CN110241134A - A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain - Google Patents
A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain Download PDFInfo
- Publication number
- CN110241134A CN110241134A CN201810190466.0A CN201810190466A CN110241134A CN 110241134 A CN110241134 A CN 110241134A CN 201810190466 A CN201810190466 A CN 201810190466A CN 110241134 A CN110241134 A CN 110241134A
- Authority
- CN
- China
- Prior art keywords
- antibody
- recombinant plasmid
- expression
- expression vector
- light chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
- C07K2317/41—Glycosylation, sialylation, or fucosylation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Abstract
The invention belongs to field of biotechnology, and in particular to a method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain.The present invention often studies antibody producing with cell strain CHO-lec2, has been surprisingly found that and is overexpressed GT under the genetic background of this cell strain, can significantly improve galactose content in the sugar chain of antibody expressed by CHO-lec2 cell.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of transformation CHO-lec2 cell improves gala in antibody sugar chain
The method of sugared content.
Background technique
Antibody plays an important role in terms of disease treatment, and ADC (antibody drug coupling) class antibody medicine is due to its idol
Len antibody and small molecular cell drug toxicity progress into the focus of research with efficient target killing.Pass through antibody glycosylation
The ADC that coupling is realized gradually obtains the extensive concern of people.Human immunoglobulin according to the difference of heavy chain property be divided into IgG,
It is 5 kinds of IgM, IgA, IgE, IgD, clinically the most commonly used for IgG.Have in Fc sections of IgG heavy chain of the region CH2 one it is conservative
N- glycosylation site Asn297.The glycosylation structure in the site is the complicated double antenna model of core fucosylation, in difference
Glycosyl transferase under the action of, fucose, galactolipin, mannose, sialic acid etc. are added on sugar chain respectively, shows antibody
The heterogeneity of height.The inhomogeneity of antibody glycosylation is that the big technical problem for realizing ADC is coupled by glycosyl.
Summary of the invention
In order to overcome the problems of in the prior art, the purpose of the present invention is to provide a kind of transformation CHO-lec2 is thin
The method that born of the same parents improve galactose content in antibody sugar chain.
To achieve the goals above and other related purposes, the present invention adopts the following technical scheme:
The first aspect of the present invention provides a kind of method for expressing antibody, includes the following steps:
(1) construction recombination plasmid: GT gene is inserted into the first expression vector, GT recombinant plasmid is constructed, by heavy chain of antibody
Encoding gene is inserted into the second expression vector, constructs heavy chain of antibody recombinant plasmid, and antibody light chain encoding gene is inserted into the
In three expression vectors, antibody light chain recombinant plasmid is constructed；
(2) by step (1) GT recombinant plasmid obtained, heavy chain of antibody recombinant plasmid and antibody light chain recombinant plasmid corotation
Dye carries out antibody expression into CHO-lec2 cell, and separation obtains antibody in expression product.
Further, in step (1), the nucleotide sequence of the GT gene is as shown in SEQ ID NO.1.
Further, in step (1), first expression vector be selected from pcDNA3.1 (+) (Ampicillin), pVAX,
PCMV, pGL, pMZ etc..
Further, in step (1), the GT gene be inserted into the restriction enzyme site in the first expression vector it
Between.For example, the GT gene be inserted into HindIII enzyme and XhoI enzyme in the first expression vector restriction enzyme site it
Between.
Further, in step (1), second expression vector is selected from pLONZA, pcDNA, pVAX, pCMV, pGL, pMZ
Deng.
Further, in step (1), the heavy chain of antibody encoding gene is inserted into the restriction enzyme in the second expression vector
Between enzyme site.For example, the heavy chain of antibody encoding gene is inserted into the limitation of BamH I and EcoRI in the second expression vector
Between property restriction enzyme site.
Further, in step (1), the third expression vector is selected from pLONZA, pcDNA, pVAX, pCMV, pGL, pMZ
Deng.
Further, in step (1), the antibody light chain encoding gene is inserted into the restriction enzyme in third expression vector
Between enzyme site.For example, the antibody light chain encoding gene is inserted into the limitation of BamH I and EcoRI in third expression vector
Between property restriction enzyme site.
Further, in step (1), specifically: GT gene is inserted into the first expression by the method for digestion, connection and carries
Body, the first connection product transformed competence colibacillus cell screen the carrier correctly connected as the successful GT recombinant plasmid of building.Antibody
Heavy chain encoding gene is inserted into the second expression vector by the method for digestion, connection, the second connection product transformed competence colibacillus cell,
The carrier correctly connected is screened as the successful heavy chain of antibody recombinant plasmid of building.Antibody light chain encoding gene passes through digestion, connects
The method connect is inserted into third expression vector, and third connection product transformed competence colibacillus cell screens the carrier conduct correctly connected
Construct successful antibody light chain recombinant plasmid.
Further, in step (2), between GT recombinant plasmid, heavy chain of antibody recombinant plasmid and antibody light chain recombinant plasmid
Mass ratio range be (2-5): (50): (50).
Further, in step (2), the GT recombinant plasmid, heavy chain of antibody recombinant plasmid and antibody light chain recombinant plasmid
Cotransfection is into the CHO-lec2 cell of adhered state.
Further, in step (2), when cotransfection, used transfection tools are Freestyle MAX transfection reagent.
Freestyle MAX transfection reagent can be obtained by commercially available approach.Such as it can be Thermo Fisher Scientific public affairs
The product F reeStyle MAX's (article No. 16447100) of department.
Further, the antibody can be IgG antibody.Such as, but not limited to Herceptin antibody.
The second aspect of the present invention provides afore mentioned antibodies expression in the purposes for the galactose content for improving antibody.
Further, afore mentioned antibodies expression is for improving galactose content in antibody sugar chain.
Further, afore mentioned antibodies expression for improve in antibody sugar chain G1F type galactose content and
/ or G2F type galactose content.
Further, the antibody can be IgG antibody.Such as, but not limited to Herceptin antibody.
The third aspect of the present invention provides the method for galactose content in a kind of sugar chain of raising antibody, includes in step
Step (1) and (2) in afore mentioned antibodies expression.
Further, the antibody can be IgG antibody.Such as, but not limited to Herceptin antibody.
Compared with prior art, the invention has the following beneficial effects:
The present invention often studies antibody producing with cell strain CHO-lec2, has been surprisingly found that the heredity in this cell strain
It is overexpressed GT under background, galactose content in the sugar chain of antibody expressed by CHO-lec2 cell can be significantly improved.
Detailed description of the invention
Fig. 1: the galactose content flow chart in the antibody of CHO-LEC2- cell expression is improved.
Fig. 2: GT is overexpressed plasmid map.
Fig. 3: expression condition test result.
Fig. 4: SDS-PAGE analysis antibody expression, antibody 200mM DTT, 70 DEG C of heating progress reduction treatment in 10 minutes.
Fig. 5: Lectin-blotting analysis GT is overexpressed the influence expressed Herceptin heavy chain galactolipin.
Fig. 6: mass spectral analysis is overexpressed influence of the GT to antibody sugar-type.
Specific embodiment
Before further describing the specific embodiments of the present invention, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiment；It is also understood that term used in the embodiment of the present invention is specific specific in order to describe
Embodiment, rather than limiting the scope of protection of the present invention.The test method of actual conditions is not specified in the following example,
Usually according to normal condition, or according to condition proposed by each manufacturer.
When embodiment provides numberical range, it should be appreciated that except non-present invention is otherwise noted, two ends of each numberical range
Any one numerical value can be selected between point and two endpoints.Unless otherwise defined, the present invention used in all technologies and
Scientific term is identical as the normally understood meaning of those skilled in the art of the present technique.Except specific method, equipment used in embodiment,
Outside material, grasp and record of the invention according to those skilled in the art to the prior art can also be used and this
Any method, equipment and the material of the similar or equivalent prior art of method described in inventive embodiments, equipment, material come real
The existing present invention.
Unless otherwise stated, disclosed in this invention experimental method, detection method, preparation method be all made of this technology neck
Molecular biology, biochemistry, chromatin Structure and the analysis of domain routine, analytical chemistry, cell culture, recombinant DNA technology and
The routine techniques of related fields.These technologies have perfect explanation in the prior art, and for details, reference can be made to Sambrook etc.
MOLECULAR CLONING:A LABORATORY MANUAL, Second edition, Cold Spring Harbor
Laboratory Press, 1989and Third edition, 2001；Ausubel etc., CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY, John Wiley&Sons, New York, 1987and periodic updates；the
Series METHODS IN ENZYMOLOGY, Academic Press, San Diego；Wolffe, CHROMATIN
STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998；METHODS IN
ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic
Press, San Diego, 1999；With METHODS IN MOLECULAR BIOLOGY, Vol.119, Chromatin
Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999 etc..
Embodiment 1
The present embodiment is tested by the expression of Herceptin antibody (Chinese means Trastuzumab antibody), demonstrates CHO-
GT gene (galactosyltransferase gene) is overexpressed in lec2 cell can be improved the galactose content in antibody sugar chain, test
Process is as shown in Figure 1, the specific steps are as follows:
(1) construction recombination plasmid: GT is overexpressed the building of plasmid, and plasmid map is as shown in Figure 2.According to Chinese hamster ovary
Cell (CHO) kind optimizes and is mutated synthesis GT gene, adds 5'(HindIII) and 3'(XhoI) restriction enzyme site, with recombination
Mode connects GT gene by 5'HindIII with 3'XhoI digestion, is cloned into carrier pcDNA3.1 (+) (Ampicillin)
In, connection product transformed competence colibacillus cell screens the carrier correctly connected as the successful GT recombinant plasmid of building.It needs to illustrate
, the nucleotide sequence of the GT gene as shown in SEQ ID NO.1, specifically:
>Human codon optimized GT gene(1197bp)
Atgcgcctgcgtgaacctctgctgagtggtagtgcagccatgcctggcgcaagtctgcagcgtgcatgccgcctgct
ggtggcagtgtgtgcactgcacctgggcgtgaccctggtgtattacctggccggccgcgatttaagccgtctgccgc
agctggttggtgtgagcaccccgttacagggcggtagtaatagtgcagccgccattggccagagcagcggtgagtta
cgtaccggcggcgcacgtccccctccccctttaggtgcaagcagccagccgcgtcctggtggcgatagtagcccggt
ggttgatagtggtccgggtccggccagtaatttaaccagcgtgccggttccgcacacaaccgccctgagtctgccgg
cctgtccggaggaaagtccgctgttagtgggtccgatgctgatcgaattcaacatgccggtggatctggaactggtg
gcaaagcagaatccgaacgtgaagatgggcggtcgttatgcaccgcgcgactgcgtgagtccgcacaaagtggccat
cattatcccgtttcgcaaccgtcaggagcacctgaagtattggctgtactacctgcatccggtgctgcagcgccagc
agctggactacggcatttacgtgatcaaccaggcaggcgataccatctttaaccgcgccaaactgctgaacgtgggt
ttccaggaagccctgaaggactatgactatacttgctttgtttttagtgatgtggacctgattccgatgaacgacca
taacgcctaccgctgcttcagccaaccgcgtcacatcagcgttgccatggacaaattcggctttagcctgccgtacg
ttcagtactttggcggcgtgagtgcactgagcaagcagcagttcctgaccatcaacggcttccctaacaactattgg
ggctggggtggcgaggatgacgacatttttaaccgcctggttttccgcggcatgagcatcagccgcccgaacgcagt
ggtgggtcgttgtcgcatgattcgccacagccgcgataagaaaaacgaaccgaacccgcagcgctttgaccgcatcg
cccacaccaaggaaaccatgctgagcgatggcctgaacagcctgacctaccaggtgctggacgttcaacgttacccg
ctgtatacccagatcaccgttgatattggtaccccgagctaa。
The nucleotide sequence of Herceptin heavy chain (HC) encoding gene as shown in SEQ ID NO.2, specifically:
>Herceptin HC(1407bp)
atggagttctggttgtcatgggtctttctggtagctattcttaagggagtacagtgtgaggtgcagcttgtcgaatc
cgggggagggctcgtccaacccggaggatcactgcgcctttcatgcgcagcctcgggtttcaatatcaaggacacgt
atatccattgggtgcggcaggcgccaggaaaaggtttggagtgggtcgcgaggatctaccccaccaatgggtacaca
cgatacgccgattcggtcaaggggcggttcacaatctcggcggacacgtcgaaaaacactgcgtacttgcagatgaa
tagcctccgcgcagaagatactgcggtgtattactgctcccgctggggaggtgatggcttctatgcgatggactatt
ggggacaaggaacacttgtaacggtcagctcggccagcaccaaggggccgtccgtgtttcccctcgccccctcgtcg
aagtcaactagcggcggaacagccgcccttggttgcctggtcaaggactacttccccgaaccggtcacggtgtcatg
gaactcgggagcattgacttcgggtgtgcatacatttcccgcagtgctccagtcatcaggactgtatagcctctcgt
ccgtcgtaacggtcccgtcatcgtcgctcgggacccagacatacatttgcaatgtcaaccacaaaccttcgaataca
aaggtggataagaaggtcgagccgccaaagtcgtgtgacaagacgcacacatgtcctccatgccctgcgcctgagtt
gctgggagggccgagcgtgttcctctttcctcccaagccgaaggacacactgatgatttcgaggacgcctgaggtaa
cttgcgtggtagtagatgtgtcccatgaggaccccgaagtaaagtttaactggtatgtggacggtgtggaggtccac
aatgccaaaaccaaaccgcgcgaagagcaatacaacagcacatatcgggtggtgagcgtgctcaccgtcttgcacca
ggactggctgaacgggaaagagtacaaatgtaaagtatcaaacaaagcgctccccgcacccattgaaaagactatct
caaaggctaagggacagcccagagagccacaagtctacacgctcccgccctcgagagatgagttgacgaagaatcag
gtcagccttacgtgcctcgtcaaagggttttacccatccgacattgcggtggaatgggaaagcaacggacagccaga
gaacaactacaagactacaccgcctgtgctggactcggatggttcgttcttcctctactcgaaattgactgtggaca
aatcccgctggcagcagggaaatgtgttctcgtgtagcgtaatgcatgaagcgttgcacaatcactatacccagaaa
tcgctctccctttcgcctggc。
The nucleotide sequence of Herceptin light chain (LC) encoding gene as shown in SEQ ID NO.3, specifically:
>Herceptin LC(708bp)
Atggatatgcgagtacccgcacaacttcttgggcttttgcttctgtggttgaggggagctagatgtgacatccagat
gacgcagtcgccgtcctcattgagcgcatccgtgggagacagagtcactattacatgccgggcatcccaagacgtaa
acacggccgtcgcctggtaccaacagaagcccggaaaagcgcccaaactgttgatctactccgcctcatttctgtac
agcggggtaccctcgaggttcagcggctcgaggagcgggacggatttcacgttgacaatttcgtcacttcagccgga
agattttgcgacatactattgccagcaacactataccacacccccgacgtttggccaggggaccaaagtcgagatca
agcggaccgtggccgctccgtcagtattcatcttcccgccgtccgatgagcaactcaagagcggaaccgcatcagtc
gtatgcttgctcaataacttctatccgcgagaggcgaaggtgcagtggaaagtggacaacgccctgcagtccggtaa
tagccaggaatcagtcacggagcaggattcaaaggattcgacctattccctctcgtcgacattgacgctgtcgaaag
cagactacgaaaaacataaagtgtacgcttgtgaagtgacacaccagggcctttcatccccggtgacaaagtcgttc
aatcgcggggagtgt。
Herceptin heavy chain (HC) encoding gene is inserted into pLONZA carrier by the method for digestion, connection, restriction enzyme site
For BamH I and EcoR I, it is successful as building to screen the carrier correctly connected for connection product transformed competence colibacillus cell
Herceptin heavy chain (HC) recombinant plasmid.Herceptin light chain (LC) encoding gene passes through digestion, the method insertion of connection
In pLONZA carrier, restriction enzyme site is BamH I and EcoR I, and connection product transformed competence colibacillus cell screens the load correctly connected
Body is as successful Herceptin light chain (LC) recombinant plasmid of building.
(2) expression condition is tested: testing 293Fectin, two kinds of transfection reagents of Freestyle MAX and CHO- respectively
LEC2- cell is adherent, suspend two kinds of transfection conditions, illustrates referring to transfection reagent, to CHO-lec2-Cell is transfected, and is used
Flow cytometry GFP cell proportion, as a result as shown in figure 3, with Freestyle MAX transfection reagent, adhered state
Under, it obtains highest transfection efficiency (81.9%), so that it is determined that transfection efficiency highest condition: Freestyle MAX transfection reagent, thin
Born of the same parents' adhered state.
(3) antibody expression:
Under the conditions of GT (- GT), the expression of Herceptin antibody is carried out: applying Freestyle MAX transfection reagent, it will
(1) Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid obtained in are according to recombinant plasmid
Plasmid mass ratio is 50:50, in the CHO-lec2 cell under cotransfection to adhered state, under the conditions of no GT (- GT), is carried out
The expression of Herceptin antibody, receives sample after 2-4 days, the purifying of antibody is carried out with protein A.It will express and purify anti-
Body restores under the conditions of 200mM DTT, 70 DEG C 10 minutes, analyzes antibody expression situation by SDS-PAGE.
Under the conditions of having GT (+GT), the expression of Herceptin antibody is carried out: applying Freestyle MAX transfection reagent, it will
(1) GT recombinant plasmid, Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid obtained in are pressed
Be 5:50:50 according to recombinant plasmid plasmid mass ratio, in the CHO-lec2 cell under cotransfection to adhered state, have GT (+
GT under the conditions of), the expression of Herceptin antibody is carried out, sample is received after 2-4 days, the purifying of antibody is carried out with protein A.It will
It expresses and the antibody purified restores under the conditions of 200mM DTT, 70 DEG C 10 minutes, antibody expression feelings are analyzed by SDS-PAGE
Condition.As a result as shown in figure 4, being overexpressed GT does not influence the normal expression of Herceptin.
Under the conditions of having GT (+GT), the expression of Herceptin antibody is carried out: applying Freestyle MAX transfection reagent, it will
(1) GT recombinant plasmid, Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid obtained in are pressed
Be 2:50:50 according to recombinant plasmid plasmid mass ratio, in the CHO-lec2 cell under cotransfection to adhered state, have GT (+
GT under the conditions of), the expression of Herceptin antibody is carried out, sample is received after 2-4 days, the purifying of antibody is carried out with protein A.It will
It expresses and the antibody purified restores under the conditions of 200mM DTT, 70 DEG C 10 minutes, antibody expression feelings are analyzed by SDS-PAGE
Condition.As a result same display, being overexpressed GT does not influence the normal expression of Herceptin.
(4) antibody Lectin-blotting is analyzed, and the Herceptin antibody given expression to is in 200mM DTT, 70 DEG C of heating
Under the conditions of handle and carry out SDS-PAGE after ten minutes, carry out Erythrina Cristagalli lectin by following steps
(ECL) it dyes: 1) transferring film；2) is closed；3) .ECL is incubated for；4) .Streptavidin-HRP is incubated for；5) develops the color.With
Lectin-blotting analyzes heavy chain (HC), identifies galactose content difference.
GT recombinant plasmid, Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid are according to weight
Group plasmids Plasmids mass ratio is that result such as Fig. 5 of this group of 5:50:50 is shown, GT overexpression can improve galactolipin in antibody and contain
Amount.The raising is compared in the case where referring to no GT expression.
GT recombinant plasmid, Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid are according to weight
Group plasmids Plasmids mass ratio is that the result of this group of 2:50:50 is equally shown, GT overexpression can improve galactolipin in antibody and contain
Amount.The raising is compared in the case where referring to no GT expression.
(5) antibody mass spectral analysis, the Herceptin antibody given expression to handle 10 under 200mM DTT, 70 DEG C of heating conditions
SDS-PAGE is carried out after minute, heavy chain and light interchain disulfide bond are opened, cut heavy chain carry out in gel digestion later
And mass spectral analysis.
GT recombinant plasmid, Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid are according to weight
Group plasmids Plasmids mass ratio is that result such as Fig. 6 of this group of 5:50:50 shows that being overexpressed GT can make antibody in CHO-
Galactose content (G1F+G2F) when expressing in lec2- cell improves, and can especially significantly improve to G2F type galactose content
(improving from 15.2% to 43.8%).The raising is compared in the case where referring to no GT expression.
GT recombinant plasmid, Herceptin heavy chain (HC) recombinant plasmid, Herceptin light chain (LC) recombinant plasmid are according to weight
Group plasmids Plasmids mass ratio is that the result of this group of 2:50:50 again shows that, being overexpressed GT can make antibody in CHO-lec2-
Galactose content (G1F+G2F) when expressing in cell improves, especially G2F type galactose content can be significantly improved (from
15.2% improves to 43.7%).The raising is compared in the case where referring to no GT expression.
The above, only presently preferred embodiments of the present invention, not to the present invention in any form with substantial limitation,
It should be pointed out that under the premise of not departing from the method for the present invention, can also be made for those skilled in the art
Several improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, are equivalent embodiment of the invention；Meanwhile all substantial technologicals pair according to the present invention
The variation, modification and evolution of any equivalent variations made by above-described embodiment, still fall within the range of technical solution of the present invention
It is interior.
Sequence table
<110>Shanghai Advanced Research Institute, Chinese Academy of Sciences
University, the Chinese Academy of Sciences
<120>a kind of method that transformation CHO-lec2- cell promotes galactose content in antibody sugar chain
<130> 181747
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1197
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atgcgcctgc gtgaacctct gctgagtggt agtgcagcca tgcctggcgc aagtctgcag 60
cgtgcatgcc gcctgctggt ggcagtgtgt gcactgcacc tgggcgtgac cctggtgtat 120
tacctggccg gccgcgattt aagccgtctg ccgcagctgg ttggtgtgag caccccgtta 180
cagggcggta gtaatagtgc agccgccatt ggccagagca gcggtgagtt acgtaccggc 240
ggcgcacgtc cccctccccc tttaggtgca agcagccagc cgcgtcctgg tggcgatagt 300
agcccggtgg ttgatagtgg tccgggtccg gccagtaatt taaccagcgt gccggttccg 360
cacacaaccg ccctgagtct gccggcctgt ccggaggaaa gtccgctgtt agtgggtccg 420
atgctgatcg aattcaacat gccggtggat ctggaactgg tggcaaagca gaatccgaac 480
gtgaagatgg gcggtcgtta tgcaccgcgc gactgcgtga gtccgcacaa agtggccatc 540
attatcccgt ttcgcaaccg tcaggagcac ctgaagtatt ggctgtacta cctgcatccg 600
gtgctgcagc gccagcagct ggactacggc atttacgtga tcaaccaggc aggcgatacc 660
atctttaacc gcgccaaact gctgaacgtg ggtttccagg aagccctgaa ggactatgac 720
tatacttgct ttgtttttag tgatgtggac ctgattccga tgaacgacca taacgcctac 780
cgctgcttca gccaaccgcg tcacatcagc gttgccatgg acaaattcgg ctttagcctg 840
ccgtacgttc agtactttgg cggcgtgagt gcactgagca agcagcagtt cctgaccatc 900
aacggcttcc ctaacaacta ttggggctgg ggtggcgagg atgacgacat ttttaaccgc 960
ctggttttcc gcggcatgag catcagccgc ccgaacgcag tggtgggtcg ttgtcgcatg 1020
attcgccaca gccgcgataa gaaaaacgaa ccgaacccgc agcgctttga ccgcatcgcc 1080
cacaccaagg aaaccatgct gagcgatggc ctgaacagcc tgacctacca ggtgctggac 1140
gttcaacgtt acccgctgta tacccagatc accgttgata ttggtacccc gagctaa 1197
<210> 2
<211> 1407
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atggagttct ggttgtcatg ggtctttctg gtagctattc ttaagggagt acagtgtgag 60
gtgcagcttg tcgaatccgg gggagggctc gtccaacccg gaggatcact gcgcctttca 120
tgcgcagcct cgggtttcaa tatcaaggac acgtatatcc attgggtgcg gcaggcgcca 180
ggaaaaggtt tggagtgggt cgcgaggatc taccccacca atgggtacac acgatacgcc 240
gattcggtca aggggcggtt cacaatctcg gcggacacgt cgaaaaacac tgcgtacttg 300
cagatgaata gcctccgcgc agaagatact gcggtgtatt actgctcccg ctggggaggt 360
gatggcttct atgcgatgga ctattgggga caaggaacac ttgtaacggt cagctcggcc 420
agcaccaagg ggccgtccgt gtttcccctc gccccctcgt cgaagtcaac tagcggcgga 480
acagccgccc ttggttgcct ggtcaaggac tacttccccg aaccggtcac ggtgtcatgg 540
aactcgggag cattgacttc gggtgtgcat acatttcccg cagtgctcca gtcatcagga 600
ctgtatagcc tctcgtccgt cgtaacggtc ccgtcatcgt cgctcgggac ccagacatac 660
atttgcaatg tcaaccacaa accttcgaat acaaaggtgg ataagaaggt cgagccgcca 720
aagtcgtgtg acaagacgca cacatgtcct ccatgccctg cgcctgagtt gctgggaggg 780
ccgagcgtgt tcctctttcc tcccaagccg aaggacacac tgatgatttc gaggacgcct 840
gaggtaactt gcgtggtagt agatgtgtcc catgaggacc ccgaagtaaa gtttaactgg 900
tatgtggacg gtgtggaggt ccacaatgcc aaaaccaaac cgcgcgaaga gcaatacaac 960
agcacatatc gggtggtgag cgtgctcacc gtcttgcacc aggactggct gaacgggaaa 1020
gagtacaaat gtaaagtatc aaacaaagcg ctccccgcac ccattgaaaa gactatctca 1080
aaggctaagg gacagcccag agagccacaa gtctacacgc tcccgccctc gagagatgag 1140
ttgacgaaga atcaggtcag ccttacgtgc ctcgtcaaag ggttttaccc atccgacatt 1200
gcggtggaat gggaaagcaa cggacagcca gagaacaact acaagactac accgcctgtg 1260
ctggactcgg atggttcgtt cttcctctac tcgaaattga ctgtggacaa atcccgctgg 1320
cagcagggaa atgtgttctc gtgtagcgta atgcatgaag cgttgcacaa tcactatacc 1380
cagaaatcgc tctccctttc gcctggc 1407
<210> 3
<211> 708
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
atggatatgc gagtacccgc acaacttctt gggcttttgc ttctgtggtt gaggggagct 60
agatgtgaca tccagatgac gcagtcgccg tcctcattga gcgcatccgt gggagacaga 120
gtcactatta catgccgggc atcccaagac gtaaacacgg ccgtcgcctg gtaccaacag 180
aagcccggaa aagcgcccaa actgttgatc tactccgcct catttctgta cagcggggta 240
ccctcgaggt tcagcggctc gaggagcggg acggatttca cgttgacaat ttcgtcactt 300
cagccggaag attttgcgac atactattgc cagcaacact ataccacacc cccgacgttt 360
ggccagggga ccaaagtcga gatcaagcgg accgtggccg ctccgtcagt attcatcttc 420
ccgccgtccg atgagcaact caagagcgga accgcatcag tcgtatgctt gctcaataac 480
ttctatccgc gagaggcgaa ggtgcagtgg aaagtggaca acgccctgca gtccggtaat 540
agccaggaat cagtcacgga gcaggattca aaggattcga cctattccct ctcgtcgaca 600
ttgacgctgt cgaaagcaga ctacgaaaaa cataaagtgt acgcttgtga agtgacacac 660
cagggccttt catccccggt gacaaagtcg ttcaatcgcg gggagtgt 708
Claims (14)
1. a kind of method for expressing antibody, includes the following steps:
(1) construction recombination plasmid: GT gene is inserted into the first expression vector, constructs GT recombinant plasmid, heavy chain of antibody is encoded
Gene is inserted into the second expression vector, constructs heavy chain of antibody recombinant plasmid, antibody light chain encoding gene is inserted into third table
Up in carrier, antibody light chain recombinant plasmid is constructed；
(2) extremely by step (1) GT recombinant plasmid obtained, heavy chain of antibody recombinant plasmid and antibody light chain recombinant plasmid cotransfection
In CHO-lec2 cell, antibody expression is carried out, separation obtains antibody in expression product.
2. antibody expression method according to claim 1, which is characterized in that the nucleotide sequence such as SEQ of the GT gene
Shown in ID NO.1.
3. antibody expression method according to claim 1, which is characterized in that further include in following characteristics in step (1)
Any one is multinomial: (1) first expression vector be selected from pcDNA3.1 (+) (Ampicillin), pVAX, pCMV, pGL,
pMZ；(2) second expression vector is selected from pLONZA, pcDNA, pVAX, pCMV, pGL, pMZ；(3) the third expression vector
Selected from pLONZA, pcDNA, pVAX, pCMV, pGL, pMZ.
4. antibody expression method according to claim 1, which is characterized in that further include in following characteristics in step (1)
Any one is multinomial: (1) the GT gene is inserted between the restriction enzyme site in the first expression vector；(2) described anti-
Weight chain encoding gene is inserted between the restriction enzyme site in the second expression vector；(3) antibody light chain encodes base
Because being inserted between the restriction enzyme site in third expression vector.
5. antibody expression method according to claim 1, which is characterized in that further include in following characteristics in step (1)
Any one is multinomial: (1) the GT gene is inserted into the restricted digestion of HindIII enzyme and XhoI enzyme in the first expression vector
Between site；(2) the heavy chain of antibody encoding gene is inserted into the restriction enzyme of BamH I and EcoRI in the second expression vector
Between enzyme site；(3) the antibody light chain encoding gene is inserted between the restriction enzyme site in third expression vector.
6. antibody expression method according to claim 1, which is characterized in that in step (1), specifically: GT gene passes through
Digestion, connection method be inserted into the first expression vector, the first connection product transformed competence colibacillus cell screens the load correctly connected
Body is as the successful GT recombinant plasmid of building；Heavy chain of antibody encoding gene is inserted into the second expression by the method for digestion, connection
Carrier, the second connection product transformed competence colibacillus cell screen the carrier correctly connected as successful heavy chain of antibody is constructed and recombinate
Plasmid；Antibody light chain encoding gene is inserted into third expression vector, the conversion sense of third connection product by the method for digestion, connection
By state cell, the carrier correctly connected is screened as the successful antibody light chain recombinant plasmid of building.
7. antibody expression method according to claim 1, which is characterized in that in step (2), GT recombinant plasmid, antibody weight
Mass ratio range between chain recombinant plasmid and antibody light chain recombinant plasmid is (2-5): (50): (50).
8. antibody expression method according to claim 1, which is characterized in that in step (2), the GT recombinant plasmid resists
Weight chain recombinant plasmid and antibody light chain recombinant plasmid cotransfection are into the CHO-lec2 cell of adhered state.
9. antibody expression method according to claim 1, which is characterized in that used when cotransfection in step (2)
Transfection tools are Freestyle MAX transfection reagent.
10. antibody expression method according to claim 1, which is characterized in that the antibody is IgG antibody.
11. purposes of the antibody expression method in the galactose content for improving antibody as described in any one of claim 1~10.
12. purposes according to claim 11, which is characterized in that the antibody expression method is for improving in antibody sugar chain
Galactose content.
13. purposes according to claim 11, which is characterized in that antibody expression method is for improving G1F in antibody sugar chain
Type galactose content and/or G2F type galactose content.
14. a kind of method of galactose content in sugar chain for improving antibody includes such as any one of claim 1~10 institute in step
State step (1) and (2) in antibody expression method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810190466.0A CN110241134A (en) | 2018-03-08 | 2018-03-08 | A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810190466.0A CN110241134A (en) | 2018-03-08 | 2018-03-08 | A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110241134A true CN110241134A (en) | 2019-09-17 |
Family
ID=67882134
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810190466.0A Pending CN110241134A (en) | 2018-03-08 | 2018-03-08 | A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110241134A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101460522A (en) * | 2006-04-11 | 2009-06-17 | 弗·哈夫曼-拉罗切有限公司 | Glycosylated antibodies |
| US20120003695A1 (en) * | 2009-02-25 | 2012-01-05 | Davidson Robert C | Metabolic engineering of a galactose assimilation pathway in the glycoengineered yeast pichia pastoris |
| CN106701823A (en) * | 2017-01-18 | 2017-05-24 | 上海交通大学 | Establishment and application of CHO cell line for producing fucose-free monoclonal antibody |
-
2018
- 2018-03-08 CN CN201810190466.0A patent/CN110241134A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101460522A (en) * | 2006-04-11 | 2009-06-17 | 弗·哈夫曼-拉罗切有限公司 | Glycosylated antibodies |
| US20120003695A1 (en) * | 2009-02-25 | 2012-01-05 | Davidson Robert C | Metabolic engineering of a galactose assimilation pathway in the glycoengineered yeast pichia pastoris |
| CN106701823A (en) * | 2017-01-18 | 2017-05-24 | 上海交通大学 | Establishment and application of CHO cell line for producing fucose-free monoclonal antibody |
Non-Patent Citations (3)
| Title |
|---|
| CELINE RAYMOND ET AL.: ""Production of α2,6-sialylated IgG1 in CHO cells"", 《MABS》 * |
| 丛宇婷 等: ""单克隆抗体药物糖基化修饰分析研究进展"", 《色谱》 * |
| 晁阳 等: ""治疗性抗体糖基化研究进展及应用"", 《山东化工》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101688204B (en) | Method for manufacturing a recombinant polyclonal protein | |
| RU2518340C2 (en) | Recombinant expression vector elements (reves) to enhance expression of recombinant proteins in host cells | |
| US7429380B2 (en) | Production of a multimeric protein by cell fusion method | |
| CN104640985A (en) | Transposition-mediated identification of specific binding or functional proteins | |
| WO2003048306A3 (en) | Polycistronic expression of antibodies | |
| CN109942709A (en) | The single domain antibody of anti-BCMA a kind of and its application | |
| CN110964111A (en) | anti-PD-L1 monoclonal antibody, antigen binding fragment thereof and application thereof | |
| CN105255895B (en) | MAR transcriptional regulatory elements and its expression system for the raising protein expression level of eukaryotic cell lines | |
| WO2017123242A1 (en) | A universal nucleic acid drug vector enhancing mrna stability and translatability | |
| CN110872349A (en) | Antibodies that bind human IL-4R, methods of making, and uses thereof | |
| CN109748965A (en) | Full source of people PD-L1 monoclonal antibody and its preparation method and application | |
| CN110241134A (en) | A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain | |
| CN110241133A (en) | A method of transformation CHO-K1 cell improves galactose content in antibody sugar chain | |
| EP1893757B1 (en) | Expression vector and methods of producing high levels of proteins | |
| CN108383908A (en) | Identification people source CTLA-4 and full human monoclonal antibody or the antibody fragment and its preparation method and application for blocking its function | |
| CN108558997A (en) | A kind of application of recombination fusion protein TIGIT-Fc and its resisting transplant rejection reaction | |
| Taupin et al. | Immunogenicity of HILDA/LIF either in a soluble or in a membrane anchored form expressed in vivo by recombinant vaccinia viruses | |
| CN110269933A (en) | A kind of preparation method and applications of rabies viruses subunit vaccine | |
| CN110050065A (en) | (EPIC) is separated after the early stage transfection of cell for biological products production | |
| Forconi et al. | Insight into the potential for DNA idiotypic fusion vaccines designed for patients by analysing xenogeneic anti‐idiotypic antibody responses | |
| CN111484558B (en) | Signal regulatory protein alpha fragment-anti-FcRn single-chain antibody fusion protein and preparation and application thereof | |
| CN110227153A (en) | A kind of preparation method and applications of porcine rotavirus subunit vaccine | |
| EP4059963A1 (en) | Molecule capable of binding to human 4-1bb, and application of molecule | |
| CN109970859A (en) | Glypican-3 specific antibody and its specific C AR-T cell | |
| CN112062848B (en) | anti-CD47 monoclonal antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190917 |