CN110251497A

CN110251497A - Application of the robenidine hydrochloride in preparation treatment fungal infection drug

Info

Publication number: CN110251497A
Application number: CN201910671110.3A
Authority: CN
Inventors: 王慧; 刘宁宁
Original assignee: Shanghai Jiaotong University School of Medicine
Current assignee: Shanghai Jiaotong University School of Medicine
Priority date: 2019-07-24
Filing date: 2019-07-24
Publication date: 2019-09-20
Anticipated expiration: 2039-07-24
Also published as: CN110251497B

Abstract

The invention belongs to field of medicine preparation, in particular to application of the robenidine hydrochloride in preparation treatment fungal infection drug.The present invention passes through experiment, demonstrating robenidine hydrochloride minimal inhibitory concentration is 4 μM, lower than common fluconazole as antifungal medicine, under same concentrations dosage, the fungistatic effect of robenidine hydrochloride is more significant, and still having good killing effect for the fungal bacterial strain and super fungi that generate drug resistance, toxicity is low, securely and reliably.It has also been found that cell wall and transcription factor RLM1 are the drug targets of robenidine hydrochloride treatment fungal infection, for the drug therapy of fungal infection wide prospect is provided.

Description

Application of the robenidine hydrochloride in preparation treatment fungal infection drug

Technical field

The invention belongs to field of medicine preparation, in particular to robenidine hydrochloride answering in preparation treatment fungal infection drug With.

Background technique

Fungal infection is huge to Human health effects, and about tens people of the annual whole world causes by fungal infection more than 150 Ten thousand people are dead.With the development of medical science, various novel drugs and new technology such as broad-spectrum antibiotic, glucocorticoid, immune suppression Preparation, various intubation catheter technologies, organ, bone-marrow transplantation etc. using more and more common, while immune deficient patients are for example pernicious Tumour, HIV infection, the aged etc. are also increasing, thus caused opportunistic pathomycete the incidence of infection and the death rate It increases year by year, increasingly by the attention of medical field.Existing antifungal drug is not able to satisfy clinical demand increasingly, and novel The research and development of drug take a long time again, and the serious disconnection of development speed and social demand is one that current the world of medicine faces Problem.Another aspect disease fungus is to clinically the drug resistance problems of antifungal drug are also increasingly taken seriously at present.These Factor increases the urgency for finding novel antifungal drugs, promotes industrial circle and scientific research institution to research and develop safer and more effective Therapeutic agent finds new chemical entities, eventually for treatment disease fungus infection.Therefore, it develops novel antimycotic with exploitation Drug and searching new role target spot will undoubtedly become the important hope for solving such problem, this is scientific to human health and big strong Health industry has important social and economic implications.

Candida albicans as most common opportunistic pathomycete, symbiosis in healthy human body skin and mucomembranous surface and Harm is not generated, but will infect blood in host immune defect or immunologic hypofunction and histoorgan causes serious depth Portion's fungal infection, the death rate are up to 40%-80%.The drug for being clinically used for treatment fungal infection at present mainly has three categories: more Alkenes, echinocandin class and azole, specific features are as follows: 1) polyene antifungal drug: what wherein application was most is that both sexes are mould Plain B.The lipophilic structure of amphotericin B and the ergosterol of fungal cell membrane combine, and increase permeability of cell membranes, lead to born of the same parents The important substance leakage such as electrolyte, amino acid in slurry, causes fungi dead.However the medical instrument has serious toxic side effect (especially It is renal toxicity), applied to fungal infection after renal transplantation patient often to damage transplanted kidney function as cost, and medication is necessary It is incremented by since low dose, effective concentration cannot be rapidly reached, Operative risk, therefore clinical application more office can be can increase instead Limit.2) echinocandin class: main representative is Caspofungin etc., and mechanism of action is that specificity inhibits β (1,3)-D- glucan to close At enzyme, the synthesis of fungal cell wall β (1,3)-D- glucan is interfered, causes cell wall structure abnormal, cell rupture, important content Object leakage finally causes fungal cell dead.Caspofungin oral absorption is poor, can only by intravenously administrable and expensive, and With adverse reaction such as fever, local phlebitis, headache and the reaction of histamine sample.3) azole: mainly including Fluconazole etc..This class medicine Object main mechanism is C14- α-demethyl enzyme that selective depression fungal cytochrome P450 is relied on, and is caused in fungal cell The accumulation of 14- methyl sterols and ergosterol synthesis are reduced, and increase permeability of cell membrane, important substance leakage intracellular, finally Inhibit fungi growth.Fluconazole is most popular fiest-tire medication, but only has bacteriostatic activity, antibody-resistant bacterium occurs several Rate greatly increases, while with adverse reaction such as Nausea and vomiting, abdominal pain, fash etc..

The problems such as abuse of the limitation of existing antifungal drug and clinically antibiotic, causes antibody-resistant bacterium to frequently occur, Wherein the formation of biofilm (Biofilm) is the major reason that Candida albicans drug resistance generates.Biofilm be by Bacterium or fungi and its mucilage secretion assemble a kind of group structure for the complexity to be formed, shape in biology or inanimate surfaces At main including adherency, starting, maturation, the stage for being detached from and spreading, biofilm can be enhanced microorganism after being formed and resist place Main immune attack and tolerance to antibacterials, and fraction of pathogens bacterium can be detached from biofilm and be propagated and be spread, Cause invasive infection.Structure is complicated for Candida albicans biofilm, by cell (including yeast, mycelia and the vacation of variform Mycelia type cell) and extracellular matrix composition.The attack of extracellular matrix energy effective protection Candida albicans escape host immune cell, Completely cut off antibacterials killing, while stable and abundant nutrient environment can also be provided for the growth of Candida albicans.One to The drug-resistant test studies have shown that Candida albicans of biomembrane Candida albicans Continuous Perfusion antifungal drug is formed to Fluconazole There is very high tolerance, amphotericin B only has the diffusion that could effectively inhibit Candida albicans biomembrane in higher concentrations；Separately have One shows have 65.5% can be separated to Candida albicans in clinical sample to resulting bacterial strain testing result is clinically separated, this There is 15.1% pair of fluconazole resistant in the albicans strain clinically acquired a bit, drug resistant to Itraconazole have 24.7%.Therefore, the generation of biofilm has become a problem in anti-fungal infection.To solve this problem, in addition to Research and develop outside new drug, new antimycotic strategy first is that excavate the antifungic action of existing drug, it is antimycotic by being commonly used with clinic Drug combination reaches effect synergistic in anti-fungal infection.

Fungal cell wall is highly dynamic labyrinth, for maintaining cell shape and protection environment most important.Carefully The robustness of cell wall is most important for maintaining the form of fungi.The mutation that the molecular entity of cell wall is interfered leads to ovum The spatial shape of spherical, pseudohypha and hyphal cell is lost, and frequently results in cracking and death.Cell wall is also fungi and host Between first contact point, therefore cell wall is most important for the interaction of fungi-host and Immune discrimination.Cell wall is by several The outer layer composition of fourth matter and the in-seam rack-layer of beta glucan (β 1,3 and β 1,6- glucan) and high saccharification Mannoproteins.These The linear O key mannosan of protein and the modification of highly branched N key mannosan, this can use additional mannosan side chain Di-phosphate ester by being referred to as phosphomannan (PM) is keyed.The mannosan part of cell wall is for adherency, cell Wall integrity, Immune discrimination are critically important, and 40% including being up to cell wall dry weight.Therefore, fungal cell wall biosynthesis Many features be that fungi is distinctive, therefore be considered as the good target spot of antifungal drug exploitation.

Robenidine hydrochloride is widely used in chicken, rabbit raising as a kind of coccidiosis veterinary drug, and some researches show that should Remaining dosage of the drug in edible tissue is reliable to human body, safety and has no toxic side effect, this medicine there is no to inhibit fungi at present The result of study of effect is delivered.

Summary of the invention

The object of the present invention is to provide application of the robenidine hydrochloride in preparation treatment fungal infection drug.Experiment shows: Robenidine hydrochloride fungistatic effect is significant, and the fungal bacterial strain for generating drug resistance, super fungi still have good killing to imitate Fruit, and toxicity is low, securely and reliably.

Technical solution provided by the invention is to provide application of the robenidine hydrochloride in preparation treatment fungal infection drug.Institute It states fungi and includes the bacterial strain in Mycotoruloides, Cryptococcus, Blastocystis, Eurotium.

Further preferably, the bacterial strain of the Mycotoruloides is Candida albicans；The bacterial strain of the Cryptococcus is Novel hidden Coccus；The bacterial strain of the brewer yeast Pseudomonas is S. cervisiae；The bacterial strain of the Eurotium is aspergillus fumigatus.

Above-mentioned fungi includes drug resistant fungal, super fungi.

Further preferably, the drug resistant fungal is Candida albicans persister；The super fungi is ear candida albicans.

A kind of drug for treating fungal infection, it is characterised in that the drug is drug target progress by transcription factor RLM1 The substance for the treatment of.Preferably, the fungi is Candida albicans.

A kind of drug for treating fungal infection, it is characterised in that the drug is that drug target is controlled by fungal cell wall The substance for the treatment of.Preferably, the fungi is Candida albicans.

It is further preferred that containing robenidine hydrochloride in the effective component of above-mentioned substance.

The bibliography of the transcription factor RLM1 are as follows: Bruno VM, et al. (2006) Control of the C.albicans cell wall damage response by transcriptional regulator Cas5.PLoS Pathog 2(3):e21

DNA source:

ATGGGTAGAAGAAAGATTGAAATAGAACCATTGACAGACGATAGAAATCGTACAGTGACTTTTGTGAAG CGTAAGGCAGGGTTATTTAAAAAAGCTCATGAATTAGCTGTGCTCTGTCAAGTGGATTTAACGGTTATTATCGTTGG CAATAATAATAAAGTATATGAATATTCTACTGTTGAGGCAAATGAGATTTTTAATGCCTATAATAAAACCATTAAAG TCAGAAAACAAGTACATGAATCGAAGTCTCCAGAATATTATTCGAAATTTAGAAAGAAACGACATTTAAATGAACCA CTTATGAATAAATCAGGGTCTGTAGTTGGCACTAATACACATTTGAACGATGAAGACTATGATCATAATGTTCATGA AGCGGGCGATGAGGATTCGGAATATGAAAGCGATGATAATTCTCCACAACCTAAACGGCACAAAAGATCAGAGTCGG TTAAAAAAGAGCAAAACCCCAAAGTGTTTAATAGTACCCAACCTCCACCACCGCCTCCACCACCTCATATATCTTTA AATAATGTTCCAACATTTACCAACCCCCAAAATTACAAAAAACAGATTGATGAGACAAATAACACTTCGGCACCGCC CGCTACTGGGACAAAAAATGAACCAACGATGCAACGACCAGTATTGAGGGTACAAATACCGAATGATGCCAAGAGCA ATACGAATAATTCCCATAGTGGTGTTAATAATAGTGATGGCAAGGACACGGCGAGAACAGTGACGGCAGTCGACAAT AGTGCAACCAACCAAAACACTCAATCGAGCAATACAACATCAGGTACAGGGACTGCTGATACCAATTCATCGCAACT AAATTCAAATGGTAATAGTAATTTAGTGCCTGCGAATGTTCCAAATACCAGGTTTTCGGGATATTCATCGTTTCGAT CACCAGACTCACGAAAACCAACACTACCGTTACCTTTGCAAACCAAATCACAAACGTCATCTCCAGCTAGTGCTGTA GCACCAGGTTTACCATTGACAGGAGGAAGCAATGCATATTTTGCAGGAATGCAACAATCACCCGTGGGTGGTTCGTA TGTCAATTATCCAGCCCAAGTATATCAGCAGTATCAACAGTTCCAAAATCAACTACAACTACAAGAACAACAACAGC AACAGCAAAAACAACAATCTCAGCCGCAGCCATCATCGCAACTGGTTGGAAATCAAAATGCACAATTGGAATCAGCA GCACGATTCCGTTCTGGTTTACCGACAGGGACACAATTTAATAATGGTGAACAAACACCAATTTCAGGATTGCCATC ACGATACGTTAATGATATGTTCCCCTTCCCATCTCCATCAAACTTTCTTGCACCTCAAGATTGGCCATCAGGTATAA CACCAACTACTCATCTACCACAGTATTTTGTGAATATGCCATTGAGTGGAATTGGACTGCAACAACTGCAACAACAA CAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAGCAACA ACAGCAACAACAGCAGCAGAATGCCCAACAGCAACTGCAAGTACCTGTTATCCCAATACAAACACAAACATCACAAC AAATGGCTTCAACTACCAATCACAAATCAGCTAATCTAATACCAGGGTTTTTACAAAACCCAACACAAGCCACTGGA AATTCGGCAAATGCTTCCAAGCTGAGTGATGCTGGTGATGGTACTAATCCAACCACAGCAGGAAGTTCAAGTTCAGC AGATGTCAATAACACCAACAATGGACCTAATAAAAATACATAA

The invention has the benefit that

1, robenidine hydrochloride fungistatic effect is significant, and minimal inhibitory concentration is 4 μM and is lower than common fluconazole as antifungal medicine, Under same concentrations dosage, the fungistatic effect of robenidine hydrochloride is more significant.

2, robenidine hydrochloride still has good killing effect for the fungal bacterial strain for generating drug resistance, therefore for clinically The antifungal agent resistance status generally occurred provides a kind of potential feasible solution.

3, robenidine hydrochloride has same good fungistatic effect for ear candida albicans, this is to future therapeutic " super fungi " Caused disease has certain reference.

4, present invention finds the drug targets that cell wall and transcription factor RLM1 are robenidine hydrochloride treatment fungal infection.

5, robenidine hydrochloride just occurs cytotoxicity at 64 μM, and it has been reported that with the animal of the feeding with medicine, Musculature drug concentration is extremely low, much smaller than the dosage being detrimental to health, so, the toxicity of robenidine hydrochloride is low, safety Reliably.

Detailed description of the invention

Fig. 1 is in embodiment 1, and Candida albicans is respectively by Fluconazole and robenidine hydrochloride treated growth curve.Its In, A figure is dose-effect relationship of the Fluconazole in YPD culture medium；Dosage-of the B figure robenidine hydrochloride in YPD culture medium Effect relation.

Fig. 2 is in embodiment 2, and robenidine hydrochloride compares the fungistatic effect of clinical fluconazole resistant strain and ear candida albicans Figure, wherein A figure is that Fluconazole and robenidine hydrochloride compare the docs-effect of Candida albicans in YPD culture medium；B figure is Fluconazole and robenidine hydrochloride compare the docs-effect of drug-fast bacteria #16 in YPD culture medium；C figure is Fluconazole and hydrochloric acid chlorine Benzene guanidine compares the docs-effect of drug-fast bacteria #17 in YPD culture medium；D figure is that Fluconazole and robenidine hydrochloride are cultivated in YPD The docs-effect of ear candida albicans is compared in base.

Fig. 3 is fungistatic effect comparison diagram of the robenidine hydrochloride to other pathomycetes in embodiment 3.Wherein, A figure is salt Bacteriostasis of the sour Robenidine for Candida albicans；B figure is bacteriostasis of the robenidine hydrochloride for S. cervisiae；C figure It is robenidine hydrochloride for the bacteriostasis of Cryptococcus neoformans；D figure is bacteriostasis of the robenidine hydrochloride for aspergillus fumigatus.

Fig. 4 is in embodiment 4, and robenidine hydrochloride compares the influence that Candida albicans mycelia generates in different culture medium Figure.Wherein, A figure is mycelia growth of the Candida albicans in Spider culture medium；B figure is Candida albicans in M199 culture medium In mycelia growth；C figure is that Candida albicans in YPD adds the mycelia in 10% cow's serum culture medium to grow.

Fig. 5 is in embodiment 5, and robenidine hydrochloride inhibits the biofilm development figure of Candida albicans.A figure is biofilm formation Comparative result figure of taking pictures；B figure be to A figure at biomembrane carry out quantitative analysis figure comparison diagram.

Fig. 6 is influence result figure of the robenidine hydrochloride drug to white Candida cell wall in embodiment 6, wherein A figure It is albicans cell under varying environment pressure to the stress reaction comparison diagram of robenidine hydrochloride；B is the survey of Ah Xinlan decoration method Determine cell wall integrity comparison diagram.

Fig. 7 is the transmission electron microscope photo pair of albicans cell wall after robenidine hydrochloride processing in embodiment 6 Than figure.

Fig. 8 is influence comparison diagram of the robenidine hydrochloride to different cell-wall components in embodiment 6.A figure is cell wall sweet dew The fluorescein isothiocynate coloration result figure of glycan；B figure is CFW (calcium fluorescence is white) the fluorescent staining experiment of cell wall chitin；C Figure is WGA-lectin (wheat agglutinin) the fluorescent staining experiment quantitative analysis figure of cell wall exposure chitin.

Fig. 9 is in embodiment 6, and the activation that cell wall repairs approach is printed by the albumen of index growthing cell crude protein extract Mark method measurement chart.

Figure 10 is in embodiment 6, and Candida albicans is through robenidine hydrochloride treated RNA sequencing result analysis chart.

Figure 11 is in embodiment 7, lactic dehydrogenase (LDH) method for releasing detect robenidine hydrochloride to FaDu epithelial cell and The cytotoxicity test figure of RAW-BLUE macrophage.

Specific embodiment

Below with reference to embodiment, the invention will be further described:

Robenidine hydrochloride used in experiment of the invention is purchased from Targetmol company.

Embodiment 1

Candida albicans is respectively by Fluconazole and robenidine hydrochloride treated growing state experimental conditions.

A fritter strain inoculated is taken out in albicans strain to containing YPD solid culture from freezing with aseptic inoculation ring In base, (15 hours) are incubated overnight in 30 DEG C of insulating boxs；After bacterial strain is incubated overnight, washed twice with sterile PBS；Use microplate reader Bacterial concentration is measured, and accesses YPD culture medium, makes its OD₆₀₀=0.4；By the robenidine hydrochloride and Fluconazole that are dissolved in DMSO point It is not dissolved in fresh YPD medium, and is configured to the concentration needed, 2 times of doubling dilutions are done in 96 orifice plates, are added later 200 μ l are supplied in every hole by the pre-arranged culture medium containing bacterium solution of 100 μ l, and such bacterial concentration is OD₆₀₀=0.2, drug Concentration be followed successively by from low to high 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 32 μM shake up after measure its OD₆₀₀, and often measure every other hour Once, until 24 hours.It is specific as shown in Figure 1.A figure is dose-effect relationship of the Fluconazole in YPD culture medium；B figure hydrochloric acid Dose-effect relationship of the Robenidine in YPD culture medium.(SC5314, that is, Candida albicans, Flu represent Fluconazole, and Robe is represented Robenidine hydrochloride is replaced below with this).

The absorbance value OD of Candida albicans bacterium solution₆₀₀For index, the growth concentration of cell is monitored.To robenidine hydrochloride and Treated respectively obtains after albicans growth curve analyzed for Fluconazole, under 30 DEG C of constant temperature, by bacterial strain After cultivating 24 hours in YPD culture medium, compared to control group, robenidine hydrochloride has more obvious fungistatic effect, and growth is bent Line is at level curve, OD₆₀₀Value is unchanged in 24 hours, and Candida albicans life can be completely inhibited in 16 μM of concentration Long, by figure, it can be concluded that, the MIC (minimum inhibitory concentration) of robenidine hydrochloride is 4 μM, less than the MIC of positive control Fluconazole.With Upper experiment shows that robenidine hydrochloride has the effect for preferably inhibiting albicans growth compared to Fluconazole under Isodose Fruit.

Embodiment 2

Fungistatic effect situation of the robenidine hydrochloride to clinical fluconazole resistant strain and ear candida albicans

For experimentation with embodiment 1, test strain has changed antibody-resistant bacterium and ear candida albicans into.

Experimental result is as shown in Fig. 2, compared with Fluconazole control group, and robenidine hydrochloride is to two plants of drug-fast bacterias #16 and #17 (the Candida albicans persister extracted in the tumour patient body of clinical treatment), which is shown, has apparent antibacterial work With, and in the cell of various concentration processing, robenidine hydrochloride has dose-dependent effect, to the inhibiting effect of cell It gradually increases from low to high.In addition, this experiment equally joined ear candida albicans, can be obtained by the D in Fig. 2, robenidine hydrochloride for Ear candida albicans equally has very strong inhibitory effect, this has good clinical meaning for treating super fungal infection.

Fig. 2A is that Fluconazole and robenidine hydrochloride compare the docs-effect of Candida albicans in YPD culture medium；Fig. 2 B The docs-effect of drug-fast bacteria #16 is compared in YPD culture medium for Fluconazole and robenidine hydrochloride；Fig. 2 C is Fluconazole and salt Sour Robenidine compares the docs-effect of drug-fast bacteria #17 in YPD culture medium；Fig. 2 D is Fluconazole and robenidine hydrochloride in YPD The docs-effect of ear candida albicans is compared in culture medium.

Embodiment 3

Robenidine hydrochloride is for S. cervisiae (Saccharomyces cerevisiae), Cryptococcus neoformans (Cryptococcus neoformans) and aspergillus fumigatus (Aspergillus fumigatus) these types human body common causative The fungistatic effect of fungi is significant.

Experimentation is with embodiment 1, and only test strain has changed S. cervisiae, Cryptococcus neoformans, aspergillus fumigatus into.

For experimental result as shown in figure 3, the growth curve of saccharomyces cerevisiae and Candida albicans is very close, minimum inhibitory concentration is equal It is 4 μM；Aspergillus fumigatus and Cryptococcus neoformans dose-effect relationship are obvious, and can completely inhibit Candida albicans in 32 μM of concentration Bacterium grows (growth curve is in a horizontal state within 48 hours).It can illustrate that robenidine hydrochloride is several for this by testing above The clinical common causative fungi of kind has good inhibitory effect.

Fig. 3 A is bacteriostasis of the robenidine hydrochloride for Candida albicans；Fig. 3 B is robenidine hydrochloride for saccharomyces cerevisiae The bacteriostasis of bacterium；Fig. 3 C is bacteriostasis of the robenidine hydrochloride for Cryptococcus neoformans；Fig. 3 D is robenidine hydrochloride for cigarette The bacteriostasis of Aspergillus.

Embodiment 4

The influence situation that robenidine hydrochloride generates mycelia.

There are three types of form, that is, yeast type, pseudohypha type and mycelia types for Candida albicans tool, and wherein mycelia, which generates, reads white Pearl bacterium is caused a disease most important.For the influence that detection robenidine hydrochloride generates mycelia, we in different culture mediums by luring Lead mycelia.

1) a fritter strain inoculated is taken out in bacterial strain to containing in YPD solid medium from freezing with aseptic inoculation ring, (15 hours) are incubated overnight in 30 DEG C of insulating boxs；

2) it after bacterial strain is incubated overnight, is washed twice with sterile PBS；

3) bacterial concentration is measured with microplate reader, and accesses YPD+10% cow's serum culture medium, M199 culture medium, Spider training Base is supported, its OD is made₆₀₀=0.001.DMSO control group, 4 μM of Robenidine are set, and 8 μM of Robenidine groups are separately added into The DMSO of respective concentration and configured Robenidine medical fluid.It is put into 37 DEG C of insulating box cultures after mixing, is used respectively after 2h, 4h Micro- sem observation is simultaneously taken pictures, and object lens multiple is 40*.

Experiment discovery, after 37 DEG C of Spider and M199 culture medium are cultivated 2 hours, Candida albicans in dosing group with Yeast type form exists, and does not observe that mycelia generates, and the growth of control group mycelia is obvious；In the YPD training containing 10% cow's serum It supports in base, dosing group is observed that the generation of mycelia, but by compared with the control group as can be seen that dosing group Hyphal length It is significantly shorter than control group.The above the results show, in different mycelia induced mediums, robenidine hydrochloride can inhibit The generation of Candida albicans mycelia.

Cell initial concentration OD₆₀₀=0.001,37 DEG C of results of taking pictures after culture 2 hours are shown in Fig. 4 in three kinds of culture mediums.Figure 4A is mycelia growth of the Candida albicans in Spider culture medium；Fig. 4 B is mycelia of the Candida albicans in M199 culture medium Growth；Fig. 4 C adds the mycelia in 10% cow's serum culture medium to grow for Candida albicans in YPD.

Embodiment 5

The formational situation of robenidine hydrochloride inhibition Candida albicans biomembrane.

1) by the RPMI-1640 culture medium inoculated of the bacterium solution containing Candida albicans of 100 μ l into 96 orifice plates 1 to 11 column, In the 12nd column 8 holes as blank control, bacterium solution is not added.Certain concentration gradient, each concentration setting 3 is arranged in each drug A technology repeats；

2) 96 orifice plates are covered after being inoculated with, is sealed with sealed membrane, is placed in 37 DEG C of incubator cultures for 24 hours；

3) after 24-48h, the biofilm formation with three-dimensional structure, so that it may be used for subsequent antifungal drug sensibility Test.Specific incubation time is fixed according to the target of research, starts to stick culture 4h if it is research

4) after biofilm formation, culture solution is gently sucked out；

5) it is washed 1 time with sterile PBS

6) robenidine hydrochloride is configured to certain working concentration in RPMI-1640 culture solution.With multiple gun head liquid-transfering gun The drug working solution of 200 μ l is added to 96 orifice plates the 1st to arrange in corresponding hole；

7) RPMI of 100 μ l is all added in the hole of 2 to 11 column, 12 column are added without liquid as negative control；

8) it draws 100 μ l liquid from the 1st each hole of column to be added in the 2nd column corresponding aperture, gently piping and druming mixes；

9) it draws 100 μ l liquid from the 2nd each hole of column to be added in the 3rd column corresponding aperture, gently piping and druming mixes；

10) it is repeated in above step, the 10th column is added to and terminates；(the 11st column and the 12nd column respectively as positive control and Negative control does not need to do any processing)

11) 96 orifice plate lids are covered, are coated with preservative film, 37 DEG C of incubators are incubated for for 24 hours；

12) need to prepare the more test tubes containing 10ml XTT solution according to experimental design, each is all added the first of 1 μ l Naphthoquinones makes final concentration of 1 μM of menadione.；

13) the XTT solution containing menadione of 100 μ l is added in every hole of 96 orifice plates；

14) 37 DEG C of incubation 2-3h are put in by 96 orifice plates with Aluminium Foil Package；

15) plate is opened, the visible each hole of 96 orifice plate of naked eyes is in orange and has certain gradual change with drug concentration.Prepare one piece newly 96 orifice plates, with multiple gun head liquid-transfering gun from original plate draw 75-80 μ l solution into new plate.New plate is placed in enzyme mark OD is read in instrument₄₉₂；

16) the metabolic activity inhibition level of each hole biomembrane is calculated according to absorbance value reading, and with Graphpad software It draws；

We are by biofilm experiments, as a result as shown in figure 5, such as Fig. 5 A, from left to right robenidine hydrochloride drug from 0 to 128 μM gradually rise, and bacterium solution also becomes to clarify therewith, and bacterium amount gradually decreases；Fig. 5 B is that the biomembrane formed to figure A is determined Measure analysis chart；Since 32 μM, biofilm formation is gradually decreased, and biomembrane reduces 50% at 64 μM, it was demonstrated that robenidine hydrochloride can To inhibit the formation of Candida albicans biomembrane.

Embodiment 6

The Mechanism Validation of robenidine hydrochloride inhibition fungi.

1) Candida albicans needs to cope with the pressure from host's microenvironment constantly during with host's symbiosis, because This bacterial strain in long-term evolutionary process itself produces corresponding stress reaction.To inquire into whether robenidine hydrochloride influences white Candida albicans is to the stress reaction of ambient pressure, to inhibit the growth of Candida albicans.This experiment uses solid medium contact plate Method.Bacterial strain on each piece of solid medium is arranged as the four column five-element, and each bacterial strain contains there are two repetition and five dilution gradients, Wherein top line candida albicans concentration is OD₆₀₀=0.5, downward 5 times of concentration gradients dilution makes OD₆₀₀Respectively 0.5, 0.1,0.02,0.004,0.0008,3 μ l bacterium solutions are added dropwise in each point.It takes pictures after being cultivated 24 hours at 30 DEG C.The result shows that in 1M Sodium chloride, 0.1% lauryl sodium sulfate (SDS), 0.7M calcium chloride, 200 white (the Calco Fluor of μ g/ml calcium fluorescence White), under the different stressed condition of 200 μ g/ml Congo red (Congo Red), 10 μM of caffeines (Caffeine), Suo Youjia The albicans growth of medicine group ("+") is more sensitive to robenidine hydrochloride compared to control group, especially to wherein and carefully The relevant one group of processing of cell wall pressure is most sensitive, illustrates that robenidine hydrochloride processing produces brokenly the cell wall of Candida albicans It is bad, therefore growth of Candida albicans under the conditions of different ambient pressures is inhibited, the mechanism of action of this prompt robenidine hydrochloride It is possible that related with cell wall integrity signal.

Fig. 6 is influence of the robenidine hydrochloride drug to white Candida cell wall, and A figure is that white is read under varying environment pressure Stress reaction of the pearl bacterium cell to robenidine hydrochloride；B is Ah Xinlan Determination Staining cell wall integrity, and data indicate dyestuff knot The average magnitude of conjunction.* * * p < 0.0001.

2), we have detected cell wall through the microstructure before and after drug-treated by transmission electron microscope.As shown in fig. 7, right Complete according to group (DMSO processing) cell wall, the camber line of cell outline is smooth and uniform, and after 8 μM of robenidine hydrochlorides are handled, cell goes out The phenomenon that cell wall damage is thinning, and cell liquid leaks out to gap is showed.After concentration is increased to 16 μM, robenidine hydrochloride processing group is thin There is the phenomenon that cell wall atrophy, more cell liquid leak in born of the same parents, and experiment shows that robenidine hydrochloride destroys Candida albicans Cell wall.

3), the specific ingredient being destroyed for detection cell wall, we have carried out a series of experiments again, and it is total several to use detection The CFW decoration method of fourth matter content, the FITC decoration method of the total mannosan of cell wall and the WGA- for being exposed to outer chitin content Lectin fluorescence colour.By Fig. 8 A as it can be seen that the fluorescence intensity of cell is much higher than drug-treated group in control group, and pass through fluorescence Quantitative analysis, the difference is extremely significant, has statistical significance.Control group visible cell wall is by level dyeing in Fig. 8 B, in parental generation There is highlighted signal, as cell wall chitin ingredient in the position combined with progeny cell, and after agent-feeding treatment on cell wall Remitted its fury, it is unobvious the position intensity connected in two cells, therefore total mannosan is significant after drug-treated It reduces.Fig. 8 C be with WGA-lectin dyeing to treated, cell carries out fluorescent staining, thus detect be exposed to it is extracellular Chitin ingredient, * * * * p < 0.0001.By quantitative analysis, the chitin content that the cell after drug-treated exposes is reduced, And the difference has statistical significance.The above result shows that the chitin with after the drug therapy, on albicans cell wall Matter is destroyed, and mannosan total amount is decreased obviously.

4), further to identify the downstream signaling pathway for participating in robenidine hydrochloride and destroying cell wall, we have detected participation The Mkc1 kinase signal pathway of albicans cell wall integrity.We handle within 1 hour and 2 hours to cell respectively Afterwards, it collects cell and carries out Western blot experiment, detected by phosphorylation Mkc1 antibody, use Tubulin as loading Control.As shown in Figure 9, it has been found that there are dose-effect relationships for the phosphorylation of Mkc1 in the cell of different pharmaceutical concentration processing. When robenidine hydrochloride concentration is increased to 16 μM by 4 μM, the phosphorylation of Mkc1 is increased with drug concentration is presented gradient type increase, Signal is most strong at 16 μM, and treated within 2 hours that signal will be weaker than 1 hour processing group.Should the result shows that, cell wall by When the destruction of robenidine hydrochloride, Mkc1 phosphorylation is significantly increased, and has activated the stress reaction of cell, while prolonging with the time Long, the phosphorylation of Mkc1 reduces.In Fig. 9, cell wall repairs the activation of approach by the egg of index growthing cell crude protein extract White blotting measurement.The MKC1 albumen of phosphorylation p44/42 antibody test phosphorylation (activation).Swimming lane 1 is control group, and cell is used Dmso treatment, 2 cell of swimming lane, 4 μM of robenidine hydrochloride handle a hour, 3 cell of swimming lane, 8 μM of hydrochloric acid chlorine Benzene guanidine handles a hour, and 4 cell of swimming lane is with 16 μM of robenidine hydrochloride, one hour of processing, 5 cell of swimming lane, 4 μM of hydrochloric acid Robenidine handles two hours, and 6 cell of swimming lane is with 8 μM of robenidine hydrochloride, two hours of processing, 7 cell of swimming lane, 16 μM of salt Sour Robenidine handles two hours, and swimming lane 8 is also control group, cell dmso treatment.

5), Candida albicans is analyzed as shown in Figure 10 through robenidine hydrochloride treated RNA sequencing result.Through hydrochloric acid chlorobenzene Guanidine extracts RNA after handling 90 minutes and carries out sequencing analysis, is compared with the result of DMSO control group.

For the gene expression profile of cell after further investigation robenidine hydrochloride processing, we are trained in 30 DEG C of shaking tables by liquid Base culture Candida albicans, the final cell for collecting agent-feeding treatment and control group different time points are supported, extract RNA builds library sequencing Data analysis is carried out afterwards, and as a result it is as shown in the table.One of crucial transcription factor RLM1 expresses significant raising after 90 min, RLM1 is generated to Candida albicans mycelia and biofilm formation plays a significant role, and it is main that RLM1 missing can significantly change cell wall The ratio of ingredient such as increases chitin content, reduces the content of glucan and mannosan.From 90 minutes white of agent-feeding treatment The result of candida albicans and the comparison of control group RNA sequence can be seen that (shown in arrow) that the expression of drug-treated group RLM1 increases 8 Times or so, it is consistent with the cell wall constituent testing result of other results of study report.This implies that RLM1 is likely to drug effect One of important gene target spot.

Embodiment 7

Toxotest

Experiment using endothelial cell FaDu and macrophage RAW-BLUE as mode cell, in conjunction with LDH method to various concentration at Cell activity after reason is detected.Lactic dehydrogenase (LDH) method for releasing detect robenidine hydrochloride to FaDu epithelial cell and The cytotoxicity of RAW-BLUE macrophage.It is incubated for altogether after cell culture 24 hours with robenidine hydrochloride, in 37 DEG C and 5%CO₂ Under the conditions of be incubated for 2 hours after according to kit specification method detection LDH release, measure OD with spectrophotometer₄₉₂Value is For toxicity value.

The result shows that the drug only has cytotoxicity more than 64 μM of concentration, and the effectively inhibition chosen in testing is dense Degree is below 64 μM, therefore used concentration of the drug in terms of inhibiting albicans growth is comparatively safe.

The above is presently preferred embodiments of the present invention, but the present invention should not be limited to disclosed in the embodiment Content.So all do not depart from the lower equivalent or modification completed of spirit disclosed in this invention, the model that the present invention protects is both fallen within It encloses.

Sequence table

<110>Medical College, Shanghai Communication Univ.

<120>application of the robenidine hydrochloride in preparation treatment fungal infection drug

<141> 2019-07-24

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1806

<212> DNA

<213> RLM1

<400> 1

atgggtagaa gaaagattga aatagaacca ttgacagacg atagaaatcg tacagtgact 60

tttgtgaagc gtaaggcagg gttatttaaa aaagctcatg aattagctgt gctctgtcaa 120

gtggatttaa cggttattat cgttggcaat aataataaag tatatgaata ttctactgtt 180

gaggcaaatg agatttttaa tgcctataat aaaaccatta aagtcagaaa acaagtacat 240

gaatcgaagt ctccagaata ttattcgaaa tttagaaaga aacgacattt aaatgaacca 300

cttatgaata aatcagggtc tgtagttggc actaatacac atttgaacga tgaagactat 360

gatcataatg ttcatgaagc gggcgatgag gattcggaat atgaaagcga tgataattct 420

ccacaaccta aacggcacaa aagatcagag tcggttaaaa aagagcaaaa ccccaaagtg 480

tttaatagta cccaacctcc accaccgcct ccaccacctc atatatcttt aaataatgtt 540

ccaacattta ccaaccccca aaattacaaa aaacagattg atgagacaaa taacacttcg 600

gcaccgcccg ctactgggac aaaaaatgaa ccaacgatgc aacgaccagt attgagggta 660

caaataccga atgatgccaa gagcaatacg aataattccc atagtggtgt taataatagt 720

gatggcaagg acacggcgag aacagtgacg gcagtcgaca atagtgcaac caaccaaaac 780

actcaatcga gcaatacaac atcaggtaca gggactgctg ataccaattc atcgcaacta 840

aattcaaatg gtaatagtaa tttagtgcct gcgaatgttc caaataccag gttttcggga 900

tattcatcgt ttcgatcacc agactcacga aaaccaacac taccgttacc tttgcaaacc 960

aaatcacaaa cgtcatctcc agctagtgct gtagcaccag gtttaccatt gacaggagga 1020

agcaatgcat attttgcagg aatgcaacaa tcacccgtgg gtggttcgta tgtcaattat 1080

ccagcccaag tatatcagca gtatcaacag ttccaaaatc aactacaact acaagaacaa 1140

caacagcaac agcaaaaaca acaatctcag ccgcagccat catcgcaact ggttggaaat 1200

caaaatgcac aattggaatc agcagcacga ttccgttctg gtttaccgac agggacacaa 1260

tttaataatg gtgaacaaac accaatttca ggattgccat cacgatacgt taatgatatg 1320

ttccccttcc catctccatc aaactttctt gcacctcaag attggccatc aggtataaca 1380

ccaactactc atctaccaca gtattttgtg aatatgccat tgagtggaat tggactgcaa 1440

caactgcaac aacaacaaca acaacaacaa caacaacaac aacaacaaca acaacaacaa 1500

caacaacaac aacaacaaca acaacagcaa caacagcaac aacagcagca gaatgcccaa 1560

cagcaactgc aagtacctgt tatcccaata caaacacaaa catcacaaca aatggcttca 1620

actaccaatc acaaatcagc taatctaata ccagggtttt tacaaaaccc aacacaagcc 1680

actggaaatt cggcaaatgc ttccaagctg agtgatgctg gtgatggtac taatccaacc 1740

acagcaggaa gttcaagttc agcagatgtc aataacacca acaatggacc taataaaaat 1800

acataa 1806

Claims

1. application of the robenidine hydrochloride in preparation treatment fungal infection drug.

2. application according to claim 1, it is characterised in that: the fungi includes Mycotoruloides, Cryptococcus, saccharomycete Belong to, the bacterial strain in Eurotium.

3. application according to claim 2, it is characterised in that: the bacterial strain of the Mycotoruloides is Candida albicans；It is described The bacterial strain of Cryptococcus is Cryptococcus neoformans；The bacterial strain of the brewer yeast Pseudomonas is S. cervisiae；The bacterium of the Eurotium Strain is aspergillus fumigatus.

4. application according to claim 1, it is characterised in that: the fungi includes drug resistant fungal, super fungi.

5. application according to claim 4, it is characterised in that: the drug resistant fungal is Candida albicans persister；Institute Stating super fungi is ear candida albicans.

6. a kind of drug for treating fungal infection, it is characterised in that the drug is that drug target is controlled by transcription factor RLM1 The substance for the treatment of.

7. the drug for the treatment of fungal infection according to claim 6, which is characterized in that include in the effective component of the substance Robenidine hydrochloride.

8. a kind of drug for treating fungal infection, it is characterised in that the drug is that drug target is treated by fungal cell wall Substance.

9. the drug for the treatment of fungal infection according to claim 8, which is characterized in that include in the effective component of the substance Robenidine hydrochloride.