CN110241120A - Transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method - Google Patents
Transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method Download PDFInfo
- Publication number
- CN110241120A CN110241120A CN201910574989.XA CN201910574989A CN110241120A CN 110241120 A CN110241120 A CN 110241120A CN 201910574989 A CN201910574989 A CN 201910574989A CN 110241120 A CN110241120 A CN 110241120A
- Authority
- CN
- China
- Prior art keywords
- hypoxemia
- gene
- transcription
- translation
- multilevel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
The invention discloses transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method, nucleotide sequence is as shown in SEQ ID NO.1 in sequence table；Transcription, transcription after and translation after multilevel hypoxemia controlling gene purposes, the expression for hypoxemia Targeted-control therapeutic gene；A method of transcription, transcription after and translation after multilevel hypoxemia controlling gene hypoxemia Targeted-control therapeutic gene；The present invention can low expression not be expressed even under normoxic condition or in normal tissue to hypoxemia controlling gene, and up-regulation is expressed under low oxygen conditions or in ischemic tissue, and then while realizing effective treatment, the risk that therapeutic gene is overexpressed the adverse side effect that may cause is avoided or reduced.
Description
[technical field]
The invention belongs to multilevel hypoxemia regulates and controls after technical field of bioengineering, more particularly to transcription, transcription and after translation
Gene, application and its regulation method.
[background technique]
During ischemic related conditions (such as Ischemic Stroke) gene therapy, as a kind of foreign gene, if controlled
It treats gene not regulated and controled, adverse side effect, such as tumour, epilepsy may be caused if overexpression.In ischemic related conditions
There are ischaemic/hypoxemia microenvironment in the pathophysiological process of generation, for this feature, we can use ischemic/low
Oxygen Targeted-control system is realized to ischemic/hypoxemia Targeted-control of therapeutic gene expression, makes it under normoxic condition or just
Often low expression is not expressed even in tissue, and expresses up-regulation under low oxygen conditions or in ischemic tissue, and then effective realizing
Treatment while, avoid or reduce therapeutic gene and be overexpressed the risk of adverse side effect that may cause.
Gene expression refers to cell in life process, passes through transcription and translation hereditary information in DNA sequence is stored in,
It is transformed into biologically active protein molecule.Therefore we can before transcription, transcription after, translation after level to gene
Expression carries out ischemic/hypoxemia Targeted-control, as shown in Figure 1.
Mainly pass through wherein hypoxia inducible factor-1 (hypoxia inducible in the regulation of transcriptional level
Factor-1, HIF-1) and hypoxia responsible element (hypoxia responsive element, HRE) hypoxia specific combine after
Start the mechanism of downstream gene transcription to realize.Under normoxic condition, HIF-1 alpha expression level is lower, and extremely unstable,
It is degraded rapidly；But under hypoxemia/low-oxygen environment, the up-regulation of HIF-1 alpha expression level, stability enhancing form dimerization with HIF-1 β
After body, it is incorporated into the HRE of related gene, starts the transcription of downstream gene.5 copies are passed through in the research of our early periods
HRE realize the expression of the ischemic to therapeutic gene NT-3/hypoxemia Targeted-control in transcriptional level, but under normoxic condition
5HRE still will start the expression of downstream gene, although expression quantity is seldom.This just need to combine transcription after and translation after it is horizontal
Hypoxemia Targeted-control, to reduce or eliminate the gene expression of transcriptional level hypoxemia Targeted-control omission.
The hypoxemia end related gene 5'- or one section of the end 3'- non-translational region (untranslated can be passed through in post-transcriptional level
Regions, UTR) stability of mRNA is controlled to adjust the post-transcriptional level (Fig. 1) of gene.Contain Epo under normoxic condition
The mRNA's of the UTR of 3'- is unstable, is degraded rapidly；And the steady of mRNA can be enhanced in the end Epo 3'- UTR under low oxygen conditions
It is qualitative, and then increase related gene expression.
It is horizontal upon translation to be mainly adjusted by the stability for albumen, in the process in the middle part of HIF-1 α
Degradation (oxygen-dependent degradation, ODD) structural domain of oxygen dependence plays an important role (Fig. 1).In hypoxemia
Under the conditions of, under normoxic condition, the fusion protein stability containing ODD structural domain is poor, can be degraded rapidly；And in hypoxia condition
Under, the stability of the fusion protein containing ODD structural domain enhances, and then it is made to maintain certain expression.Therefore, low
During oxygen targeting regulating and expressing, UTR and ODD structural domain can reduce or eliminate the omission of transcriptional level hypoxemia Targeted-control
Protein expression can further enhance the hypoxemia Targeted-control to therapeutic gene.
[summary of the invention]
The object of the present invention is to provide transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation
Method, to solve the expression problem of multilevel regulation hypoxemia controlling gene after transcription, transcription and after translation.
The invention adopts the following technical scheme: transcription, transcription after and translation after multilevel hypoxemia controlling gene, nucleotide
Sequence is as shown in SEQ ID NO.1.
Transcription, transcription after and translation after multilevel hypoxemia controlling gene purposes, be used for hypoxemia Targeted-control therapeutic gene
Expression.
A method of transcription, transcription after and translation after multilevel hypoxemia controlling gene hypoxemia Targeted-control therapeutic gene,
It comprises the steps of:
With hypoxemia controlling gene construction recombination plasmid；
Hypoxemia controlling gene is transferred in eukaryocyte by recombinant plasmid；
Oxygen content in environment is controlled, so that less than 1.5%, hypoxemia controlling gene starts to regulate and control oxygen content in environment
The expression of therapeutic gene.
Further, recombinant plasmid is pLNCX carrier recombinant plasmid.
Further, when obtaining the recombinant plasmid of someone ODD gene, coupled reaction system is converted to Escherichia coli
It cloned in JM109 competent cell, extract the recombinant plasmid pT-ODD for carrying someone ODD gene.
Further, when obtaining the recombinant plasmid of someone UTR gene, coupled reaction system is converted to Escherichia coli
It cloned in JM109 competent cell, extract the recombinant plasmid pT-UTR for carrying someone UTR gene.
Further, oxygen content is being 0.3% in environment.
The beneficial effects of the present invention are: the present invention can be to hypoxemia controlling gene under normoxic condition or in normal tissue
Low expression is not expressed even, and expresses up-regulation under low oxygen conditions or in ischemic tissue, and then effectively treated in realization
Meanwhile avoiding or reducing the risk that therapeutic gene is overexpressed the adverse side effect that may cause.
[Detailed description of the invention]
Fig. 1 is that hypoxemia targeting adjusts schematic diagram after the transcription of gene expression of the invention, transcription and after translation；
Fig. 2 is the digestion of plasmid pT-NT3 and PCR qualification result in the present invention；
Fig. 3 is the digestion of plasmid pT-UTR and PCR qualification result in the present invention；
Fig. 4 is the table that 1 reverse transcription PCR of the embodiment of the present invention and western blot detect NT-3 mRNA and albumen respectively
Up to situation.
[specific embodiment]
The following describes the present invention in detail with reference to the accompanying drawings and specific embodiments.
The invention discloses transcription, transcription after and translation after horizontal hypoxemia controlling gene, nucleotide sequence such as sequence table
Shown in middle SEQID NO.1.
SEQ ID NO:1:
ggtaccccacagtgcatacgtgggctccaacaggtcctcttccacagtgcatacgtgggctccaacag
gtcctcttccacagtgcatacgtgggctccaacaggtcctcttccacagtgcatacgtgggctccaacaggtcctc
ttccacagtgcatacgtgggctccaacaggtcctctttgcatctcaattagtcagcaaccatagtcccgcccctaa
ctccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatcgctgactaattttttttattta
tgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttt
tgcaaaaagcttacgcgtcggtgatgtccatcttgttttatgtgatatttctcgcttatctccgtggcatccaagg
taacaacatggatcaaaggagtttgccagaagactcgctcaattccctcattattaagctgatccaggcagatatt
ttgaaaaacaagctctccaagcagatggtggacgttaaggaaaattaccagagcaccctgcccaaagctgaggctc
cccgagagccggagcggggagggcccgccaagtcagcattccagccggtgattgcaatggacaccgaactgctgcg
acaacagagacgctacaactcaccgcgggtcctgctgagcgacagcacccccttggagcccccgcccttgtatctc
atggaggattacgtgggcagccccgtggtggcgaacagaacatcacggcggaaacggtacgcggagcataagagtc
accgaggggagtactcggtatgtgacagtgagagtctgtgggtgaccgacaagtcatcggccatcgacattcgggg
acaccaggtcacggtgctgggggagatcaaaacgggcaactctcccgtcaaacaatatttttatgaaacgcgatgt
aaggaagccaggccggtcaaaaacggttgcaggggtattgatgataaacactggaactctcagtgcaaaacatccc
aaacctacgtccgagcactgacttcagagaacaataaactcgtgggctggcggtggatacggatagacacgtcctg
tgtgtgtgccttgtcgagaaaaatcggaagaacagctagccccagccgctggagacacaatcatatctttagattt
tggcagcaacgacacagaaactgatgaccagcaacttgaggaagtaccattatataatgatgtaatgctcccctca
cccaacgaaaaattacagaatataaatttggcaatgtctccattacccaccgctgaaacgccaaagccacttcgaa
gtagtgctgaccctgcactcaatcaagaagttgcattaaaattagaaccaaatccagagtcactggaactttcttt
taccatgccccagattcaggatcagacacctagtccttccgatggaagcactagacaaagttcacctgagcctaat
agtcccagtgaatattgtttttatgtggatagtgatatggtcaatgaattcaagttggaattggtagaaaaacttt
ttgctgaagacacagaagcaaagaacccattttctactcaggacacagatttagacttggagatgttagctcccta
tatcccaatggatgatgacttccagttacgttccttcgatcagttgtcaccattagaaagcagttccgcaagccct
gaaagcgcaagtcctcaaagcacagttacagtattccagtgactcgagccaggtgtgtccacctgggcatatccac
cacctccctcaccaacattgcttgtgccacaccctcccccgccactcctgaaccccgtcgaggggctctcagctca
gcgccagcctgtcccatggacactccagtgccagcaatgacatctcaggggccagaggaactgtccagagagcaac
tctgagatctaaggatgtcacagggccaacttgagggcccagagcaggaagcattcagagagcagctttaaactca
gggacagagccatgctgggaagacgcctgagctcactcggcaccctgcaaaatttgatgccaggacacgctttgga
ggcgatttacctgttttcgcacctaccatcagggacaggatgacctggagaacttaggtggcaagctgtgacttct
ccaggtctcacgggcatgggcactcccttggtggcaagagcccccttgacaccggggtggtgggaaccatgaagac
aggatgggggctggcctctggctctcatggggtccaagttttgtgtattcttcaacctcattgacaagaactgaaa
ccaccaatatgactcttggcttttctgttttctgggaacctccaaatcccctggctctgtcccactcctggcagca
gtgcagcaggtccaggtccgggaaatgaggggtggagggggctgggccctacgtgctgtctcacacagcctgtctg
acctctcgacctaccggcctaggccacaagctctgcctacgctggtcaataaggtgtctccattcaaggcctcacc
gcagtaaggcagctgccaaccctgcccagggcaaggctgcagtctagagc
It is disclosed by the invention transcription, transcription after and translation after horizontal hypoxemia controlling gene for hypoxemia Targeted-control treat base
The expression of cause.
The invention also discloses it is a kind of using transcription, transcription after and translation after horizontal hypoxemia controlling gene hypoxemia Targeted-control
The method of therapeutic gene, comprises the steps of:
With the hypoxemia controlling gene construction recombination plasmid；
Hypoxemia controlling gene is transferred in eukaryocyte by recombinant plasmid；
Oxygen content in environment is controlled, so that less than 1.5%, the hypoxemia controlling gene starts oxygen content in environment
Regulate and control the expression of therapeutic gene.
Embodiment 1
The construction method of vector plasmid is as follows:
The clone of step 1:5HRE-SV40mp gene and identification
HRE is people's source vessels endothelial growth factors (vascular endothelial growth factor, VEGF)
In one Duan Xulie: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT, 5 copy HRE, i.e. 5HRE is then 175bp:
CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT-CCACAGTGCATACGTGGGCTCCAACAGGTCCT
CTT-CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT-CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT-
CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT-
SV40 minimal promoter, 203 bp
5HRE-SV40mp
In front of 5HRE and restriction enzyme site Kpn I, Mlu I are inserted into the rear SV40mp respectively, and sequence is
5HRE-SV40mp is connected to pMD18-T carrier, coupled reaction system is converted to e. coli jm109 and is experienced
State is cloned into the cell, extracts the recombinant plasmid pT-5HRE-SV40m for carrying 5HRE-SV40mp gene.Using pair
The PCR amplification of 5HRE-SV40mp gene and the double digestion of Kpn I/Mlu I carry out recombinant plasmid pT-5HRE-SV40mp preliminary
Identification, then filter out possible positive colony and carry out sequencing identification, and then filter out the 5HRE- containing complete correct sequence
The clone of SV40mp gene.
Step 2: the clone of people's NT-3 gene and identification
Chelex-100 is used to extract human gene group DNA from human peripheral as template, according to people NT-3 in GeneBank
Sequence (NM_002527) designs the upstream and downstream NT-3 primer, is inserted into restriction enzyme site MluI, NheI respectively in the primer of upstream and downstream,
NT-3 full length sequence is expanded, sequence is as follows:
Forward primer:5'GGC GACGCGTC GGTG ATGTCCATCTTC3'
Reverse primer:5'GCG GCTAGC TGTTCTTCCGATTTTTC3'
After carrying out pcr amplification reaction, with gel reclaims kit, NT-3 segment is recycled, purify, is connected to pMD18-T
Coupled reaction system is converted to being cloned in escherichia coli jm109 competent cell, extracted and carries someone NT-3 by carrier
The recombinant plasmid pT-NT3 of gene.
It is tentatively reflected using the double digestion of PCR amplification and Mlu I/Nhe to NT-3 gene to recombinant plasmid pT-NT3
It is fixed, then filter out possible positive colony and carry out sequencing identification, and then filter out people's NT-3 gene containing complete correct sequence
Clone, as shown in Fig. 2, Lane 1:DNA marker DL2000, Lane 2: plasmid pT-NT3, Lane 3:Hind III/
Hpa I double digestion, Lane 4:pT-NT3 are that template carries out NT-3 pcr amplification product.
Wherein, NT-3 information is as follows:
Homo sapiens neurotrophin 3,GenBank:BC069773.1
CDS 84..857=774bp
Information after therapeutic gene NT-3 expression is as follows:
Neurotrophin 3 (source of people)
Length: 257aa, GenBank:AAH69773.1.
Amino acid sequence:
Since NT-3 sequence rear has one section of ODD to regulate and control, so the terminator codon (tga) of NT-3 is cancelled, it is placed in ODD
Rear.
Step 3: the clone of people source HIF-1 α ODD gene and identification
CDNA conduct is obtained after the total serum IgE progress reverse transcription PCR extracted in HEK293 cell with Trizol extraction process
Template, according to sequence (AF208487.1) the design ODD segment upstream and downstream primer of people HIF-1 α in GeneBank (in upstream and downstream
Restriction enzyme site NheI, Xho I are inserted into primer respectively, expands ODD (segment 1211-1819) sequence, sequence is as follows:
Forwardprimer:5'GC GCTAGC GCCCAGCCGCTGGAGAC3'
Reverse primer:5'GC CTCGAG TCA CTGGAATACTGTAAC3'
After carrying out pcr amplification reaction, with gel reclaims kit, ODD segment is recycled, is purified, is connected to pMD18-T load
Coupled reaction system is converted to being cloned in escherichia coli jm109 competent cell, extracted and carries someone ODD base by body
The recombinant plasmid pT-ODD of cause.
It is tentatively reflected using the double digestion of PCR amplification and Nhe I/Xho I to ODD gene to recombinant plasmid pT-ODD
It is fixed, then filter out possible positive colony and carry out sequencing identification, and then filter out people's ODD gene containing complete correct sequence
Clone.
Wherein, ODD information is as follows:
People source HIF-1 α, GenBank:AF208487.1, ODD:1211-1819
Since one section of regulating and controlling sequence that ODD is NT-3 sequence rear is placed in ODD so the terminator codon of NT-3 is cancelled
Rear, terminator codon tga.
Step 4: the building of transfer vector plasmid pGL3-5HRE-SV40-NT3-ODD
PT-ODD and pGL3-5HRE-SV40-NT3 are carried out to Nhe I/Xho I double enzyme digestion reaction respectively, and recycle digestion
Product, then ODD segment is inserted into pGL3-5HRE-SV40-NT30 with T4 DNA ligase, obtain transfer vector plasmid pGL3-
5HRE-SV40-NT3-ODD passes through PCR, digestion and sequencing identification.
Step 5: people source hematopoietin (Erythropoietin, EPO) 3 '-holds clone and the mirror of UTR gene
It is fixed
CDNA is obtained as mould after the total serum IgE progress reverse transcription PCR extracted in HepG2 cell with Trizol extraction process
Plate (draws according to people's UTR sequence (M11319) design upstream and downstream UTR segment 2773-3602 primer in GeneBank in upstream and downstream
Restriction enzyme site Xho I, Bgl II are inserted into object respectively, expands UTR (segment 2773-3602) sequence, sequence is as follows:
Forward primer:5'GC CTCGAG GGAGGTGTGTCCACCTGG3'
Reverse primer:5'GC AGATCT CTGCAGCCTTGCCCTGGGC3'
After carrying out pcr amplification reaction, with gel reclaims kit, UTR segment is recycled, is purified, is connected to pMD18-T load
Coupled reaction system is converted to being cloned in escherichia coli jm109 competent cell, extracted and carries someone UTR base by body
The recombinant plasmid pT-UTR of cause.
Recombinant plasmid pT-UTR is carried out using the double digestion of PCR amplification and Xho I/Bgl II to UTR gene preliminary
Identification, then filter out possible positive colony and carry out sequencing identification, and then filter out people's UTR gene containing complete correct sequence
Clone.
Wherein, UTR information is as follows:
People source Epo 3 '-holds UTR, Genebank:M11319, segment 2773-3602
This section of sequence is to regulate and control the segment of whole mRNA, so to be placed in the rear for the mRNA that front needs to transcribe, such as Fig. 3
Shown, Lane 1: plasmid pT-UTR, Lane 2:Hpa I/Cla I double digestion, Lane 3:pT-UTR are that template carries out UTR
Pcr amplification product, Lane 4:DNA marker DL2000.
Step 6: the building of transfer vector plasmid pGL3-5HRE-SV40-NT3-ODD-UTR
PT-UTR and pGL3-5HRE-SV40-NT3-ODD are carried out to Xho I/Bgl II double enzyme digestion reaction respectively, and recycled
Digestion products, then UTR segment is inserted into pGL3-5HRE-SV40-NT3-ODD with T4 DNA ligase, obtain recombinant vector matter
Grain pGL3-5HRE-SV40-NT3-ODD-UTR is identified by PCR, digestion and sequencing.
Each plasmid liposome Lipofectamine 2000 is transfected into PC12 cell, respectively obtain PC12-NT3 and
Then PC12-5HRE-NT3-ODD-UTR is handled under anoxic conditions.Culture bottle is placed in the anaerobism work station of pre-operation
(BUGBOX) in, 37 DEG C are incubated for the taking-up progress next step experiment afterwards for 24 hours of corresponding time point.
Gas content is respectively as follows: 5%CO in anaerobism work station2, 0.3%O2And 94.7%N2, examined in incubation period with oxygen
It surveys instrument (CY-100B) and continues to monitor oxygen content, it is made to maintain 0.3% level.
As a result:
Reverse transcription PCR and western blot detect the expression of NT-3 mRNA and albumen respectively, as shown in figure 4, instead
Transcribe PCR (A) and Western blot method (B) detection PC12-NT3 (lane 1) and PC12-5HRE-NT3-ODD-UTR (lane
2) mRNA of NT-3 and protein expression situation in cell.
Reverse transcription PCR is the results show that under normoxic condition, and the mRNA of NT-3 is expressed in PC12-5HRE-NT3-UTR-ODD
Level is significantly lower than PC12-NT3 group, there is significant difference (P < 0.05)；Under anoxic conditions, PC12-5HRE-NT3-UTR-
The mRNA expression of NT-3 is significantly raised in ODD, and compared under normoxic condition, there is significant difference (P < 0.05).
Western blot is the results show that under normoxic condition, and NT-3 expressing quantity is obvious in PC12-5HRE-NT3-UTR-ODD group
Lower than PC12-NT3 group, there is significant difference (P < 0.05)；And in PC12-5HRE-NT3-UTR-ODD group, with normal oxygen item
It compares under part, intracellular middle NT-3 mrna expression amount is significantly raised under anoxic conditions, there is significant difference (P < 0.05)；
But in PC12-NT3 group, compared under normoxic condition, after anoxic under anoxia condition intracellular NT-3 expressing quantity without
Significant difference variation.
Sequence table
<110>Xi'an Medical University
<120>multilevel hypoxemia controlling gene, application and its regulation method after transcription, transcription and after translation
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2626
<212> DNA
<213>artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
ggtaccccac agtgcatacg tgggctccaa caggtcctct tccacagtgc atacgtgggc 60
tccaacaggt cctcttccac agtgcatacg tgggctccaa caggtcctct tccacagtgc 120
atacgtgggc tccaacaggt cctcttccac agtgcatacg tgggctccaa caggtcctct 180
ttgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta 240
actccgccca gttccgccca ttctccgccc catcgctgac taattttttt tatttatgca 300
gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga 360
ggcctaggct tttgcaaaaa gcttacgcgt cggtgatgtc catcttgttt tatgtgatat 420
ttctcgctta tctccgtggc atccaaggta acaacatgga tcaaaggagt ttgccagaag 480
actcgctcaa ttccctcatt attaagctga tccaggcaga tattttgaaa aacaagctct 540
ccaagcagat ggtggacgtt aaggaaaatt accagagcac cctgcccaaa gctgaggctc 600
cccgagagcc ggagcgggga gggcccgcca agtcagcatt ccagccggtg attgcaatgg 660
acaccgaact gctgcgacaa cagagacgct acaactcacc gcgggtcctg ctgagcgaca 720
gcaccccctt ggagcccccg cccttgtatc tcatggagga ttacgtgggc agccccgtgg 780
tggcgaacag aacatcacgg cggaaacggt acgcggagca taagagtcac cgaggggagt 840
actcggtatg tgacagtgag agtctgtggg tgaccgacaa gtcatcggcc atcgacattc 900
ggggacacca ggtcacggtg ctgggggaga tcaaaacggg caactctccc gtcaaacaat 960
atttttatga aacgcgatgt aaggaagcca ggccggtcaa aaacggttgc aggggtattg 1020
atgataaaca ctggaactct cagtgcaaaa catcccaaac ctacgtccga gcactgactt 1080
cagagaacaa taaactcgtg ggctggcggt ggatacggat agacacgtcc tgtgtgtgtg 1140
ccttgtcgag aaaaatcgga agaacagcta gccccagccg ctggagacac aatcatatct 1200
ttagattttg gcagcaacga cacagaaact gatgaccagc aacttgagga agtaccatta 1260
tataatgatg taatgctccc ctcacccaac gaaaaattac agaatataaa tttggcaatg 1320
tctccattac ccaccgctga aacgccaaag ccacttcgaa gtagtgctga ccctgcactc 1380
aatcaagaag ttgcattaaa attagaacca aatccagagt cactggaact ttcttttacc 1440
atgccccaga ttcaggatca gacacctagt ccttccgatg gaagcactag acaaagttca 1500
cctgagccta atagtcccag tgaatattgt ttttatgtgg atagtgatat ggtcaatgaa 1560
ttcaagttgg aattggtaga aaaacttttt gctgaagaca cagaagcaaa gaacccattt 1620
tctactcagg acacagattt agacttggag atgttagctc cctatatccc aatggatgat 1680
gacttccagt tacgttcctt cgatcagttg tcaccattag aaagcagttc cgcaagccct 1740
gaaagcgcaa gtcctcaaag cacagttaca gtattccagt gactcgagcc aggtgtgtcc 1800
acctgggcat atccaccacc tccctcacca acattgcttg tgccacaccc tcccccgcca 1860
ctcctgaacc ccgtcgaggg gctctcagct cagcgccagc ctgtcccatg gacactccag 1920
tgccagcaat gacatctcag gggccagagg aactgtccag agagcaactc tgagatctaa 1980
ggatgtcaca gggccaactt gagggcccag agcaggaagc attcagagag cagctttaaa 2040
ctcagggaca gagccatgct gggaagacgc ctgagctcac tcggcaccct gcaaaatttg 2100
atgccaggac acgctttgga ggcgatttac ctgttttcgc acctaccatc agggacagga 2160
tgacctggag aacttaggtg gcaagctgtg acttctccag gtctcacggg catgggcact 2220
cccttggtgg caagagcccc cttgacaccg gggtggtggg aaccatgaag acaggatggg 2280
ggctggcctc tggctctcat ggggtccaag ttttgtgtat tcttcaacct cattgacaag 2340
aactgaaacc accaatatga ctcttggctt ttctgttttc tgggaacctc caaatcccct 2400
ggctctgtcc cactcctggc agcagtgcag caggtccagg tccgggaaat gaggggtgga 2460
gggggctggg ccctacgtgc tgtctcacac agcctgtctg acctctcgac ctaccggcct 2520
aggccacaag ctctgcctac gctggtcaat aaggtgtctc cattcaaggc ctcaccgcag 2580
taaggcagct gccaaccctg cccagggcaa ggctgcagtc tagagc 2626
Claims (7)
1. transcription, transcription after and translation after multilevel hypoxemia controlling gene, which is characterized in that in its nucleotide sequence such as sequence table
Shown in SEQID NO.1.
2. the purposes of multilevel hypoxemia controlling gene after transcription according to claim 1, transcription and after translation, feature exists
In expression for hypoxemia Targeted-control therapeutic gene.
3. a kind of transcription using claim 1, multilevel hypoxemia controlling gene hypoxemia Targeted-control is controlled after transcription and after translation
The method for treating gene, which is characterized in that comprise the steps of:
With the hypoxemia controlling gene construction recombination plasmid；
Hypoxemia controlling gene is transferred in eukaryocyte by recombinant plasmid；
Oxygen content in environment is controlled, so that less than 1.5%, the hypoxemia controlling gene starts to regulate and control oxygen content in environment
The expression of therapeutic gene.
4. after transcription according to claim 3, transcription and after translation, multilevel hypoxemia controlling gene hypoxemia Targeted-control is controlled
The method for treating gene, which is characterized in that the recombinant plasmid is pLNCX carrier recombinant plasmid.
5. after transcription according to claim 4, transcription and after translation, multilevel hypoxemia controlling gene hypoxemia Targeted-control is controlled
The method for treating gene, which is characterized in that when obtaining the recombinant plasmid of someone ODD gene, coupled reaction system is converted to big
It cloned in enterobacteria JM109 competent cell, extract the recombinant plasmid pT-ODD for carrying someone ODD gene.
6. after transcription according to claim 4, transcription and after translation, multilevel hypoxemia controlling gene hypoxemia Targeted-control is controlled
The method for treating gene, which is characterized in that when obtaining the recombinant plasmid of someone UTR gene, coupled reaction system is converted to big
It cloned in enterobacteria JM109 competent cell, extract the recombinant plasmid pT-UTR for carrying someone UTR gene.
7. the method for horizontal hypoxemia controlling gene hypoxemia Targeted-control therapeutic gene after translation according to claim 3,
It is characterized in that, oxygen content is being 0.3% in environment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910574989.XA CN110241120A (en) | 2019-06-28 | 2019-06-28 | Transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910574989.XA CN110241120A (en) | 2019-06-28 | 2019-06-28 | Transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110241120A true CN110241120A (en) | 2019-09-17 |
Family
ID=67890209
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910574989.XA Pending CN110241120A (en) | 2019-06-28 | 2019-06-28 | Transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110241120A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4092125A1 (en) * | 2021-05-17 | 2022-11-23 | Hochschule Biberach | Method for producing a biomolecule by a cell |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1179018A1 (en) * | 1999-05-12 | 2002-02-13 | Isis Innovation Limited | Interaction between the vhl tumour suppressor and hypoxia inducible factor, and assay methods relating thereto |
| CN106366173A (en) * | 2015-07-24 | 2017-02-01 | 北京京爱康科技有限公司 | Chromatin peptide for controlling expression of anoxic reaction gene through combining hypoxic response element |
-
2019
- 2019-06-28 CN CN201910574989.XA patent/CN110241120A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1179018A1 (en) * | 1999-05-12 | 2002-02-13 | Isis Innovation Limited | Interaction between the vhl tumour suppressor and hypoxia inducible factor, and assay methods relating thereto |
| CN106366173A (en) * | 2015-07-24 | 2017-02-01 | 北京京爱康科技有限公司 | Chromatin peptide for controlling expression of anoxic reaction gene through combining hypoxic response element |
Non-Patent Citations (4)
| Title |
|---|
| H.A. KIM, K. KIM, S.W. KIM, M. LEE: "Transcriptional and post-translational regulatory system for hypoxia specific gene expression using the erythropoietin enhancer and the oxygen-dependent degradation domain", 《J. CONTROL. RELEASE》 * |
| HYUN AH KIM ，ET AL: "Hypoxia-specific gene expression for ischemic disease gene therapy", 《ADVANCED DRUG DELIVERY REVIEWS 》 * |
| M. LEE,ET AL: "Hypoxia-inducible gene expression system using the erythropoietin enhancer and 3′-untranslated region for the VEGF gene therapy", 《J. CONTROL. RELEASE》 * |
| 张军峰 等: "低氧反应元件介导的低氧调控的神经营养因子-3表达上调减少低氧诱导的PC12 细胞凋亡", 《解剖学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4092125A1 (en) * | 2021-05-17 | 2022-11-23 | Hochschule Biberach | Method for producing a biomolecule by a cell |
| WO2022243320A1 (en) * | 2021-05-17 | 2022-11-24 | Hochschule Biberach | Method for producing a biomolecule by a cell |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jair et al. | Ambidextrous transcriptional activation by SoxS: requirement for the C‐terminal domain of the RNA polymerase alpha subunit in a subset of Escherichia coli superoxide‐inducible genes | |
| Beisel et al. | The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli | |
| Lim et al. | RNAi suppression of Bax and Bak enhances viability in fed-batch cultures of CHO cells | |
| Carlomagno et al. | The different RET-activating capability of mutations of cysteine 620 or cysteine 634 correlates with the multiple endocrine neoplasia type 2 disease phenotype | |
| Adar et al. | Formation of the LuxR protein in the Vibrio fischeri lux system is controlled by HtpR through the GroESL proteins | |
| JP2007061106A (en) | Method for producing polypeptide and constructs used therefor | |
| Ivey et al. | Molecular cloning and sequencing of a gene from alkaliphilic Bacillus firmus OF4 that functionally complements an Escherichia coli strain carrying a deletion in the nhaA Na+/H+ antiporter gene. | |
| EP2726626A1 (en) | A microorganism for methionine production with enhanced glucose import | |
| Pohjanpelto et al. | Deprivation of a single amino acid induces protein synthesisdependent increases in c-jun, c-myc, and ornithine decarboxylase mRNAs in Chinese hamster ovary cells | |
| Aichi et al. | Involvement of NtcB, a LysR family transcription factor, in nitrite activation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp. strain PCC 7942 | |
| Boado | Brain-derived peptides regulate the steady state levels and increase stability of the blood-brain barrier GLUT1 glucose transporter mRNA | |
| Cho et al. | BiP internal ribosomal entry site activity is controlled by heat-induced interaction of NSAP1 | |
| CN110241120A (en) | Transcription, transcription after and translation after multilevel hypoxemia controlling gene, application and its regulation method | |
| Sarkar et al. | Effect of cra gene knockout together with edd and iclR genes knockout on the metabolism in Escherichia coli | |
| Lee et al. | Regulation of transcription from two ssrS promoters in 6S RNA biogenesis | |
| Jeong et al. | Constitutive production of human leptin by fed-batch culture of recombinant rpoS− Escherichia coli | |
| Morceau et al. | Transcriptional and posttranscriptional regulation of erythroid gene expression in anthracycline-induced differentiation of human erythroleukemic cells | |
| Caspeta et al. | Enhancing thermo-induced recombinant protein production in Escherichia coli by temperature oscillations and post-induction nutrient feeding strategies | |
| Kudo et al. | Usage of putative chicken U6 promoters for vector-based RNA interference | |
| Kaneko et al. | Co-induction of DNA relaxation and synthesis of DnaK and GroEL proteins in Escherichia coli by expression of LetD (CcdB) protein, an inhibitor of DNA gyrase encoded by the F factor | |
| CN110257392A (en) | Post-transcriptional level hypoxemia controlling gene, application and its regulation method | |
| CN110257393A (en) | Horizontal hypoxemia controlling gene, application and its regulation method after translation | |
| AU2018319637A1 (en) | Expression control using a regulatable intron | |
| US20080125384A1 (en) | Simultaneous silencing and restoration of gene function | |
| US20210236593A1 (en) | Methods of supporting weight maintenance by decreasing the activity of fam46a |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190917 |