CN110229925A - A kind of late blight of potato disease-resistant gene diagnostic primers and its design method - Google Patents
A kind of late blight of potato disease-resistant gene diagnostic primers and its design method Download PDFInfo
- Publication number
- CN110229925A CN110229925A CN201910492963.0A CN201910492963A CN110229925A CN 110229925 A CN110229925 A CN 110229925A CN 201910492963 A CN201910492963 A CN 201910492963A CN 110229925 A CN110229925 A CN 110229925A
- Authority
- CN
- China
- Prior art keywords
- gene
- disease
- potato
- primer
- resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of late blight of potato disease-resistant gene R8 diagnostic primers and its design method, diagnostic primers include: Tub gene internal control primer and R8 gene specific diagnostic primers.The primer designed using the present invention, can be whether to contain R8 gene in precise Identification Potatoes, high-throughput detection can be carried out to hundreds of samples within 2 days, can be used for extensive, the rapid molecular marker assisted selection of late blight of potato breeding for disease resistance filial generation material disease-resistant gene R8.
Description
Technical field
The invention belongs to late blight of potato disease-resistant genes to identify field, and in particular to a kind of disease-resistant base of the late blight of potato
Because of diagnostic primers and its design method, utilize the kit of primer identification late blight of potato disease-resistant gene R8.
Background technique
Potato is grain, the dish, the important crops for raising dual-purpose that world wide is cultivated extensively.Potatoes cultivated area and
Yield ranks first in the world.In production process, potato by various diseases harm, wherein by oomycetes phytophthora infestans
Late blight caused by (Phytophthora infestans (Mont.) de Bary) is for disease the most serious, normal year
Because loss reaches 20-30% caused by late blight harm, up to 50% or more when serious, climatic extreme year some areas even
It will cause potato total crop failure.Therefore, anti-late blight is China and the highly important breeding objective of world potato.
Late blight of potato resistance is disease-resistant in Potato cultivar in the world at present mainly by the control of main effect R gene
R1-R11 gene of the gene in wild potato kind Solanum demissum, wherein most disease-resistant genes are
Being overcome by the late disease bacteria of tachytelic evolution, such as R1, R2, R3a and R4 lose utility value in breeding, but there are also
Gene still has utility value.In early-stage study, we are from the P. infestans resistant material that International Potato Center provides
By constructing Resistant segregation group, finely positioning, gene of gene library screening and cloning control late blight durable resistance,
It finally confirms to be the R8 gene (Jiang et al., 2018) in S.demissum.By being collected and international horse to the country
The evaluation of resistance for more than the 400 parts of materials that bell potato center provides, filters out more than 80 parts of P. infestans resistant materials, passes through disease-resistant gene group
Sequencing technologies are found, most in these resistant materials to contain R8 gene.R8 gene is from transformation in wild species into cultivar
Has the history of upper a century, it has been found that contain in the resistant material overwhelming majority that China late blight district occurred frequently Southwest Mountainous Areas is collected
R8 gene, it was demonstrated that R8 gene still effectively, is a permanent disease-resistant gene, can add in late blight resistance breeding in breeding
To utilize.
Potato cultivar is autotetraploid, and sexual hybrids Gene Isolation is complicated, and theoretically favorable genes type goes out
Frequency is low, generally requires bigger group, and the conventional breeding methods efficiency of selection based on Phenotypic Selection is low.And it is based on genotype
Molecular marker assisted selection can greatly improve potato superior genotypes selection accuracy and breeding efficiency.Molecular labeling
The key of assisted Selection is that have special primer, and be capable of efficiently and accurately identifies the individual containing target gene from offspring.
R8 is a permanent disease-resistant gene, it is desirable in late blight breeding by way of molecular marker assisted selection
It is used.It is expected that the R8 gene order cloned and registered according to us designs gene specific primer in research, is expanded using PCR
Increasing mode identifies whether contain R8 gene in potato resource material and filial generation, and discovery is according to design of primers in heuristic process
Rule design primer expected size segment can be amplified in the material containing R8 gene and without R8 gene,
Design can distinguish in Potatoes whether the special primer with R8 gene is very difficult.The reason is that: different plants
Disease-resistant gene often has conservative NBS-LRR structural domain, while disease-resistant gene contains disease-resistant gene class existing for many clusters
Like object (Resistance gene analog, RGA), these disease resistance gene analogs and real functional disease-resistant gene sequence
There is high similarity again, therefore, it is difficult to design gene specific primer by real disease-resistant gene and without the anti-of disease-resistant function
Ospc gene analog is distinguish.The different regions between disease-resistant gene and disease resistance gene analog are how precisely found, are to set
Disease-resistant gene special primer is counted, the key of disease-resistant gene molecule marker selection is carried out.
Problem of the existing technology: there is presently no develop to can be used in carrying out R8 gene molecular labeling auxiliary choosing
The ideal mark selected.PCR amplification primer is designed with R8 gene start codon and terminator codon regional sequence, can be amplified
It is expected that the segment of size, but not can guarantee the specificity of amplified production.These segments, which are likely to be amplified from, does not have function
Disease resistance gene analog gene, can not represent in material containing having functional R8 gene.R8 is shown in attached drawing in gene coding region
3.Bibliography:
Jiang R,Li J,Tian Z,Du J,Armstrong M,Baker K,Lim JT,Vossen JH,He H,
Portal L,Zhou J,Bonierbale M,Hein I,Lindqvist-Kreuze H,Xie C.Potato late
blight field resistance from QTL dPI09c is conferred by the NB-LRR gene
R8.Journal of Experimental Botany.2018,69(7):1545-1555.
Summary of the invention
The invention solves key technical problem be to provide a kind of late blight of potato disease-resistant gene diagnostic primers and
Its design method utilizes the kit of primer identification late blight of potato disease-resistant gene R8.It is surveyed especially by disease-resistant gene group
Sequence obtains the R8 gene and its homologous sequence sequencing information of 84 parts of potato resource materials, by comparing point with R8 gene order
Analysis, precisely finds the diff area of R8 gene order Yu its disease resistance gene analog, and then in these diff areas, design is special
Primer has well solved the problem of PCR amplification is difficult to differentiate between R8 gene and its disease resistance gene analog.Principle designs according to this
Primer can be used for the Markers for Detection of potato filial generation R8 gene.It can the characteristics of being simple and efficient with amplifying specific
For late blight resistance breeding molecular marker assisted selection.
In order to solve the above technical problems, the present invention adopts the following technical scheme:
1, a kind of late blight of potato disease-resistant gene R8 diagnostic primers, comprising:
Tub gene internal control primer:
Upstream primer: Tub-F:TTGGACAGTCTGGTGCTGGGAAT
Downstream primer: Tub-R:CCAGGGAATCTCAAACAGCAAG
R8 gene specific diagnostic primers:
Upstream primer R8-Fd:CTGGCGCTGGTTTTGCTATGC
Downstream primer R8-Rd:TCTCTTCGACTTCTTCTTACGAGGTCTA
2, a kind of design method of late blight of potato disease-resistant gene diagnostic primers, comprising:
(1) different P. infestans resistant Potatoes R8 gene sequencing；(2) sequence difference regional analysis and design of primers；
(3) amplification of R8 gene specific primer is verified with compatible degree.
3, a kind of late blight of potato disease-resistant gene diagnostic kit, comprising:
(1) primer；(2) PCR reacts Mix.
4, a kind of diagnostic method of late blight of potato disease-resistant gene R8 is used using kit described in above-described embodiment
Following steps are diagnosed:
(1) potato total DNA is extracted；(2) PCR reaction system configures；(3) PCR program is arranged；(4) result judgement
Detailed description of the invention
Fig. 1 matches (mismatch rate 1%) with the high rigor of R8 gene for different Potatoes disease-resistant gene sequencing results
Wherein, figure grey area is that corresponding Potatoes sequencing fragment sequence can cover R8 gene.It is not covered with
Region is the region with R8 gene similitude difference.Wherein Potatoes CT9-4 and 93012 sequencing fragments splicing sequence can be complete
All standing R8 gene shows that remaining 4 Potatoes sequencing fragment sequence cannot be complete containing R8 gene in the two materials
R8 gene is covered, is shown without R8 gene in this 4 materials, but contain disease-resistant gene similar with R8 Gene Partial segment height
Analog.Region shown in dashed rectangle is the region of present invention design gene specific primer, designs R8 gene specific in the region
Primer carries out PCR amplification, so that it may distinguish disease-resistant gene and the like.
Fig. 2 is that reference gene Tub primer and difference R8 gene primer expand in 11 PCR being sequenced in Potatoes
Increase result
Wherein, A: the result of reference gene Tub primer PCR amplification；B, C: according to R8 gene order by design of primers
Two pairs of not specific R8 primer amplification results of principle design；D: the R8 specific primer of Technology design according to the present invention
The result of PCR amplification.Swimming lane 1,2,3,4,5,6,7,8,9,10 and 11 respectively represents Potatoes: CIP129, ZS-1,
HB11A1-119, J297, YS605,7636,7129-1, SD-27, SD-14, CIP87,7638 extracting DNA are template amplification
PCR product, swimming lane 12 are the negative control using sterile water as control (no template).Molecular weight standard is DL2000plus.
Attached drawing 3 is the gene coding region R8 (3738bp)
Wherein, gray area is primer region, and lower thread-changing region is design primer region of the present invention.
Fig. 4 (subordinate list 1) is Primer and primer sequence information
Wherein, Tub Gene in Potato genome sequence column number: PGSC0003DMS000001367 (PGSC_DM_v3_
scaffolds.fasta)82374-83805bp.R8 gene cluster sequence GenBank number: KU530153.1Solanum
demissum R8gene cluster 79025-75288bp。
Fig. 5 (subordinate list 2) sequencing and PCR diagnose the result of R8 gene in 84 Potatoes
Specific implementation method
Application method and device in the following embodiments of the invention patent are unless otherwise specified conventional method and device；
Equipment used, reagent are the conventional equipment and reagent of Reagent Company's purchase.For make the purpose of the invention patent, technical solution and
Advantage is clearer, and the specific embodiment of the invention patent is described in detail combined with specific embodiments below.These are excellent
The example of embodiment is selected to be illustrated in a particular embodiment.
Here, it should also be noted that, in order to avoid having obscured the technical side of the invention patent because of unnecessary details
Case illustrate only the technical solution and/or processing step closely related with the scheme of patent according to the present invention in embodiment,
And the little other details of relationship are omitted.
Embodiment 1
The present embodiment provides a kind of late blight of potato disease-resistant gene R8 diagnostic primers, comprising:
Tub gene internal control primer:
Upstream primer: Tub-F:TTGGACAGTCTGGTGCTGGGAAT
Downstream primer: Tub-R:CCAGGGAATCTCAAACAGCAAG
R8 gene specific diagnostic primers:
Upstream primer R8-Fd:CTGGCGCTGGTTTTGCTATGC
Downstream primer R8-Rd:TCTCTTCGACTTCTTCTTACGAGGTCTA
Embodiment 2
The present embodiment provides a kind of design methods of late blight of potato disease-resistant gene diagnostic primers, comprising:
(1) different P. infestans resistant Potatoes R8 gene sequencing
The disease-resistant R gene of plant of Solanaceae has conservative NB-LRR and NB-ARC structural domain, designs 48 according to conserved domain,
549 120-mer biotin labeling rna probes (being purchased from Agilent Technologies Inc).Ma Ling is extracted with CTAB method
Potato genomic DNA smashes genomic fragment, clip size 400-500bp or so with ultrasonic wave, then uses biotin labeling RNA
Probe captures disease-resistant gene and its disease resistance gene analog segment in potato gene group, then these sequencing fragments will
These sequencing fragments are compared with high rigor (1%) mismatch rate onto R8 gene order, if some material sequencing fragment can
R8 gene order region is completely covered, indicates that the material contains R8 gene, if cannot be completely covered, shows that the material is free of
R8 gene.
Attached drawing 1 illustrate 6 materials in two material C T9-4 and 93012 contain R8 gene, material 93045, SD-4,
J101K27 and IVP96-2 is free of R8 gene.
Specific sequencing approach is joyous with reference to what, and 2018；Armstrong et al.,2019；Jupe et al.,2013.
Whether there is or not (seeing attached list 2) using the R8 gene in 84 parts of Potatoes of above-mentioned diagnosis of technique by the present invention.
Bibliography:
The screening of He Huan late blight of potato Resistance resource and its disease-resistant gene composition identification Hua Zhong Agriculture University master grind
Study carefully raw paper, 2018
Armstrong MR,Vossen J,Lim TY,Hutten RCB,Xu J,Strachan SM,Harrower B,
Champouret N,Gilroy EM,Hein I.Tracking disease resistance deployment in
potato breeding by enrichment sequencing.Plant Biotechnology Journal.2019,17
(2):540-549.
Jupe F, Witek K, Verweij W, Sliwka J, Pritchard L, Etherington GJ, Maclean
D,Cock PJ,Leggett RM,Bryan GJ,Cardle L,Hein I,Jones JD..Resistance gene
enrichment sequencing(RenSeq)enables reannotation ofthe NB-LRR gene family
from sequencedplant genomes and rapid mapping of resistance loci in
segregating populations.Plant Journal,2013.76:530–544
(2) sequence difference regional analysis and design of primers
It is disease-resistant in no a certain number of R8 since R8 disease-resistant gene and its gene analog sequence have high similarity
Under the premise of the comparison information of gene and its gene analog sequence, it can not determine that region design primer progress PCR amplification can
To distinguish amplified production from R8 disease-resistant gene or its gene analog.80 multiple and different something lost that the application utilizes us to obtain
The sequencing information of background Potatoes is passed, the difference of comparative analysis R8 disease-resistant gene and the like sequence finds them
The significant region design primer of sequence difference.As shown in Figure 1, be after the sequencing of 6 Potatoes disease-resistant genes disease-resistant gene and
Its analog and the comparison result of R8 and gene order under high stringent conditions (1% mismatch rate), disease-resistant gene and disease-resistant base
Because analog is identical or have very high similitude (1 grey overlay area of attached drawing) in some regions, but in some regions
Similitude is poor (1 grey uncovered area of attached drawing).
R8 disease-resistant gene code area is completely covered in sequencing result in material 1 (CT9-4) and material 2 (93012), show this two
A material contains R8 disease-resistant gene, and remaining material sequencing splicing result only has the part covering gene coding region R8, such as the 3rd
A material SD-14 has region (dotted line frame signal) that can not cover although other regions can cover, at 3 ' ends, theoretical
On can distinguish disease-resistant gene and disease resistance gene analog in this section design primer, PCR amplification.
R8 gene diagnosis primer is designed in R8 gene and its apparent region of analog difference (signal of 1 dotted line frame of attached drawing)
R8-Fd, primer sequence such as attached drawing 4 (subordinate list 1) design a primer R8-Rd, primer sequence in 3 ' terminal conserved region of R8 gene
Such as attached drawing 4 (subordinate list 1), attached drawing 3 is seen in position of the primer sequence on the gene coding region R8, this can amplify primer expection
682bp segment.In order to compare the specificity of design primer of the present invention, other two pairs are devised with primer-design software Primer5
Primer R8-F1/R8-R1 and R8-F2/R8-Rd (subordinate list 1, sequence location is shown in attached drawing 3).
Using Tub gene as reference gene, PCR amplification primer Tub-F/Tub-R is devised with primer-design software Primer5
(subordinate list 1).
(3) amplification of R8 gene specific primer is verified with compatible degree
The Potato Cultivars or material of disease-resistant gene sequencing are completed with 11 of random picking (all inventories see attached list 2)
The genomic DNA of extracting be template, in the primer and example 3 in subordinate list 1 PCR system and PCR program expanded.
11 Potatoes number for detection primer amplification are as follows: ' ZS-1 ', ' YS605 ', CIP129, HB11A1-
119, J297,7636,7129-1, SD-27, SD-14, CIP87 and 7638.Sequencing result, which diagnoses, shows CIP129, ' ZS-1 ',
HB11A1-119, J297 and ' YS605 ' this 5 materials contain R8 gene (subordinate list 2).
Reference gene can amplify expected size segment (attached drawing 2A), R8-F1/R8-R1 primer in 11 materials
Segment (attached drawing 2B) can be amplified in remaining 9 material other than material 7636 and CIP87, R8-F2/R8-Rd draws
Object can amplify expected size segment (attached drawing 2C) in 11 materials, show that first two pairs primer without specificity, can not be sentenced
Whether really there is R8 gene in disconnected material.And the present invention design special primer R8-Fd/R8-Rd primer can only CIP129,
Expected size segment is amplified in ' ZS-1 ', HB11A1-119, J297 and ' YS605 ' 5 materials, and in other 6 materials
It can not expand (attached drawing 2D), show R8-Fd/R8-Rd primer amplification result and disease-resistant gene sequencing result in above 11 materials
It is completely the same.
In order to further verify the specificity of present invention design specific diagnostic primer R8-Fd/R8-Rd, with other 73
It is that template carries out PCR amplification that Potatoes DNA, which is sequenced, amplification is compared with sequencing diagnostic result, as the result is shown
Amounting to 84 sample amplification results and sequencing diagnostic result consistency is 98.8% (83/84), only a sample SD-46 exception
(subordinate list 2).In addition, carrying out PCR detected representation in other more than 50 parts of Potatoes using special primer of the invention is feminine gender.
Show that special primer R8-Fd/R8-Rd has high identification.
Embodiment 3
The present embodiment provides a kind of late blight of potato disease-resistant gene diagnostic kits, comprising:
(1) primer
Internal reference Tub gene primer, R8 gene specific primer, such as attached drawing 4 (subordinate list 1).
(2) PCR reaction Mix includes:
Taq archaeal dna polymerase, dNTPs, MgCl2, reaction buffer, concentration be 2 ×, it is recommended to use Beijing Ai Delai biology
Science and Technology Ltd. 2 × Taq PCR MasterMix (article No. PC0902).Other company trade Taq archaeal dna polymerases and match
Set PCR reaction buffer and its dNTPs can be expanded normally.
Embodiment 4
The present embodiment provides the diagnostic methods of late blight of potato disease-resistant gene R8 a kind of, try using described in above-described embodiment
Agent box, is diagnosed using following steps:
(1) potato total DNA is extracted
Plant group DNA is extracted using CTAB extraction process, the method is as follows:
A. it takes 200mg or so fresh potato blade in 2ml centrifuge tube, is incorporated in the CTAB extract of 95 DEG C of preheatings
Even 750 μ l, sample grinding machine 50Hz/120s mill is in foam-like fine crushing (can also use liquid nitrogen grinding).
B. in 95 DEG C of water-bath water-bath 30min.It takes out centrifuge tube to be cooled to room temperature, isometric chloroform/isoamyl alcohol is added
(24:1) solution, slowly shaking centrifuge tube to organic phase from colourless becomes bottle green.
C. room temperature 8500r/min is centrifuged 15min, is transferred in 1.5ml centrifuge tube with the 1ml pipette tips for cutting off tip, is added
2/3 volume isopropanol slowly mixes to DNA and forms flocculence.Room temperature 8500r/min centrifugation 5min removes supernatant, with 75% ethyl alcohol
1-2h is impregnated, ethyl alcohol is removed, dries DNA, 200 μ l TE (pH8.0) abundant dissolving DNAs are added.
D. about 20 μ l RNaseA (10mg/ml) are added, in 37 DEG C of warm bath 2h, DNA is saved backup at -20 DEG C.
E.PCR template DNA concentration is adjusted to 50ng/ μ l.
CTAB extract recipe (1L): CTAB 20g, PVP 20g, NaCl 89.3g, 1mol/L Tris-HCl (pH8.0)
100ml, 0.5mol/L EDTA (pH8.0) 40ml.
Potatoes DNA can also be extracted with other similar method.
(2) PCR reaction system includes:
(3) PCR program are as follows:
(4) result judgement method includes:
PCR amplification is carried out according to above-mentioned PCR system and amplification program；Amplification, which finishes, takes 10 μ l amplified productions, and 1 μ l is added
10 times of electrophoresis sample-loading buffers, electrophoresis under 120V voltage, observes stripe size in the UV lamp on 1% Ago-Gel, interior
Ginseng gene amplification fragment size is 1432bp, can expand expected size segment, it was demonstrated that PCR system and program are normal；R8 gene
Specific diagnostic primer R8-Fd/R8-Rd is 682bp to amplified fragments, no amplified fragments or amplified fragments are not of uniform size is judged as
Without R8 gene in sample, determine that example is shown in attached drawing 2D.
The utility model has the advantages that
If just can not precisely find R8 gene order and its disease resistance gene analog without the support of a large amount of sequencing results
Diff area, the design primer other than this region, such as in 1 gray area design primer of attached drawing, result leads to no R8
It can also be amplified in the material of gene segment (attached drawing 2B, C), without specificity, be unable to judge accurately material is such label
It is no containing R8 gene, therefore be also not used to the accurate selection of R8 gene.
Disease-resistant gene encodes albumen can excite allergic reaction with the corresponding nontoxic protein identification that it is identified in potato
(HR), it may determine that, whether containing corresponding resistant gene in Potatoes, this technical tactic needs to utilize nontoxic base whereby
Because of Agrobacterium transient expression technology, but many potato genotypes are not appropriate for Agrobacterium transient expression, some genotype notes
It penetrates and does not react, some genotype are sensitive to Agrobacterium, and necrotic plaque quickly occurs in Material injection point, therefore, this technical appraisement
Whether containing R8 gene in Potatoes has significant limitations.
By designing a series of all R8 genes of primer amplification and the like full length sequence, then all it is sequenced to judge
Whether there is R8 gene in material.This method design of primers is difficult, and amplified production is complicated, and sequencing cost is high, it is impossible to be used in educates
The screening of the kind extensive material of offspring.
Furthermore it is possible to directly be by being sequenced in accurate expert evidence using aforementioned sequencing approach to potato filial generation
No to have disease-resistant gene, this method cost is sufficiently expensive, and according to our data, each sample sequencing takes on 3000 yuan of left sides
It is right, it is impossible to be used in breeding progeny selects on a large scale.
The primer designed using the present invention can quick and precisely identify that DNA takes out whether containing R8 gene in Potatoes
Mention, PCR and its electrophoresis detection technology be common laboratory routine techniques, commercialized Taq is cheap, DNA extraction agent
For common agents.Using offer technology of the present invention can hundreds of samples be carried out with high-throughput detection within 2 days, be fully available for
Extensive, the rapid molecular assisted Selection of Potato Breeding filial generation material disease-resistant gene R8.
The above is only the specific embodiment of the application, it is noted that for the ordinary skill people of the art
For member, under the premise of not departing from the application principle, several improvements and modifications can also be made, these improvements and modifications are also answered
It is considered as the protection scope of the application.
<110>Hua Zhong Agriculture University
<120>a kind of late blight of potato disease-resistant gene diagnostic primers and its design method
<160> 4
<210> 1
<211> 23
<212> DNA
<213>potato (Solanum tuberosum)
<400> 1
TTGGACAGTCTGGTGCTGGGAAT 23
<210> 2
<211> 22
<212> DNA
<213>potato (Solanum tuberosum)
<400> 2
CCAGGGAATCTCAAACAGCAAG
<210> 3
<211> 21
<212> DNA
<213>potato (Solanum tuberosum)
<400> 3
CTGGCGCTGGTTTTGCTATGC
<210> 4
<211> 28
<212> DNA
<213>potato (Solanum tuberosum)
<400> 4
TCTCTTCGACTTCTTCTTACGAGGTCTA
Claims (9)
1. a kind of late blight of potato disease-resistant gene R8 diagnostic primers, which is characterized in that the diagnostic primers include: Tub gene
Internal control primer and R8 gene specific diagnostic primers, Tub gene internal control primer such as sequence table SEQ ID NO:1 and SEQ ID NO:1
Shown, R8 gene specific diagnostic primers are as shown in sequence table SEQ ID NO:3 and SEQ ID NO:4.
2. a kind of design method of late blight of potato disease-resistant gene diagnostic primers, which comprises the steps of: (1)
Different P. infestans resistant Material Potato disease-resistant gene sequencings；(2) R8 gene and the like sequence difference regional analysis with draw
Object design；(3) amplification of R8 gene specific primer is verified with compatible degree.
3. a kind of design method of late blight of potato disease-resistant gene diagnostic primers according to claim 2, feature exist
In, it is characterised in that step (1) difference P. infestans resistant Potatoes disease-resistant gene sequencing includes: that selection plant of Solanaceae is disease-resistant
R gene has conservative NB-LRR and NB-ARC structural domain, designs 48,549 120-mer biotin marks according to conserved domain
Remember rna probe (being purchased from Agilent Technologies Inc)；Potato gene group DNA is extracted with CTAB method, uses ultrasonic wave
Genome is smashed as the segment of length 400-500bp, with disease-resistant in biotin labeling rna probe capture potato gene group
Gene and its disease resistance gene analog segment, by these sequencing fragments, then by these sequencing fragments with high rigor mismatch rate
It compares in R8 gene order.
4. a kind of design method of late blight of potato disease-resistant gene diagnostic primers according to claim 2, feature exist
In, it is characterised in that step (2) sequence difference regional analysis includes: to utilize 84 different genetic background potatos from design of primers
The sequencing information of material, the comparative analysis difference of R8 disease-resistant gene and its very high homology analog sequence, finds their sequences
The region design primer of significant difference；Simultaneously using Tub gene as reference gene, PCR is devised with primer-design software Primer5
Amplimer.
5. a kind of design method of late blight of potato disease-resistant gene diagnostic primers according to claim 2, feature exist
In the amplification of, it is characterised in that step (3) R8 gene specific primer verify with compatible degree include: 11 of random picking be completed it is anti-
The Potato Cultivars of ospc gene sequencing or the genomic DNA of material extracting are template, carry out PCR amplification.
6. a kind of late blight of potato disease-resistant gene diagnostic kit, comprising: primer and PCR react Mix, which is characterized in that institute
Stating primer is primer described in claim 1, and it includes: Taq archaeal dna polymerase, dNTPs, MgCl that PCR, which reacts Mix,2, reaction buffering
Liquid, concentration be 2 ×.
7. a kind of diagnostic method of late blight of potato disease-resistant gene R8, which is characterized in that diagnosed using following steps:
(1) potato total DNA is extracted；(2) PCR reaction system constructs；(3) PCR response procedures are arranged；(4) result judgement.
8. the diagnostic method of late blight of potato disease-resistant gene R8 according to claim 7 a kind of, which is characterized in that described
Step (4) result judgement includes: to carry out PCR amplification according to above-mentioned PCR system and amplification program；Amplification, which finishes, takes 10 μ l amplification to produce
1 μ l10 times electrophoresis sample-loading buffer is added in object, and electrophoresis under 120V voltage, observes item in the UV lamp on 1% Ago-Gel
Band size, reference gene amplified fragments size are 1432bp, can expand expected size segment, it was demonstrated that PCR system and program are just
Often；R8 gene specific diagnostic primers R8-Fd/R8-Rd is 682bp to amplified fragments, and no amplified fragments or amplified fragments size are not
Unanimously it is judged as in sample without R8 gene.
9. a kind of late blight of potato disease-resistant gene R8 diagnostic primers are in Potato Cultivars, strain and breeding material late blight resistance
Application in genescreen, which is characterized in that the diagnostic primers include: Tub gene internal control primer and the diagnosis of R8 gene specific
Primer, Tub gene internal control primer is as shown in sequence table SEQ ID NO:1 and SEQ ID NO:1, and R8 gene specific diagnostic primers are such as
Shown in sequence table SEQ ID NO:3 and SEQ ID NO:4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910492963.0A CN110229925B (en) | 2019-06-06 | 2019-06-06 | Potato late blight disease-resistant gene diagnosis primer and design method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910492963.0A CN110229925B (en) | 2019-06-06 | 2019-06-06 | Potato late blight disease-resistant gene diagnosis primer and design method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110229925A true CN110229925A (en) | 2019-09-13 |
| CN110229925B CN110229925B (en) | 2020-09-22 |
Family
ID=67859307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910492963.0A Active CN110229925B (en) | 2019-06-06 | 2019-06-06 | Potato late blight disease-resistant gene diagnosis primer and design method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110229925B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725505A (en) * | 2021-01-27 | 2021-04-30 | 华中农业大学 | Method for excavating potato wild species resource resisting late blight |
-
2019
- 2019-06-06 CN CN201910492963.0A patent/CN110229925B/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725505A (en) * | 2021-01-27 | 2021-04-30 | 华中农业大学 | Method for excavating potato wild species resource resisting late blight |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110229925B (en) | 2020-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sato et al. | Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.) | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN101440399B (en) | Molecular marking method for indicating and identifying litter size in pigs by MMP23 gene | |
| Lin et al. | Genetic diversity of rice germplasm used in Taiwan breeding programs. | |
| CN115927720B (en) | Soy saponin related KASP (KASP) mark and application thereof | |
| Wu et al. | Fine mapping and identification of blast resistance gene Pi-hk1 in a broad-spectrum resistant japonica rice landrace | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| Zhou et al. | Identification of novel alleles of the rice blast-resistance gene Pi9 through sequence-based allele mining | |
| CN109295247B (en) | Closely linked molecular marker yau403 of clubroot-resistant CRd gene of Chinese cabbage, primer and application | |
| CN109280709A (en) | One kind molecular labeling relevant to pig growth and reproductive trait and application | |
| CN101487056A (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN113774144A (en) | Anti-porcine reproductive and respiratory syndrome molecular marker and research and development and application of detection kit thereof | |
| CN110229925A (en) | A kind of late blight of potato disease-resistant gene diagnostic primers and its design method | |
| CN109134633A (en) | Blast resisting albumen and gene, the nucleic acid of separation and its application | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN117683927A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| Liu et al. | Molecular cloning and functional analysis of the pepper resistance gene Me3 to root-knot nematode | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| CN109468330B (en) | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof | |
| CN109706154B (en) | CsPR3 gene and application thereof in cucumber fusarium wilt resistance | |
| EP3772909A1 (en) | Genes associated with resistance to wheat yellow rust | |
| CN102776184B (en) | Genetic marker using pig CKM (creatine kinase muscle) 5' flanking promoter region SNP (single nucleotide polymorphism) as pig carcass traits and application | |
| CN115976248A (en) | Method for uniquely identifying populus diversifolia pie plants and kit used in method | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN109666757B (en) | Kit for identifying wheat vernalization gene VRN-D4 and special complete set of primer pair thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |