locked yeast strain which is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2019119. The near-rose color-locked yeast strain has the characteristics of high growth and propagation speed and high activity of produced lactase, and has the capability of efficiently decomposing lactose. The near-rose color locked yeast strain is particularly suitable for producing lactase.

Description

Near-rose color-locked yeast strain and application thereof in production of lactase

Technical Field

The invention relates to the field of microorganisms, in particular to a Daisy-like chromophose tosphase strain and application thereof in producing lactase.

Background

Lactase, also known as β -galactosidase or β -D-galactoside galactohydrolase, is a disaccharidase existing on the surface of the microvillous membrane of the small intestine mucous membrane of mammals, lactose in milk is hydrolyzed by lactase, the product glucose is an energy source for the metabolism of each part of the human body, galactose is a structural sugar necessary for the metabolism of human brain and mucous membrane tissues and is an essential substance for the development of the brain of infants.

Lactase has special importance and catalytic activity to organisms, so that the lactase has wide application prospect. The food industry utilizes lactase to prepare low-sugar dairy products, thus effectively solving the problem of lactose intolerance; can also be used for ripening and softening fruits and vegetables; lactase can also be used in the field of medicine as a digestive drug to treat infant dyspepsia, regulate normal intestinal flora and the like.

Lactase derived from microorganisms has been widely studied and applied to practical production, and some lactase produced by aspergillus and yeast has been officially used as a food additive in countries such as the united states. There are also many single lactase products in China for the treatment of lactose intolerance and other problems. The lactase is produced by utilizing microorganisms, and the key for improving the yield of the lactase is proper fermentation culture conditions. The production and activity of the enzyme are influenced by various parameters, such as the type of strain, the culture conditions (temperature, pH, inoculum size, culture time), the inorganic salt ion, and the ratio of carbon and nitrogen sources in the medium. In the test, the test strain is found to have lactase activity through qualitative tests, so that the yield of lactase is improved by optimizing culture conditions, and the lactase can be conveniently used for industrial production.

Disclosure of Invention

Accordingly, an object of the present invention is to provide a novel fungus belonging to genus Paracoccus.

The technical scheme adopted by the invention is as follows:

a Daisy color-locked yeast strain is preserved in China center for type culture Collection with the preservation number of CCTCCNO M2019119.

The near-rose color-locked yeast strain has the characteristics of high growth and propagation speed and high activity of produced lactase, and has the capability of efficiently decomposing lactose.

Another object of the present invention is to provide the use of a strain of Spodoptera fumosa in the production of lactase.

Further, the culture method of the near rose color-locked yeast strain comprises the following steps:

s1 inoculation: the color-locked yeast strain is 1.0 × 10⁵～7.0×10⁶Inoculating the strain with the inoculation concentration of 0.5-5% in a culture medium;

s2 culture: and (3) culturing the culture medium inoculated with the rhodotorula rosea near yeast strain at the constant temperature of 28 ℃ for 12-72 hours.

Further, the culture medium comprises the following raw materials in parts by weight: tryptone 20 parts, yeast powder 15 parts, glucose 20 parts and sterile water 1000 parts.

Further, the inoculation concentration in step S1 was 6.55X 10⁶。

Further, the inoculation amount in step S1 was 4%.

Further, the incubation period in step S2 was 54 hours.

Further, in step S2, the culture was performed at 28 ℃ with shaking at a speed of 180 rpm.

Further, the production of the lactase comprises the following steps:

s1 inoculation: the color-locked yeast strain is expressed in 6.55 multiplied by 10⁶Inoculating the culture medium with the inoculation concentration and the inoculation amount of 0.5-5%;

s2 culture: culturing the culture medium inoculated with the near rose color tostada strain at the constant temperature of 28 ℃ for 12-72 hours;

s3 centrifugation: after the culture, the precipitate was removed by centrifugation and the supernatant was collected. The supernatant is liquid containing the lactase produced by the near rose color tossed yeast strain.

Compared with the prior art, the near rose color tossed yeast strain has wider pH adaptation range and temperature adaptation range in the process of producing lactase, and is beneficial to adapting to industrial operation.

For a better understanding and practice, the invention is described in detail below with reference to the accompanying drawings.

Drawings

FIG. 1 is a diagram of the PCR amplification of the ITS sequence of a Nitrospira near-Dahurica yeast strain according to the present invention;

FIG. 2 is a tree constructed based on the ITS sequence barcodes of a near rose-color-locked yeast strain and a similar strain according to the present invention;

FIG. 3 is a diagram showing the alignment of ITS sequences between a P.fumosoroseus strain and a P.fumosoroseus strain AUMC 7791(JQ425362.1) according to the present invention;

FIG. 4 is a graph showing the relationship between the activity of a Sargassu rhodozyma strain of the present invention and the activity of lactase obtained by culturing the Sargassu rhodozyma strain at different times;

FIG. 5 is a graph showing the relationship between the enzymatic activities of a Sargassu rhodozyma strain of the present invention cultured in different inoculum sizes and the resulting lactase;

FIG. 6 is a graph showing the relationship between the activity of a Sargassu rhodozyma strain of the present invention cultured at different temperatures and the activity of the resulting lactase;

FIG. 7 is a graph showing the relationship between the enzymatic activities of a Sargassu rhodozyma strain of the present invention cultured on different carbon sources and the resulting lactase;

FIG. 8 is a graph showing the relationship between the enzymatic activities of a Sargassu rhodozyma strain of the present invention cultured in different nitrogen sources and the resulting lactase;

FIG. 9 is a graph showing the relationship between the enzymatic activity of a Sargassu rhodozyma strain of the present invention cultured at different pH's and the resulting lactase;

FIG. 10 is a morphogram staining pattern of a near-meissypium spinosum strain of the present invention cultured for 48 h;

FIG. 11 is a staining pattern of a near-meissypium spinosum strain according to the invention.

Detailed Description

The near rose color-locked yeast strain is named as XWSP1, is preserved in a China center for type culture Collection (address: China center for type culture Collection in Wuhan university in Wuhan City, Hubei province, China) in 2019 and 19 months, and has the preservation number of CCTCC NO of M2019119.

The first embodiment is as follows: separation and purification method

The invention relates to a method for separating and purifying a near rose color locked yeast strain, which comprises the following steps:

s1: weighing 10g of a soil sample from a Guangzhou Xunwu agricultural reclamation high-yield farm; then, adding 90ml of sterile water into the soil sample in a super-clean workbench, and placing the soil sample on an oscillator for oscillation for 60min to uniformly disperse the soil sample in the diluent to form soil suspension; after the soil is dispersed, 100ul of soil suspension is sucked into 900ul of sterile water to obtain 10 times of diluent, then the 10 times of diluent is sequentially diluted to obtain 100 times of diluent and 1000 times of diluent, and the whole process is carried out in an ultra-clean workbench.

S2: and (3) respectively coating 100ul of 10-time diluent, 100-time diluent and 1000-time diluent on three PDA solid culture plates, then placing the culture plates in an incubator at the constant temperature of 28 ℃ for 2-3 days, and growing bacterial plaques on the culture plates.

S3: after the culture is finished, single bacterial plaques with different shapes, colors, sizes and the like are selected from the appropriate dilution gradient plate one by one according to the growth condition of the bacterial colonies to carry out plate streaking, and the near rose color locked yeast strain is separated. The near rose color tossed yeast strain of the invention is cultured for 48h on PDA solid culture medium, and the morphological characteristics are as follows: the colony surface was oily, pale red and protruded upward (as shown in FIG. 10); the near-rhodotorula rosea yeast strain is stained by ammonium oxalate crystal violet, and a single colony is purple oval (as shown in figure 11).

S4: selecting purified strains from PDA plate, inoculating into 500ml Erlenmeyer flask containing 200ml YPD liquid culture medium, and culturing at 28 deg.C and 180rpm under constant temperature shaking culture condition for 72h to obtain seed solution;

the PDA solid culture medium comprises the following components in percentage by weight: 200 parts of potato, 20 parts of glucose, 12 parts of agar and MgSO₄3 parts of KH₂PO₄1.5 parts of sterile water 1000 parts; the preparation method comprises the following steps: accurately weighing 200 parts of potato, cutting into small pieces, putting into tap water, boiling for 20min, cooling, filtering with 400-mesh gauze to obtain potato juice, accurately adding the components, adding tap water to a constant volume, subpackaging into conical flasks, sterilizing with high-pressure steam at 121 ℃ and 101KPa in a sterilizing pot for 20min, taking out when the temperature of the sterilizing pot is reduced to below 70 ℃ and the pressure is restored to 0KPa, pouring into culture dishes on a super clean bench, pouring about 10ml of culture medium into each culture dish, cooling and solidifying, and storing the solid culture plate at 4 ℃.

The YPD liquid culture medium comprises the following components: tryptone 20 parts, yeast powder 15 parts, glucose 20 parts and sterile water 1000 parts. Subpackaging into conical bottles, sterilizing with high pressure steam at 121 deg.C and 101KPa for 20min in a sterilizing pan, cooling to below 70 deg.C, recovering pressure to 0KPa, and storing.

Example two: culture method

S1 inoculation: the seed liquid obtained in the first example was mixed with 10⁶Inoculating the strain with the inoculation concentration and the inoculation amount of 2 percent into a 1000ml conical flask containing 300ml of PDA liquid culture medium;

s2 culture: and (3) culturing the culture medium inoculated with the near-rose color-locked yeast strain for 72 hours under the conditions of 28 ℃ and 180rpm constant temperature shaking table to obtain the near-rose color-locked yeast strain liquid.

The rhodotorula roseus is capable of secreting lactase to the outside of cells in the growth process, namely secreting lactase to a culture solution. Therefore, the bacterial liquid of the yeast of the near rose color tosphakia obtained in S2 is centrifuged to precipitate the thallus, and the supernatant liquid is the liquid containing lactase, which is called as crude enzyme liquid for short. Therefore, the method for culturing the near-rose color-locked saccharomycete liquid is the method for producing lactase by using the near-rose color-locked saccharomycete liquid, which is disclosed by the invention, by adding centrifugation and supernatant retention operation.

Example three: PCR amplification of ITS sequences and sequencing

S1: taking genomic DNA

Firstly, 200ml of the seed solution described in the first embodiment is taken and put in a sterile 2ml centrifuge tube, centrifuged for 2min at 12000rpm, and the supernatant is discarded to keep the precipitate; then, resuspending the precipitate with 2% CTAB buffer solution, adding 20ul proteinase K (20mg/ml), placing on a shaker, shaking for 20-30 s, and performing water bath at 55 ℃ for more than 4h or overnight (shaking once every half an hour); then, taking the extract digested by the protease K out of the water bath kettle, cooling at room temperature, adding 600ul of chloroform, shaking, mixing uniformly, and centrifuging at 12000rpm for 10min to obtain a supernatant; then, pouring the supernatant into a new 1.5ml centrifuge tube, adding 300ul of 100% isoamyl alcohol solution stored at room temperature, uniformly mixing, turning upside down, uniformly mixing, placing in a refrigerator at 4 ℃ for more than one hour, centrifuging at 12000rpm for 10min, and removing the supernatant to obtain DNA precipitate; and finally, washing the DNA precipitate for 1-2 times by using 300ul of 70% ethanol, inverting the centrifugal tube, naturally airing the centrifugal tube, dissolving the DNA precipitate by using 30 ul-50 ul of ddH2O to obtain genome DNA, and storing the genome DNA in a refrigerator at 4 ℃ overnight and at-20 ℃ for later use.

S2: PCR amplification of ITS sequences

And (3) performing PCR amplification by using the genomic DNA obtained in the step S1 as a template and ITS1 and ITS4 as primers, wherein a PCR reaction system (50ul) is as follows:

the PCR reaction program is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 deg.C for 30s, renaturation at 55 deg.C for 30s, and extension at 72 deg.C for 1min, and repeating the denaturation, renaturation and extension processes for 30 times; further extension at 72 ℃ for 10min, and storage of the PCR amplification product at 4 ℃.

The sequence of the upstream primer ITS1 is as follows: TCCGTAGGTGAACCTGCGG

The sequence of the downstream primer ITS4 is as follows: TCCTCCGCTTATTGATATGC

S3: subjecting the PCR product to nucleic acid electrophoresis

5ul of the PCR product obtained in step S2 was spotted and subjected to nucleic acid electrophoresis at 120V for 30 min. The electrophoresis result is shown in FIG. 1, the ITS fragment amplified by using the genomic DNA of the S.fumosoroseus strain of the present invention as the template has a single band and high brightness, and the ITS sequence length is about 600 bp.

S4: sequencing of ITS sequences

After the PCR product obtained in the step S2 is purified and recovered, 30ul of the purified product is sent to Guangzhou Ongke Biotechnology Limited for sequence two-way sequencing determination, and the sequencing result shows that the ITS sequence of the near rose color-locked yeast strain of the invention has the length of 610bp, and the specific sequence is as follows:

example four: building phylogenetic trees

Inputting the ITS sequence of the near-rose color-locked yeast strain of the invention obtained in the third embodiment into NCBI, performing BLAST alignment, and constructing an NJ phylogenetic tree based on the sequence of the barcode ITS segment. As shown in FIG. 2, the strains obtained according to the phylogenetic tree of the present invention have most sequences in the ITS barcode database of S.fumosoroseus strains that are highly similar but do not completely overlap, nor have unique contiguous species sequences. Therefore, it is understood that the strain obtained by the present invention belongs to genus Sporidiobolus pararosaeus (genus Sporidiobolus pararosaeus) in classification and is a novel species.

Example five: comparison of closely-sourced species

The ITS sequence of the Rhodotorula rosea strain of the present invention obtained in example III is inputted into NCBI, and aligned with the ITS sequence of Rhodotorula rosea strain, Sporidiobolus pararosasesstrin AUMC 7791(JQ425362.1), and the alignment result is shown in FIG. 3. the ITS sequence of the Rhodotorula rosea strain of the present invention has a homology of 99% with the ITS sequence of Sporidiobolus pararosasesstrin AUMC 7791, but is not completely identical, and there is a difference of 12 bases between the two. It is further seen that the strain obtained in the present invention belongs to genus Sporidiobolus pararosaus in classification, and is a novel strain of genus Sporidiobolus pararosaus, which was tentatively named XWSP 1.

Example six: method for producing lactase

s2 culture: culturing the culture medium inoculated with the near-rose color-locked saccharomycete for 72 hours at 28 ℃ under the condition of a constant temperature shaking table at 180rpm to obtain the near-rose color-locked saccharomycete liquid.

S3 centrifugation: after the culture, the precipitate was removed by centrifugation and the supernatant was collected.

The supernatant is liquid containing lactase produced by the near rose color tossed yeast strain, which is called crude enzyme liquid for short.

The formula and the preparation mode of the YPD liquid culture medium are shown in the first embodiment.

Example seven: culture condition for screening strain producing cellulase with optimal enzyme activity state

(1) Screening for optimal incubation duration

S1: the seed liquid of the strain obtained in the first example was mixed at 6.55X 10⁶The inoculation concentration was 2% in a 1000ml Erlenmeyer flask containing 300ml YPD liquid mediumPerforming constant-temperature shaking culture at 28 deg.C and 180rpm on shaking table, respectively sucking 10ml of bacteria solution for 6h, 12h, 18h, 24h, 30h, 36h, 42h, 48h, 54h, 60h, 66h and 72h, and storing in 4 deg.C refrigerator;

s2, taking out the bacterial liquid in each time period from a refrigerator at 4 ℃, centrifuging at 12000rpm for 2min to obtain a crude enzyme liquid, and detecting the lactase enzyme activity of the crude enzyme liquid obtained in different culture times by adopting a Gister-Blacket method and taking o-nitrophenyl- β -D-galactopyranoside (ONPG) as a substrate.

S3: the Gister-Blockz method comprises the following specific steps:

ONPG substrate solution (2.5g/L) preparation 250.0mg of o-nitrophenyl- β -D-galactopyranoside (ONPG) was dissolved in about 80mL of reaction buffer, then transferred to a 100mL volumetric flask, made up with reaction buffer to volume, shaken up, and prepared as early as 2h before use.

b. Preparing a sodium carbonate termination solution: 50g of sodium carbonate (Na)₂CO₃) And 37.2g disodium EDTA dissolved in about 900mL of water to a volume of 1000 mL.

c. Preparing an o-nitrophenol standard stock solution: 139.0mg of o-nitrophenol is weighed, dissolved in 10mL of 96% ethanol, transferred to a 1000mL volumetric flask, made to volume with water and shaken up.

d. 0.5ml of the crude enzyme solution and 2ml of the ONPG substrate solution were preheated at 37 ℃ for 10min, respectively.

e. Adding 0.5ml of the crude enzyme solution into the preheated ONPG substrate solution, uniformly mixing, and carrying out water bath at 37 ℃ for 30 min.

f. After the water bath is finished, taking out the reaction product, adding 0.5ml of 1mol/L sodium carbonate solution (precooled) into the reaction product to terminate the reaction, and measuring the absorbance value at 420nm by using an ultraviolet-visible spectrophotometer. And obtaining the absorbance value and obtaining the corresponding concentration of the o-nitrophenol (ONP) according to an o-nitrophenol (ONP) standard curve, thereby calculating the enzyme activity of the lactase.

g. One lactase enzyme activity unit (U) is defined as: the amount of enzyme required to catalyze the formation of 1umol of o-nitrophenol (ONP) per minute under standard conditions is defined as one lactase enzyme activity unit (U) (Ghosh et al 2012).

h. The enzyme activity calculation formula is as follows:

U/mL＝(V₁ ^.N^.c)/(V₂ ^.t)

note: c: calculated ONPG concentration (mmol/L) from standard curve; n: the dilution times of the crude enzyme solution are obtained;

v1: total volume of reaction (ml); v2: crude enzyme solution volume (ml); t: reaction time (min)

The detection result is shown in figure 4, the near rose color tossing yeast strain has obvious lactase producing capacity, the enzyme producing capacity is in positive correlation with the culture time of the strain, and the enzyme activity of the produced lactase is obviously improved along with the increase of the culture time. When the culture time is 54h, the enzyme activity reaches a peak value of 19U/L. Therefore, the culture time of 54h is the best culture time for the near rose color tossed yeast strain to carry out lactose enzymolysis.

(2) Screening the optimal inoculum size

S1: the seed liquid of the strain obtained in the first example was mixed at 6.55X 10⁶Inoculating the strain at the inoculation concentration of 0.5%, 1%, 2%, 3%, 4% and 5% respectively in 1000ml conical flask containing 300ml YPD liquid culture medium, performing constant temperature shaking culture at 28 deg.C and 180rpm for 54 hr, sucking 10ml bacterial liquid, and centrifuging at 12000rpm for 2min to obtain crude enzyme liquid;

s2, adopting a Gister-Blocktz method to detect the lactase enzyme activity of the crude enzyme solution obtained by different inoculation amounts by taking o-nitrophenyl- β -D-galactopyranoside (ONPG) as a substrate.

The detection result is shown in figure 5, when the inoculation amount is 4%, the enzyme activity of the cellulase produced by the near rose color tossing yeast strain is highest and reaches 50U/L; when the inoculation amount is less than 4%, the enzymatic activity of lactase is obviously reduced; when the inoculation amount is more than 4%, the enzymatic activity of lactase is reduced. Therefore, the inoculation amount of 4 percent is the best inoculation amount of the near rose color tossed yeast strain for hydrolyzing lactose.

(3) Screening for optimal culture temperature

S1: the seed liquid of the strain obtained in the first example was mixed at 6.55X 10⁶Inoculation concentration, 4% inoculation amount of inoculation in the contentCulturing in 300ml YPD liquid culture medium 1000ml conical flask under shaking at constant temperature of 18 deg.C, 23 deg.C, 28 deg.C, 33 deg.C, 38 deg.C and 180rpm for 54 hr, sucking 10ml bacterial liquid, and centrifuging at 12000rpm for 2min to obtain crude enzyme solution;

s2, adopting a Gister-Blocktz method to detect the lactase enzyme activity of crude enzyme liquid obtained at different culture temperatures by taking o-nitrophenyl- β -D-galactopyranoside (ONPG) as a substrate.

The detection result is shown in figure 6, and the near rose color locked yeast strain has the highest enzyme activity under the culture condition of 28 ℃, and reaches 50U/L. When the temperature is higher than 28 ℃, the enzyme activity is gradually reduced; the enzyme activity tends to gradually increase before the temperature is lower than 28 ℃.

(4) Screening for optimal carbon sources

S1: the seed liquid of the strain obtained in the first example was mixed at 6.55X 10⁶Inoculating the strain at 4% concentration into 1000ml conical flask containing YPD liquid culture medium containing 300ml of different carbon sources, performing constant temperature shaking culture at 28 deg.C and 180rpm for 54 hr, sucking 10ml of bacterial liquid, and centrifuging at 12000rpm for 2min to obtain crude enzyme solution;

S3: YPD medium formula of the different carbon sources: 20 parts of carbon source (soluble starch, sucrose, galactose, lactose, glucose and fructose), 20 parts of tryptone, 15 parts of yeast powder and 1000 parts of sterile water. Subpackaging into conical bottles, sterilizing with high pressure steam at 121 deg.C and 101KPa for 20min in a sterilizing pan, cooling to below 70 deg.C, recovering pressure to 0KPa, and storing.

The detection result is shown in figure 7, and the near rose color tossing yeast strain has the highest enzyme activity when galactose is used as a carbon source, and reaches 100U/L. Compared with other five carbon sources, the enzyme activity is obviously improved.

(5) Screening of optimal Nitrogen sources

S1: the seed liquid of the strain obtained in the first example was mixed at 6.55X 10⁶Inoculation concentration, at 4% inoculationInoculating the strain into 1000ml conical flask containing YPD liquid culture medium containing 300ml of different nitrogen sources, performing constant temperature shaking culture at 28 ℃ and 180rpm for 54 hours, sucking 10ml of bacterial liquid, and centrifuging at 12000rpm for 2min to obtain crude enzyme liquid;

S3: the YPD culture medium formula of the different nitrogen sources comprises the following components: 20 parts of galactose, 20 parts of nitrogen source (peptone, peptone and yeast powder which are 2:5, peptone and yeast powder which are 1:1, 3:4, 5:2 and 1000 parts of sterile water). Subpackaging into conical bottles, sterilizing with high pressure steam at 121 deg.C and 101KPa for 20min in a sterilizing pan, cooling to below 70 deg.C, recovering pressure to 0KPa, and storing.

The detection result is shown in figure 8, and the near rose color locked yeast strain has the highest enzyme activity when galactose is used as a carbon source, and reaches 1986U/L. Compared with other five nitrogen sources, the enzyme activity is obviously improved. Compared with the method for screening the optimal temperature, the enzyme activity of the lactase is improved by 104.5 times, and the nitrogen source has great influence on the production of the lactase.

(6) Screening for optimal Medium initial pH

S1: the seed liquid of the strain obtained in the first example was mixed at 6.55X 10⁶Inoculating the strain at 4% concentration into 1000ml conical flask containing 300ml YPD liquid culture medium with different pH, performing constant temperature shaking culture at 28 deg.C and 180rpm for 54 hr, sucking 10ml bacterial liquid, and centrifuging at 12000rpm for 2min to obtain crude enzyme solution;

S3: the YPD medium formulas with different pH values are as follows: galactose 20 parts, nitrogen source (peptone: yeast powder ═ 3:4)20 parts, sterile water 1000 parts, then respectively adjusting the pH of the culture medium to 5, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, subpackaging to conical flasks, placing in a sterilizing pot for sterilizing 20min with high pressure steam at 121 ℃ and 101KPa, taking out when the temperature of the sterilizing pot is reduced to below 70 ℃ and the pressure is restored to 0KPa, and storing for later use.

The detection result is shown in figure 9, the positive control is β -galactosidase/GAL standard product produced by the leaf biology company, the standard enzyme activity is 110U/mg, the concentration of β -galactosidase solution prepared in the experiment is 0.2mg/ml, and as can be seen from figure 9, the near rose color-locked yeast strain has the highest enzyme activity which reaches 2151U/L when galactose is used as a carbon source, peptone, yeast powder and 3:4 are used as nitrogen sources, and the pH of a culture medium is 7.0, and has a remarkable difference compared with the positive control.

The strains of the invention were optimized for culture conditions by way of example seven. Before the culture conditions are optimized, the lactase enzyme activity of the strain is only 19U/L; after the culture conditions are optimized, the lactase activity of the strain is as high as 2151U/L; compared with the prior strain, the lactase enzyme activity of the strain is improved by about 113 times after the optimization, and the culture condition plays a great role in the lactase enzyme activity of the strain.

Sequence listing

<110> southern China university of agriculture

<120> Dahurian rose-like chromophobe strain and application thereof in production of lactase

<160>13

<170>PatentIn version 3.1

<210>1

<211>610

<212>DNA

<213> Artificial sequence

<220>

<223> ITS sequence of Nitrosclerospora proximatei strain of the present invention

<400>1

ccttccgtaa gggggggacc tgcggaagga tcattattga aaacaagggt gtccaattta 60

acttggaacc caaacttctc aattctaact ttgtgcatct gtattaatgg cgagcaactt 120

cggttgtgag ccttcactta caaaacacta gtctatgaat gtaaaatttt tataacaaat 180

aaaaactttc aacaacggat ctcttggctc tcgcatcgat gaagaacgca gcgaaatgcg 240

atacgtaatg tgaattgcag aattcagtga atcatcgaat ctttgaacgc atcttgcgct 300

ctctggtatt ccggagagca tgtctgtttg agtgtcatga attcttcaac ccaatctttt 360

cttgtaatcg attggtgttt ggattctgag cgttgctggc gtttgcctag ctcgttcgta 420

atacattagc atccctaata caagtttgga ttgacttggc gtaatagact attcgctaag 480

gattcggtgg aaacatcgag ccaacttcat taaggaagct cctaatttaa aagtctacct 540

tttgattaga tctcaaatca ggcaggatta cccgctgaac ttaagcatat caataaaggc 600

cggaggaaaa 610

<210>2

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> upstream primer ITS1

<400>2

tccgtaggtgaacctgcgg

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> downstream primer ITS4

<400>3

tcctccgcttattgatatgc

Claims

1. A Woodfordia roseoflavus strain (Sporidiobolus pararosaus) XWSP1 is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2019119.

2. Use of a phoma rhodozyma near strain XWSP1 according to claim 1 in the production of lactase.

3. The use of a near Daisy-locked yeast strain XWSP1 in the production of lactase according to claim 2, wherein the method for culturing the near Daisy-locked yeast strain comprises the steps of:

s2 culture: and (3) culturing the culture medium inoculated with the yeast strain at the constant temperature of 28 ℃ for 12-72 hours.

4. The use of a near rhodotorula rosea strain XWSP1 in the production of lactase according to claim 3, wherein the culture medium comprises the following raw materials in parts by weight: tryptone 20 parts, yeast powder 15 parts, glucose 20 parts, agar 15 parts and sterile water 1000 parts.

5. The use of a near rhodotorula rosea strain XWSP1 in the production of lactase according to claim 3, wherein: the amount of inoculation in step S1 was 2%.

6. The use of a near rhodotorula rosea strain XWSP1 in the production of lactase according to claim 3, wherein: the incubation period in step S2 was 54 hours.

7. Use of a near rhodotorula rosea yeast strain according to claim 3 in the production of cellulase enzymes, wherein: in step S2, the sample was shaken at a speed of 150-220rpm during the 28 ℃ culture.

8. The use of a near rhodotorula rosea strain XWSP1 in the production of lactase according to claim 2, wherein: the production of lactase comprises the following steps:

s2 culture: culturing the culture medium inoculated with the yeast strain at the constant temperature of 28 ℃ for 12-72 hours;

s3 centrifugation: after the culture is finished, centrifuging to remove the precipitate, and reserving and taking supernatant; the supernatant is liquid containing the lactase produced by the yeast strain.