CN110241236B - Specific PCR primer, kit and application for identifying rhodobacter capsulatus - Google Patents
Specific PCR primer, kit and application for identifying rhodobacter capsulatus Download PDFInfo
- Publication number
- CN110241236B CN110241236B CN201910516176.5A CN201910516176A CN110241236B CN 110241236 B CN110241236 B CN 110241236B CN 201910516176 A CN201910516176 A CN 201910516176A CN 110241236 B CN110241236 B CN 110241236B
- Authority
- CN
- China
- Prior art keywords
- rhodobacter capsulatus
- seq
- primer
- specific pcr
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000191023 Rhodobacter capsulatus Species 0.000 title claims abstract description 52
- 238000000034 method Methods 0.000 claims abstract description 23
- 238000001514 detection method Methods 0.000 claims abstract description 15
- 241000894006 Bacteria Species 0.000 claims description 10
- 230000000243 photosynthetic effect Effects 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000000137 annealing Methods 0.000 claims description 7
- 108010006785 Taq Polymerase Proteins 0.000 claims description 6
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 5
- 239000012634 fragment Substances 0.000 claims description 5
- 238000011144 upstream manufacturing Methods 0.000 claims description 4
- 239000002068 microbial inoculum Substances 0.000 claims 1
- 230000035945 sensitivity Effects 0.000 abstract description 3
- 239000002775 capsule Substances 0.000 abstract 1
- 239000000047 product Substances 0.000 description 14
- 239000006228 supernatant Substances 0.000 description 13
- 239000000523 sample Substances 0.000 description 12
- 230000003321 amplification Effects 0.000 description 7
- 238000003199 nucleic acid amplification method Methods 0.000 description 7
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 6
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- 241000238557 Decapoda Species 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 4
- 239000012154 double-distilled water Substances 0.000 description 4
- 230000008014 freezing Effects 0.000 description 4
- 238000007710 freezing Methods 0.000 description 4
- 239000007788 liquid Substances 0.000 description 4
- 238000010257 thawing Methods 0.000 description 4
- 239000013642 negative control Substances 0.000 description 3
- 239000013641 positive control Substances 0.000 description 3
- 239000002244 precipitate Substances 0.000 description 3
- 239000008223 sterile water Substances 0.000 description 3
- 238000005406 washing Methods 0.000 description 3
- 108020004465 16S ribosomal RNA Proteins 0.000 description 2
- 108010067770 Endopeptidase K Proteins 0.000 description 2
- 241000282414 Homo sapiens Species 0.000 description 2
- 241000191043 Rhodobacter sphaeroides Species 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 239000003674 animal food additive Substances 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 230000012010 growth Effects 0.000 description 2
- 230000036039 immunity Effects 0.000 description 2
- 239000012160 loading buffer Substances 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 230000000813 microbial effect Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 238000002205 phenol-chloroform extraction Methods 0.000 description 2
- 238000005303 weighing Methods 0.000 description 2
- 241001474374 Blennius Species 0.000 description 1
- 241000459479 Capsula Species 0.000 description 1
- 241000195493 Cryptophyta Species 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 241000251511 Holothuroidea Species 0.000 description 1
- 241000191025 Rhodobacter Species 0.000 description 1
- 241000190950 Rhodopseudomonas palustris Species 0.000 description 1
- 125000003275 alpha amino acid group Chemical group 0.000 description 1
- 238000003975 animal breeding Methods 0.000 description 1
- 238000009360 aquaculture Methods 0.000 description 1
- 244000144974 aquaculture Species 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 238000010876 biochemical test Methods 0.000 description 1
- 230000003115 biocidal effect Effects 0.000 description 1
- 239000012472 biological sample Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000003337 fertilizer Substances 0.000 description 1
- 238000010413 gardening Methods 0.000 description 1
- 239000002054 inoculum Substances 0.000 description 1
- 239000012263 liquid product Substances 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 230000008635 plant growth Effects 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a specific PCR primer, a kit and application for identifying rhodobacter capsulatus, which comprise the following primer pairs: SEQ ID NO:1 and SEQ ID NO:2, and (b) a primer pair shown in the figure; SEQ ID NO:3 and SEQ ID NO:4, and (b) a primer pair shown in the specification; and SEQ ID NO:5 and SEQ ID NO:6 under the control of a control panel. The specific PCR primer provided by the invention has strong specificity to rhodobacter capsulatus, and solves the problem of poor specificity to capsules in the traditional method. The primer is utilized to establish the method for identifying the rhodobacter capsulatus, the method has the advantages of good specificity, strong stability and high sensitivity, the appearance of false positive can be well controlled in the detection process, and meanwhile, the detection accuracy of the rhodobacter capsulatus is improved.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a specific PCR primer for identifying rhodobacter capsulatus, a kit containing the primer and application.
Background
The problems of natural environment pollution and antibiotic resistance in the process of animal breeding are increasingly serious, and how to adopt a new technology and a new method to promote health and guarantee safe production becomes the key of sustainable development of human beings or not, and becomes a research hotspot at home and abroad, and in fact, the problem is the bottleneck problem of further development of the biological industry. Under the background, physiological and biochemical characteristics of rhodobacter capsulatus play an important role in human life and production, and the rhodobacter capsulatus is widely researched and applied in the aspects of water quality purification, aquaculture, crops, gardening and the like. In Chinese patent application No. 201610367225.X, a prawn feed containing rhodobacter capsulatus strain and its application report that a rhodobacter capsulatus strain is used as feed additive for prawn culture, so as to greatly increase growth rate of prawn and enhance immunity of prawn. A rhodobacter capsulatus with a Chinese patent application number of 2012100922031.5 and application thereof report that the rhodobacter capsulatus can produce some small organic molecules, so that plant growth is stimulated, and disease-resistant immunity of plants is improved. A rhodobacter capsulatus with a Chinese patent application number of 2013105011364.3 and application thereof report that a rhodobacter capsulatus can secrete biological enzymes in a pond to gradually decompose macroalgae, so that the excessive growth of the algae is controlled, the culture environment of sea cucumbers is improved, and the aim of improving the pond culture yield of aquatic organisms is fulfilled.
In view of the versatility of rhodobacter capsulatus, rhodobacter capsulatus will be widely used in microbial fertilizers and feed additives. In order to ensure the use effect of the products containing rhodobacter capsulatus, the rhodobacter capsulatus in the products needs to be identified and counted. Because products containing photosynthetic bacteria, especially liquid products, are mostly brownish red in color, it is difficult to judge the rhodobacter capsulatus from the color and label of the products. The traditional photosynthetic bacteria identification needs morphological characteristics and physiological and biochemical tests, the operation steps are complex, and the detection time is long. The traditional 16S rDNA detection can not effectively distinguish species with closer evolutionary relationships sometimes, and particularly in rhodobacter in photosynthetic bacteria, the traditional 16S rDNA identification has low accuracy in identifying rhodobacter capsulatus and rhodobacter sphaeroides. Therefore, a more specific PCR method is urgently needed for identifying rhodobacter capsulatus. To date, no report has been made on the specific PCR detection of rhodobacter capsulatus.
Disclosure of Invention
Based on the technical problems that the operating steps of the method for identifying rhodobacter capsulatus in the prior art are long in detection time and poor in specificity, the invention provides the primer which is strong in specificity to rhodobacter capsulatus, simple to operate, short in detection time, high in sensitivity and strong in stability in the identification process.
A specific PCR primer for identifying rhodobacter capsulatus comprises the following primer pairs:
SEQ ID NO:1 and SEQ ID NO:2, and (b) a primer pair shown in the figure;
the amino acid sequence of SEQ ID NO:3 and SEQ ID NO:4, and (b) a primer pair shown in the specification;
and SEQ ID NO:5 and SEQ ID NO: 6.
The invention also provides a kit, which comprises the specific PCR primer, taq DNA polymerase, dNTP and DNA template
The invention also provides application of the specific PCR primer or the kit in identifying rhodobacter capsulatus.
In some embodiments, the method of application comprises the steps of:
s1, extracting total DNA of a sample to be detected;
s2, carrying out PCR amplification on the total DNA by using the specific PCR primer of claim 1;
and S3, carrying out agarose gel electrophoresis detection on the amplified product of the S2.
In some embodiments, the sample to be tested is selected from a single colony of photosynthetic bacteria or a product of a photosynthetic bacteria inoculant.
In some embodiments, the amplification system of the PCR comprises: taq DNA polymerase 0.5. Mu.l, dNTP 0.5. Mu.l, upstream and downstream primers 0.5. Mu.l each, and DNA template 100ng.
In some embodiments, the amplification process of PCR comprises an annealing process under the following conditions: annealing at 52-56 deg.c for 1min.
In some embodiments, in the agarose gel electrophoresis image obtained in step S3, if 1 strip appears in a lane, the sample to be tested is determined to be from rhodobacter capsulatus; and if no strip appears on the lane, judging that the sample to be detected is not from rhodobacter capsulatus.
In some embodiments, if 1 band appears in the lane, the length of the PCR-amplified DNA fragment is 300bp.
The specific PCR primer provided by the invention has strong specificity to rhodobacter capsulatus, and solves the problem of poor specificity to capsula in the traditional method. The primer is utilized to establish a method for identifying the rhodobacter capsulatus, the method has the advantages of good specificity, strong stability and high sensitivity, the appearance of false positive can be well controlled in the detection process, and meanwhile, the detection accuracy of the rhodobacter capsulatus is improved; in addition, the method can detect the existence of the rhodobacter capsulatus in biological samples such as microbial agents besides single colonies, and can know whether the rhodobacter capsulatus exists in the samples or not through specific PCR amplification only by obtaining the genomic DNA in the samples, thereby effectively solving the problems of single detection target and weak specificity of detection primers.
Drawings
FIG. 1 is a schematic flow diagram of some embodiments of the present disclosure;
FIG. 2 is an agarose gel electrophoresis of the amplification product of example 1.
Detailed Description
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
Example 1
Referring to fig. 1, a method for identifying rhodobacter capsulatus includes the steps of:
1. extraction of DNA from bacterial colony to be tested
Weighing 1.0g of sample, washing, placing the thallus in a 1.5mL centrifuge tube, immediately placing the thallus in liquid nitrogen for complete freezing, taking out the thallus, placing the thallus in a 65 ℃ water bath for slow thawing, repeatedly freezing and thawing for 3 times, then adding 0.1mL 10% SDS and 10.0 μ l 10mg/mL proteinase K, shaking for 2h at 200r/min in a 37 ℃ constant temperature shaking table, centrifuging for 10min at 10000g at room temperature, collecting supernatant and transferring the supernatant to another centrifuge tube. Adding chloroform with the same volume as the supernatant, centrifuging for 10min at 10000g, sucking the supernatant, transferring to another centrifuge tube for phenol chloroform extraction for 2 times, transferring the supernatant to another centrifuge tube, adding isopropanol with 2 times of the volume of the supernatant to precipitate DNA, centrifuging to remove the supernatant, washing the DNA precipitate with 70% ethanol for 2 times, adding double distilled water to dissolve the DNA, and storing at-20 ℃.
2. Amplification of specific primers for rhodobacter capsulatus
10 ul of reaction system, 0.5 ul of upstream and downstream primers, 0.5 ul of Taq DNA polymerase, 0.5 ul of dNTP, 100ng of DNA template, and 10 ul of double distilled water. PCR amplification conditions: pre-denaturing at 94 ℃ for 4min, denaturing at 94 ℃ for 1min, annealing at 56 ℃ for 1min, extending at 72 ℃ for 30s and 30 cycles, extending at 72 ℃ for 10min, and preserving the product at 4 ℃ after PCR is finished.
The primer sequence is as follows:
seq1 forward primer: 5' GGGAAATTGGAATGGGCGAAGAT-3
Seq1 reverse primer: 5' GGTCGATCAGCGTGCTGAA
Seq2 forward primer: 5' GGAAGCGCGTCTGTTCAAATAC-3
Seq2 reverse primer: 5' TCGATGACCTTCCAGTTGATGAATTC-3
Seq3 forward primer: 5' ATGCGGGAACGCAGATA-3
Seq3 reverse primer: 5' ATGGTCGGAGCGAGAGGAT-doped 3
3. Detection of PCR products
After the reaction, 5. Mu.l of the PCR product was added to 1. Mu.l of 6 Xbromophenol blue loading buffer and electrophoresed on 2% agarose gel at 110V for 35min. And (3) ultraviolet photographing, taking the DNA of the rhodobacter capsulatus CGMCC1.3366 containing the target amplified fragment as a positive control, taking sterile water as a negative control, and determining whether the rhodobacter capsulatus is contained in the sample according to whether an expected characteristic band appears at 300bp.
The amplification effect is shown in 2, lanes 1-3 are sterile water negative control, lanes 4-6 are positive control of capsular rhodobacter capsulatus CGMCC1.3366 containing the target amplification fragment, lanes 7-9 are unknown sample 1, lanes 10-12 are rhodobacter sphaeroides CGMCC1.3368, and lanes 13-15 are rhodopseudomonas palustris CGMCC 1.2180.
The above examples show that the primers provided by the invention are specific to rhodobacter capsulatus.
Example 2
A method of identifying rhodobacter capsulatus comprising the steps of:
1. DNA extraction from photosynthetic bacteria products
Weighing 1.0g photosynthetic bacteria solid sample (if liquid sample, firstly centrifuging the bacteria liquid, taking 1.0g precipitate), then placing the thallus into a 1.5mL centrifuge tube, immediately placing into liquid nitrogen for completely freezing, taking out and placing into a 65 ℃ water bath for slowly thawing, repeatedly freezing and thawing for 3 times, then adding 0.1mL 10% SDS and 10.0 μ l 10mg/mL proteinase K, shaking for 2h in a 37 ℃ constant temperature shaking table at 200r/min, centrifuging for 10min at 10000g at room temperature, collecting supernatant and transferring into another centrifuge tube. Adding chloroform with the same volume as the supernatant, mixing thoroughly, centrifuging for 10min at 10000g, sucking the supernatant, transferring to another centrifuge tube for phenol chloroform extraction for 2 times, transferring the supernatant to another centrifuge tube, adding isopropanol with 2 times of the volume of the supernatant to precipitate DNA, centrifuging to remove the supernatant, washing the DNA precipitate with 70% ethanol for 2 times, adding double distilled water to dissolve the DNA, and storing at-20 ℃.
2. Amplification of specific primers for rhodobacter capsulatus
10 ul of reaction system, 0.5 ul of each of the upstream and downstream primers, 0.5 ul of Taq DNA polymerase, 0.5 ul of dNTP, 100ng of DNA template, and 10 ul of double distilled water. PCR amplification conditions: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 1min, annealing at 56 ℃ for 1min, extension at 72 ℃ for 30s for 30 cycles, extension at 72 ℃ for 10min, and preserving the product at 4 ℃ after PCR.
The primer sequence is as follows:
seq1 forward primer: 5' GGGAAATTGGAATGGGCGAAGAT-3
Seq1 reverse primer: 5' GGTCGATCAGCGTGCTGAA
Seq2 forward primer: 5' GGAAGCGCGTCTGTTCAAATAC-3
Seq2 reverse primer: 5' TCGATGACCTTCCAGTTGATGAATTC-3
Seq3 forward primer: 5' ATGCGGGAACGCAGATA-3
Seq3 reverse primer: 5' ATGGTCGGAGCGAGAGGAT-doped 3
3. Detection of PCR products
After the reaction, 5. Mu.l of the PCR product was added to 1. Mu.l of 6 Xbromophenol blue loading buffer and electrophoresed on 2% agarose gel at 110V for 35min. And (3) ultraviolet photographing, taking the DNA of the rhodobacter capsulatus CGMCC1.3366 containing the target amplified fragment as a positive control, taking sterile water as a negative control, and determining whether the rhodobacter capsulatus is contained in the sample according to whether an expected characteristic band appears at 300bp. If a characteristic band appears at 300bp, the sample contains rhodobacter capsulatus; if no characteristic band appears at 300bp, the sample does not contain rhodobacter capsulatus.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Hunan agriculture university
<120> specific PCR primer for identifying rhodobacter capsulatus, kit and application
<141> 2019-06-12
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 1
gggaaattggaatgggcgaagat 23
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 2
ggtcgatcagcgtgctgaa 19
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 3
ggaagcgcgtctgttcaaatac 22
<210> 4
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 4
tcgatgaccttccagttgatgaattc 26
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 5
atgcgggaacgcgcagata 19
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 6
atggtcggagcgagaggat 19
Claims (9)
1. A specific PCR primer for identifying rhodobacter capsulatus is characterized by comprising the following primer pairs:
SEQ ID NO:1 and SEQ ID NO:2, and (b) a primer pair shown in the figure;
SEQ ID NO:3 and SEQ ID NO:4, and a primer pair shown in the specification;
and SEQ ID NO:5 and SEQ ID NO:6 in the sequence table;
the specificity of the specific PCR primer to rhodobacter capsulatus is strong.
2. A kit comprising the specific PCR primer of claim 1, taq DNA polymerase, dNTP and DNA template.
3. Use of the specific PCR primer of claim 1 or the kit of claim 2 for identifying rhodobacter capsulatus.
4. The application according to claim 3, characterized in that the method of application comprises the steps of:
s1, extracting total DNA of a sample to be detected;
s2, respectively carrying out PCR amplification on the total DNA by using the three pairs of specific PCR primers of claim 1;
and S3, carrying out agarose gel electrophoresis detection on the product amplified in the step S2.
5. The use of claim 4, wherein the sample to be tested is selected from a photosynthetic bacteria single colony or a photosynthetic bacteria microbial inoculum product.
6. The use of claim 4, wherein the PCR amplification system comprises: taq DNA polymerase 0.5. Mu.L, dNTP 0.5. Mu.L, upstream and downstream primers 0.5. Mu.L, DNA template 100ng.
7. The use of claim 4, wherein the PCR amplification process comprises an annealing process, and the conditions of the annealing process are as follows: annealing at 52-56 deg.c for 1min.
8. The application of claim 4, wherein in the agarose gel electrophoresis image obtained in step S3, if 1 band appears in a lane, the sample to be detected is judged to be from rhodobacter capsulatus; and if no strip appears on the lane, judging that the sample to be detected is not from rhodobacter capsulatus.
9. The use according to claim 8, wherein the length of the PCR-amplified DNA fragment is 300bp if 1 band is present in the lane.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910516176.5A CN110241236B (en) | 2019-06-14 | 2019-06-14 | Specific PCR primer, kit and application for identifying rhodobacter capsulatus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910516176.5A CN110241236B (en) | 2019-06-14 | 2019-06-14 | Specific PCR primer, kit and application for identifying rhodobacter capsulatus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110241236A CN110241236A (en) | 2019-09-17 |
| CN110241236B true CN110241236B (en) | 2022-11-11 |
Family
ID=67887175
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910516176.5A Active CN110241236B (en) | 2019-06-14 | 2019-06-14 | Specific PCR primer, kit and application for identifying rhodobacter capsulatus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110241236B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102618469A (en) * | 2012-03-31 | 2012-08-01 | 福建安野高新农业开发有限公司 | Rhodobacter capsulatus and application thereof |
| CN103667109A (en) * | 2013-10-23 | 2014-03-26 | 大连市水产技术推广总站 | Rhodobacter capsulatus and application thereof |
| CN105861390A (en) * | 2016-05-30 | 2016-08-17 | 天津师范大学 | Rhodobacter capsulatus strain as well as screening method and application thereof |
| CN106987540A (en) * | 2017-04-25 | 2017-07-28 | 昆明理工大学 | One plant of Rhodobacter capsulatus and its application |
-
2019
- 2019-06-14 CN CN201910516176.5A patent/CN110241236B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102618469A (en) * | 2012-03-31 | 2012-08-01 | 福建安野高新农业开发有限公司 | Rhodobacter capsulatus and application thereof |
| CN103667109A (en) * | 2013-10-23 | 2014-03-26 | 大连市水产技术推广总站 | Rhodobacter capsulatus and application thereof |
| CN105861390A (en) * | 2016-05-30 | 2016-08-17 | 天津师范大学 | Rhodobacter capsulatus strain as well as screening method and application thereof |
| CN106987540A (en) * | 2017-04-25 | 2017-07-28 | 昆明理工大学 | One plant of Rhodobacter capsulatus and its application |
Non-Patent Citations (3)
| Title |
|---|
| Rhodobacter capsulatus SB 1003, complete genome;Strnad,H.等;《GENBANK》;20140131;全文 * |
| 不产氧光合细菌分离鉴定及其产氢菌株的快速筛选;邓春浩等;《西北农业学报》;20160714;第25卷(第8期);1187-1194 * |
| 荚膜红细菌的分离鉴定及其协同固氮作用;朱美珍等;《微生物学通报》;19991231;第26卷(第5期);342-344 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110241236A (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN116042896B (en) | Index molecular marker for identifying SP-A strain of She Xiu cocci and application | |
| Hai-Feng et al. | Effect of different bacterial-feeding nematode species on soil bacterial numbers, activity, and community composition | |
| Naganandhini et al. | Persistence of pathogenic and non-pathogenic Escherichia coli strains in various tropical agricultural soils of India | |
| Chinivasagam et al. | Detection of Arcobacter spp. in piggery effluent and effluent‐irrigated soils in southeast Queensland | |
| Liu et al. | Effects of a nutrient additive on the density of functional bacteria and the microbial community structure of bioorganic fertilizer | |
| Al-Mariri et al. | Prevalence of Listeria spp. in raw milk in Syria. | |
| CN105755143B (en) | A kind of kit and detection method for being used to detect bacterium | |
| Soon et al. | Microbiological and physicochemical analysis of water from Empurau fish (Tor tambroides) farm in Kuching, Sarawak, Malaysian Borneo | |
| CN110241236B (en) | Specific PCR primer, kit and application for identifying rhodobacter capsulatus | |
| CN104403958B (en) | One plant can effectively suppress the bacillus cereus NY5 of Rofe source of fish Streptococcusagalactiae | |
| CN105602945A (en) | Detection primer group, detection kit, and detection method used for simultaneous detection of three pathogenic bacteria of marine fishes | |
| CN109355404B (en) | Primer, kit and detection method for isothermal detection of listeria monocytogenes based on polymerase helix reaction | |
| CN106801103A (en) | A kind of detection primer group of Streptococcusagalactiae, detection kit and multi-PCR detection method | |
| CN105755116B (en) | Primer and its application with microsatellite marker mutually chain whether Eriocheir sinensis sex premature | |
| CN105087814B (en) | A kind of the multiplex PCR detection primer and detection method of detection four kinds of pathogens of sheep | |
| Pejchalová et al. | Presence of Arcobacter species in pet cats and dogs in the Czech Republic | |
| Amusan et al. | Isolation and identification of Listeria monocytogenes in fresh croaker (pseudotolithus senegalensis) | |
| KR101478921B1 (en) | Primer for loop-mediated isothermal amplification reaction for detecting Arcobacter spp., and method for detecting Arcobacter spp. using the same | |
| Fadaeifard et al. | Molecular identification of Yersinia ruckeri isolates by polymerase chain reaction test in rainbow trout, Oncorhynchus mykiss | |
| CN106868134B (en) | Real-time quantitative PCR detection method for spores/gametes of ulva aquatica, ulva scleoides and hemerocallis fulva in sea cucumber culture water | |
| CN110923342A (en) | RPA detection primer, kit and detection method for sweet potato blast bacteria | |
| Ghazali et al. | Molecular identification of bacterial communities from vegetables samples as revealed by DNA sequencing of universal primer 16S rRNA gene | |
| CN108950033B (en) | Nano PCR kit for simultaneously detecting enterohemorrhagic escherichia coli O45 and O145 and application thereof | |
| De Visscher | Effect of biochar and chitin on plant defense and rhizosphere microbiome of strawberry | |
| Amusan et al. | PREVALENCE OF LISTERIA SPECIES IN BLUE WHITING (MICROMESISTUS POUTASOU) IN LAGOS STATE, NIGERIA. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20231204 Address after: Room 605, Hualing New City Landmark Building, No. 208 Laodong Road, Guitang Street, Yuhua District, Changsha City, Hunan Province, 410007 Patentee after: Hunan Kesai'an Biotechnology Co.,Ltd. Address before: 410128, No. 1, Nongda Road, Furong district, Hunan, Changsha Patentee before: Hunan Agricultural University |
|
| TR01 | Transfer of patent right |