CN110225768A

CN110225768A - Target the pharmaceutical composition and method of CXCR7

Info

Publication number: CN110225768A
Application number: CN201880008458.8A
Authority: CN
Inventors: 王淼; 郝会峰; 陈虹
Original assignee: Fuwai Hospital of CAMS and PUMC
Current assignee: Fuwai Hospital of CAMS and PUMC
Priority date: 2017-01-26
Filing date: 2018-01-26
Publication date: 2019-09-10
Also published as: CN108355133A; WO2018137701A1

Abstract

The present invention relates to the pharmaceutical compositions and method for treating cardiovascular disease.Specifically, the present invention relates to the methods and pharmaceutical composition of the heart reconstruction after the blood vessel endothelium injury disease of the treatment object of targeting CXCR7 or the myocardial infarction of improvement object.

Description

Target the pharmaceutical composition and method of CXCR7

Related application

This application claims the priority for the Chinese patent application No.201710061692.4 that on January 26th, 2017 submits, and are herein incorporated herein entire contents by quoting.

Technical field

Background technique

The association study (GWA) of genome range is found, (it encodes Chemokine CXCL12 to CXCL12 locus, also known as stromal cell derived factor-1, SDF1) with coronary artery disease (CAD) and myocardial infarction (MI) with relevance (Nat Genet.2009；41:334-341；Nat Genet.2013；45:25-33), some of them risk allele (European heart journal.2011 related to plasma C XCL12 level raising；32:963-971).Higher plasma C XCL12 (European heart journal.2014 related to the myocardial infarction (MI) and death incident of Patients with Chronic Renal Disease；35:2115-2122), a perspective study table of Framingham Heart Study, (Arteriosclerosis, thrombosis, and vascular biology.2014 also associated with heart failure and general mortality rate；34:2100-2105).

There are two types of receptors by CXCL12: CXCR4, it is a kind of G- G-protein linked receptor (GPCR) of classics, and CXCR7, second of receptor (The Journal of biological chemistry.2005 of CXCL12 was just found to be in 2005；280:35760-35766).CXCR4 is considered participating in vascular remodeling (Circulation.2003；108:2491-2497；Circulation research.2005；96:784-791；Arteriosclerosis, thrombosis, and vascular biology.2014；34:1209-1220；Thrombosis and haemostasis.2012；107:356-368), atherosclerosis (Circulation research.2008；102:209-217) and myocardial infarction (Circulation.2007；116:654-663；Circulation.2008；117:2224-2231；J Am Coll Cardiol.2011；58:2415-2423), but function of the CXCR7 in cardiovascular disease is not known.In Symptomatic patients with coronary heart disease, CXCR4 (rather than CXCR7) expression reduces (Journal of thrombosis and haemostasis:JTH.2015 related to All-cause death and/or MI joint terminal；13:719-728).

CXCR7 occurs upper closely related with chemokine receptors in system, with affinity more higher than CXCR4 in conjunction with CXCL12, signal is transmitted by β-arrestin (non-classical G- albumen), but cannot be coupled to induce cell response (the J Exp Med.2006 of typical chemokine receptors-mediation with G-protein；203:2201-2213).It is considered the removing acceptor as CXCL12 before CXCR7, mediates effective ligand endocytosis and degradation (PLoS One.2010；5:e9175；Cell.2008；132:463-473；Proc Natl Acad Sci USA.2010；107:628-632).However, accumulative evidence, which shows CXCR7 also, has the signal except ligand removing active, including signal activity (the Proc Natl Acad Sci USA.2007 in growth of tumour cell and neomorph；104:15735-15740；J Biol Chem.2008；283:4283-4294；Mol Cancer.2014；13:198；Nature medicine.2016；22:154-162).

In people, CXCR7 expresses (J Exp Med.2006 in brain, heart, kidney, endothelium and tumour cell；203:2201-2213；PLoS One.2011；6:e20680).Its wide expression (Proc Natl Acad Sci USA.2007 in tumor vascular endothelium；104:15735-15740), and by hypoxia inducible (PLoS One.2013；8:e55290).Blood platelet had both expressed CXCR4 or had expressed CXCR7 (European heart journal.2014；35:386-394), but on the leucocyte in people or mouse blood CXCR7 albumen (Journal of immunology.2010 is not expressed；185:5130-5139).The mouse period from prenatal to postnatal of CXCR7 missing is just because of heart valve disorders death (Proc Natl Acad Sci USA.2007；104:14759-14764).Weber et al. uses hyperlipidemia Apoe ^-/-Mouse confirms that the whole of CXCR7 knocks out aggravation atherosclerosis, this defect (Circulation.2014 because of adipose tissue in terms of cholesterol intake；129:1244-1253).

Summary of the invention

The present invention provides the method for treating or preventing the cardiovascular disease of object, including applying a effective amount of expression for increasing CXCR7 albumen and/or active first drug to the object.Preferably, the present invention provides the method for the heart reconstruction after the blood vessel endothelium injury disease for the treatment of object or the myocardial infarction of improvement object, including applying a effective amount of expression for increasing CXCR7 albumen and/or active first drug to the object.

In an embodiment of method of the invention, the method for the cardiovascular disease for the treatment of or prevention object of the invention further includes that a effective amount of expression for reducing CXCR4 albumen and/or active second drug are applied to the object.In another embodiment, method of the invention further includes that the drug for inhibiting platelet activation and/or aggregation is applied to the object.In another embodiment, method of the invention further includes that the drug for stablizing patch is applied to the object.

The present invention also provides the pharmaceutical compositions of the cardiovascular disease for treating or preventing object, and it includes a effective amount of expression for being used to increase CXCR7 albumen and/or active first drugs.Preferably, the present invention is provided to the pharmaceutical composition of the heart reconstruction after the blood vessel endothelium injury disease for the treatment of object or the myocardial infarction of improvement object, it includes a effective amount of expression for being used to increase CXCR7 albumen and/or active first drugs.

In an embodiment of pharmaceutical composition of the invention, described pharmaceutical composition also includes the selective antagonist of a effective amount of CXCR4 or the nucleic acid molecules or expression vector for inhibiting CXCR4 protein expression.In another embodiment, described pharmaceutical composition is used for a effective amount of selective antagonist comprising CXCR4 or inhibits the nucleic acid molecules of CXCR4 protein expression or the second Drug combination of expression vector.In another embodiment, described pharmaceutical composition is used for the Drug combination with inhibition platelet activation and/or aggregation.In another embodiment, described pharmaceutical composition is used for and the Drug combination of stablizing patch.

The present invention also provides the purposes of expression and/or active first drug in the pharmaceutical composition for preparing the cardiovascular disease for treating or preventing object for increasing CXCR7 albumen.Preferably, the present invention is provided to increase the purposes of the expression of CXCR7 albumen and/or active first drug in the pharmaceutical composition of the heart reconstruction after preparing the blood vessel endothelium injury disease for treatment object or improving the myocardial infarction of object.

In an embodiment of purposes of the invention, described pharmaceutical composition also includes the selective antagonist of a effective amount of CXCR4 or the nucleic acid molecules or expression vector for inhibiting CXCR4 protein expression.In another embodiment, the second Drug combination of the nucleic acid molecules or expression vector of described pharmaceutical composition and a effective amount of selective antagonist comprising CXCR4 or inhibition CXCR4 protein expression.In the another embodiment of purposes of the invention, described pharmaceutical composition is used for the Drug combination with inhibition platelet activation and/or aggregation.In another embodiment, described pharmaceutical composition is used for and the Drug combination of stablizing patch.

According to the method for the present invention, pharmaceutical composition or purposes, the disease are selected from following set of: arrhythmia cordis and any combination thereof after heart failure, heart infarction after hemadostewnosis, PCI and Bypass Vascular Restenosis after Balloom, coronary heart disease, myocardial ischemia, myocardial infarction, heart infarction after thrombosis, thromboembolism, vascular damaged, damage.

The present invention also provides intravascular stent or with the conduit of sacculus, wherein the surface of the bracket or sacculus is coated with a effective amount of expression for increasing CXCR7 albumen and/or active first drug.

In an embodiment of intravascular stent of the invention or the conduit with sacculus, the surface of the bracket or sacculus is also coated with the selective antagonist of a effective amount of CXCR4 or inhibits the nucleic acid molecules or expression vector of CXCR4 protein expression.

Intravascular stent of the invention or the conduit with sacculus be used to treat or prevent object injury of blood vessel and/or myocardial ischemia it is diseases related, the disease is selected from following set of: arrhythmia cordis and any combination thereof after heart failure, heart infarction after hemadostewnosis, PCI and Bypass Vascular Restenosis after Balloom, coronary heart disease, myocardial ischemia, myocardial infarction, heart infarction after thrombosis, thromboembolism, vascular damaged, damage.

The present invention also provides treat or prevent object thrombosis related disease method, including to the object apply it is a effective amount of reduce circulation in CXCL12 the drug of level or activity the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof.

The present invention also provides the pharmaceutical composition of the thrombosis related disease for treating or preventing object, it includes a effective amount of drug of level or activity for reducing the CXCL12 in circulation or the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof.

The present invention also provides the drug of level or activity for reducing the CXCL12 in circulation or the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof purposes in the pharmaceutical composition for preparing thrombosis related disease for treating or preventing object.

The present invention also provides the pharmaceutical compositions for treating cancer, and it includes CXCR7 inhibitor, wherein the CXCR7 inhibitor does not increase blood CXCL12 level when being applied in subject.

The present invention also provides the methods that screening has the drug for treating cancer of high cardiovascular safety, comprising:

(i) drug candidate is applied to animal,

(ii) activity of the CXCR7 albumen in the tissue sample from the animal is measured, and

(iii) level of the CXCL12 albumen in the blood sample from the animal is measured,

Wherein active reduction of the activity of CXCR7 albumen relative to CXCR7 albumen in the identical tissue sample for the control-animal for not applying the drug candidate in the tissue sample of the animal, and in the blood sample of the animal content of CXCL12 albumen in the blood sample for the control-animal for not applying the drug candidate CXCL12 albumen be on close level or it is lower, prompting the drug candidate is the drug with the treating cancer of high cardiovascular safety.

It can be used in treating or preventing the method for the drug of cardiovascular disease the present invention also provides screening, comprising:

(i) drug candidate is applied to animal, and

(ii) expression and/or activity of the CXCR7 albumen in the tissue sample from the animal are measured,

Wherein the expression of CXCR7 albumen and/or activity relative to the expression of CXCR7 albumen in the identical tissue sample for the control-animal for not applying the drug candidate and/or active the raisings prompt drug candidate can treat or prevent cardiovascular disease in the tissue sample of the animal.

Detailed description of the invention

The endothelial cell of Fig. 1 people and mouse damaged arteries expresses CXCR7

A-D: 28 days hyperplasia femoral artery (B) after mouse health femoral artery (A) and seal wire damage, and in the aorta slice (C from the patient with dissection of aorta, D in), to CXCR7 (red) and vWF (endothelial cell marker, green) immunofluorescence dyeing is carried out, DAPI contaminates core (blue).The rightmost side is the merging of three kinds of colors.Grey photo in C1 shows dyeing site in Fig. 1 C compared with low magnification.Arrow is directed toward severe injury.The representative slice independently dyed from three is shown.The inner cavity L=, P=patch, Bar=50 μm.E: the expression of CXCR7 in the femoral artery of the cKO mouse before Ctl and tamoxifen induction.The femoral artery of cKO mouse before Ctl and tamoxifen induction is dyed with CXCR7 (red) and vWF (endothelial cell marker, green).DAPI contaminates core (blue).Bar=50 μm.

The inducible missing of Fig. 2 endothelium CXCR7 increases the Neointimal formation after internal boronization damage

A-F: the CXCR7 mRNA expression (A) being isolated from the mouse lung endothelial cell (MLEC) of endothelium CXCR7 conditionity knock-out mice (cKO) and littermate control (Ctl) by RT-PCR detection.CXCR7 (red) and vWF (green) immunofluorescence dyeing (B) is carried out in cKO the and Ctl artery after seal wire denudation injury.DAPI contaminates core (blue).In cKO, Neointimal formation (C) and inner membrance and middle film ratio (D) increase, and media thickness is constant (E).(F) is dyed by the representative HE for undermining undamaged artery from cKO and Ctl.Bar=100 μm；*, p < 0.05；*, p < 0.01；N=12cKO, 15Ctl.

G: the expression of CXCR7 in the cKO mouse endothelial cells after Ctl and tamoxifen induction.The separating mouse intrapulmonary chrotoplast (MLEC) from the mouse (cKO) and littermate control (Ctl) that CXCR7 endothelium conditionity knocks out.Pass through RT-PCR detection CXCR4 (A) and CXCL12 (B) mRNA expression.

The endothelial loss of Fig. 3 .CXCR7 is destroyed through the endothelialization again after stripping off caused by seal wire damage

A-F: the 7th day artery after being damaged using seal wire, for endothelial cell (A) (vWF, green), inner membrance macrophage (C) (F4/80, it is red) and PDGF-BB expression (E) (green) progress immunofluorescence dyeing (A, C, E) and corresponding quantitative (B, D, F).Arrow indicates endothelialization.Bar=100 μm；*, p < 0.05；N=10cKO, 9Ctl.G: the blood plasma level of PDGF-BB increases in the 7th day cKO after seal wire damage.(n=15, p < 0.05)

Fig. 4 blocks CXCR7 to influence external endothelial cell proliferation

It is horizontal that A-H:IL-1 β (10ng/mL) processing increases CXCR7 mRNA (A) and albumen (B) in the mouse lung endothelial cell (MLEC) of culture.IL-1 β (10ng/mL) promotes cell growth.Drug inhibition (CCX771) or gene delection CXCR7 inhibit the cell Proliferation in MLEC (C) and Mouse Aortic Endothelial cells (MAEC) (D).In MAEC, immunoblotting assay shows that IL-1 β increases ERK signal path, which is inhibited or lacked by CXCR7 to inhibit (E, F).In HUVEC, when being stimulated with IL-1 β, CCX771 (G) or CXCR7 (H) strike the low cell Proliferation of sinking.Each experiment carries out no less than 3 times.*, p < 0.05；*, p < 0.01.

I: with the expression of CXCR4 and CXCL12 in the culture mouse lung endothelial cell (MLEC) of IL-1 β processing.Before IL-1 β (10ng/mL) stimulation and 6 hours after stimulation, CXCR4 (A) and CXCL12 (B) mRNA is detected by RT-PCR.Pass through the immune-blotting method CXCR4 protein level (C) of the cell of IL-1 β (10ng/mL) incubation 0,6,12 and 24 hour.*, p < 0.05；*, p < 0.01.

J: the Drug inhibition CXCR7 influence to unprovoked endothelial cell proliferation.In the mouse lung endothelial cell (MLEC not stimulated by IL-1 β；) and Mouse Aortic Endothelial cells (MAEC A；B proliferation research is carried out in).Without significance,statistical.

K:CXCR7 inhibits to reduce the endothelial cell proliferation and angiogenesis of TNF α induction.

The CXCR7 protein expression (A) and endothelial cell proliferation (B) of TNF α induction.CXCR7 antagonist (B) or .Bar=200 μm of the cell Proliferation and angiogenesis reaction (D) that low (C) reduction induction is struck by si-RNA.

L:CXCR7 inhibits the influence to CXCR4 signal.

Relatively CXCR7 and/or CXCR4 is inhibited to form (A, B to tubule in the rat aorta endothelial cell (MAEC) of culture；Bar=500 μm), proliferation (C, D), migration (E, F；Bar=200 μm) and calcium release (G) influence.The inner skin surface expression of CXCR4 is not influenced (H) by CXCR7 inhibition in HUVEC.*, p < 0.05vs.si-Neg；N.S., nonsense vs.si-Neg.

The endothelial loss of Fig. 5 .CXCR7 generates the mouse medium vessels of posterior-limb ischemia to be reduced with blood flow functional restoration

A-I: it is pre-processing 6 hours with or without IL-1 β and is being formed with analysis tubule in si-CXCR7 or feminine gender si-RNA (si-Neg) HUVEC (A, B) transfected or human aorta endothelial cell (HAEC, C, D).Bar=500 μm.In a manner of blind test, in the blood flow (E) of predetermined point of time monitoring posterior-limb ischemia mouse.The endothelial loss of CXCR7 reduces hind limb blood flow and restores (F；N=8).Monitored hind leg region is identical between the two groups (G).The 21st day after ischemic, the vessel density (H) in the spatium intermusculare (IS) of gastrocnemius is detected by the immunostaining of vWF.VWF (green) dyes endothelial cell, and quantitative for vessel density.DAPI (blue) contaminates core.Quantitative (I is carried out to the mean vascular number in spatium intermusculare；N=3) .Bar=50 μm of in H.*, p < 0.05； P=0.053.

Fig. 6 mouse endothelial CXCR7 missing destroys cardiac function, reduces survival rate, the infarct size after increasing MI

A-K: survival curve (A；Kaplan-Meier method) show that cKO mouse has reduced time-to-live and higher cumulative mortality (n=18cKO, 20Ctl) after MI in 30 days.Mouse heart function is evaluated by blind test by sonographer 7 days after MI operation.The representative echocardiogram from Ctl and cKO mouse is shown in B.In cKO mouse, ejection fraction (EF；C), left ventricle Fractional area change (FAC；D), bicuspid valve peak value early stage arrives the ratio (E/A of diastasis filling velocity；) and diastole left room anterior wall thickness (LVAWd E；F (in two groups, n=12)) are reduced.CXCR7 is expressed in the Ctl mouse endothelial cells after MI, but (G) is not expressed in cKO endothelial cell.Masson dyeing is carried out to the heart of separation in the 28th day after MI operation and shows that infarct size increases (H, J in cKO group；N=8cKO, 9Ctl).(vWF is dyed to the endothelial cell immunotoxin in ischemic area ⁺, green, the representative vascular system of arrow expression) and show that cKO blood vessel density significantly reduces (I, K；N=3 in) .*, p < 0.05.G and I, Bar=50 μm.

Plasma C XCL12 is increased in mouse after Fig. 7 .MI

MI increases the CXCL12 blood plasma level in Ctl and cKO mouse.Compared with Ctl, cKO is shown in front of MI (be defined as " 0 ") and MI after higher plasma C XCL12 it is horizontal.*, p < 0.05vs.Ctl； 0 in p < 0.05vs.cKO； 0 in p < 0.05vs.Ctl.

The recombined adhenovirus of left ventricle injection expression CXCR7 improves cardiac function and reduces infarct size after Fig. 8 .MI

A-F: the expression (A) of CXCR7 is confirmed in the 293T cell line with adenovirus (Ad-CXCR7) transfection of expression CXCR7.The mouse of adenovirus (Ad-Neg) and Ad-CXCR7 from injection CXCR7 feminine gender collects heart, carries out CXCR7 dyeing (B, bar=50 μm).In the mouse (n=10Ad-Neg, 11Ad-CXCR7) of injection Ad-CXCR7, ejection fraction (EF；) and diastole left room anterior wall thickness (LVAWd C；E) improved.Infarct size reduces (D, F in the mouse of injection Ad-CXCR7；N=10Ad-Neg, 11Ad-CXCR7) .*, p < 0.05.

Fig. 9 .TC14012 promotes vascular endothelial cell proliferation

The area of Figure 10 .TC14012 reduction myocardial infarction

The restricted missing (A, B and E) of the endothelium of Figure 11 .CXCR7 and pharmacology antagonist (C, D and F) accelerate rat and form the time (A-D) of complete embolic occlusion and increase the CXCL12 (E&F) in circulation.

A-F: the conditionity that the endothelium CXCR7 of tamoxifen processing induction is described in detail in method knocks out (cKO), and for measuring plasma C XCL12 and photochemically-induced thrombosis.By subcutaneous injection 20mg/kg CCX771 or vehicle treated wild-type mice (C57BL/6), plasma C XCL12 and photochemically-induced thrombosis are checked after two hours.Representative Flow of carotid artery during the thrombosis of induction is referring to attached drawing (A&C).

Figure 12 .CXCL12 venoclysis increases CXCL12 and enhances photochemically-induced thrombosis by CXCR4

A-F: intravenous infusion CXCL12 increases circulation CXCL12 level (A&B), enhances collagen-induced in vitro Whole Blood Aggregation (C&D).CXCL12 infusion accelerates photochemically-induced thrombosis (E&F), and AMD3100 (CXCR4 specific inhibitor) eliminates the thrombosis accelerated.Representative Whole Blood Aggregation curve is shown in figure C, and representative carotid artery flow is shown in figure E.As indicated, infusion rates are 2 μ l/min, dosage 25ng/min/Kg.

The thrombosis reaction enhanced in Figure 13 .cKO is dependent on CXCR4

A-B:AMD3100 treatment eliminates the reaction of the pro-thrombotic as caused by the loss of endothelium CXCR7.A be shown in the thrombosis of induction during representative Flow of carotid artery.B indicates the result of the statistical analysis of the off-period in every group.

Figure 14 blood platelet is clearly helpful for the increase of circulation CXCL12 after endothelium CXCR7 removal

A-H: when ex vivo treatment whole blood, platelet agonist U46619 (A) or collagen (B) triggering CXCL12 release.It is injected intravenously U46619 (20 μ g/ mouse) and reduces number of platelets (Fig. 4 C) in 3 minutes, and increase plasma C XCL12 (Fig. 4 D).Platelet consumption caused by anti-CD41 antibody can reduce the circulation CXCL12 in cKO and Ctl, but raised CXCL12 level is maintained (Fig. 4 G) in cKO mouse.The ratio of CXCL12 is reduced higher than control (H) in every million decrease of platelet in cKO.The flow cytometry that palatelet-selectin (CD62P) is expressed in blood platelet show compared to Ctl, the blood platelet (E&F) with higher CD62P expression and activation in cKO.I: blood platelet is exhausted and recovery time.

Figure 15 A-B: the relevance of CXCL12 level and platelet reactivity in human blood circulation.

Detailed description of the invention

The present inventor is it has surprisingly been found that CXCR7 plays a key effect in maintaining endothelium integrality.Specifically, the inflammatory factor stimulation that can be discharged in injury of blood vessel induces, and promotes the proliferation of inflammation associated endothelial cells the inventors discovered that CXCR7 is expressed in impaired blood vessel；And the missing of endothelium CXCR7 can then promote as endothelium reparation reduce and caused by hemadostewnosis.The present inventors have additionally discovered that endothelium CXCR7 also functions to key effect in the angiogenesis that ischemic induces.Angiogenesis is the process that endothelial cell relies on, and new blood vessel is consequently formed, this is required for promoting regeneration after the revascularization and ischemic injuries after MI for saving cardiac muscle cell.Importantly, inventors have found that by CXCR7 gene by adenovirus be delivered to cardiac muscle improve MI after cardiac function and reduce myocardial infarction area.Therefore, activation CXCR7 will treat blood vessel endothelium injury disease or improve the heart reconstruction after myocardial infarction.

Correspondingly, the present invention provides the method for treating or preventing the cardiovascular disease of object, including applying a effective amount of expression for increasing CXCR7 albumen and/or active first drug to the object.Preferably, the present invention provides the method for the heart reconstruction after the blood vessel endothelium injury disease for the treatment of object or the myocardial infarction of improvement object, including applying a effective amount of expression for increasing CXCR7 albumen and/or active first drug to the object.

As used herein, term " object " refers to mammal, preferably primate, more preferable people.

In an embodiment of method of the invention, first drug include CXCR7 selective agonist, comprising coding CXCR7 albumen or its function fragment polynucleotides expression vector, or combinations thereof.In a specific embodiment, the selective agonist of the CXCR7 be selected from the activated form antibody of CXCR7, the activated form ligand of CXCR7, TC14012 or its functional homologue, and combinations thereof.

In the another embodiment of method of the invention, the method for the cardiovascular disease for the treatment of or prevention object of the invention further includes that a effective amount of expression for reducing CXCR4 albumen and/or active second drug are applied to the object.In one embodiment, second drug include CXCR4 selective antagonist, inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof.In a specific embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, TC14012 or its functional analogue, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

In another embodiment, method of the invention further includes that the drug for inhibiting platelet activation and/or aggregation is applied to the object.In another embodiment, method of the invention further includes that the drug of stable patch, such as statins are applied to the object.

In the method for the cardiovascular disease for the treatment of or prevention object of the invention, the described first and/or second drug is applied to object by way of oral, buccal, sucking, intravenous injection, intra arterial injection, intramuscular injection, subcutaneous injection, intraperitoneal injection or local application.In a specific embodiment of method of the invention, by being administered in coronary artery or the described first and/or second drug coat is realized the local application on intravascular stent or on the sacculus of the conduit with sacculus.

In an embodiment of pharmaceutical composition of the invention, first drug include CXCR7 selective agonist, comprising coding CXCR7 albumen or its function fragment polynucleotides expression vector, or combinations thereof.In a specific embodiment, the selective agonist of the CXCR7 be selected from the activated form antibody of CXCR7, the activated form ligand of CXCR7, TC14012 or its functional analogue, and combinations thereof.

In an embodiment of pharmaceutical composition of the invention, described pharmaceutical composition also includes the selective antagonist of a effective amount of CXCR4 or the nucleic acid molecules or expression vector for inhibiting CXCR4 protein expression.In another embodiment, described pharmaceutical composition is used for a effective amount of selective antagonist comprising CXCR4 or inhibits the nucleic acid molecules of CXCR4 protein expression or the second Drug combination of expression vector.In a specific embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, TC14012 or its functional analogue, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

In another embodiment, described pharmaceutical composition is used for the Drug combination with inhibition platelet activation and/or aggregation.In another embodiment, described pharmaceutical composition is used for and the Drug combination of stablizing patch, such as statins.

According to the present invention, described pharmaceutical composition is used to apply by way of oral, buccal, sucking, intravenous injection, intra arterial injection, intramuscular injection, subcutaneous injection, intraperitoneal injection or local application to object.In a specific embodiment, described pharmaceutical composition is for application in coronary artery.

In an embodiment of purposes of the invention, first drug include a effective amount of CXCR7 selective agonist, comprising coding CXCR7 albumen or its function fragment polynucleotides expression vector, or combinations thereof.In a specific embodiment, the selective agonist of the CXCR7 be selected from the activated form antibody of CXCR7, the activated form ligand of CXCR7, TC14012 or its functional analogue, and combinations thereof.

In an embodiment of purposes of the invention, described pharmaceutical composition also includes the selective antagonist of a effective amount of CXCR4 or the nucleic acid molecules or expression vector for inhibiting CXCR4 protein expression.In another embodiment, the second Drug combination of the nucleic acid molecules or expression vector of described pharmaceutical composition and a effective amount of selective antagonist comprising CXCR4 or inhibition CXCR4 protein expression.In a specific embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, TC14012 or its functional analogue, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

In the another embodiment of purposes of the invention, described pharmaceutical composition is used for the Drug combination with inhibition platelet activation and/or aggregation.In another embodiment, described pharmaceutical composition is used for and the Drug combination of stablizing patch, such as statins.

In accordance with the purpose of the invention, described pharmaceutical composition is used to apply by way of oral, buccal, sucking, intravenous injection, intra arterial injection, intramuscular injection, subcutaneous injection, intraperitoneal injection or local application to object.In a specific embodiment, described pharmaceutical composition is configured to the form for applying in coronary artery.

In an embodiment of intravascular stent of the invention or the conduit with sacculus, first drug include CXCR7 selective agonist, comprising coding CXCR7 albumen or its function fragment polynucleotides expression vector, or combinations thereof.In a specific embodiment, the selective agonist of the CXCR7 be selected from the activated form antibody of CXCR7, the activated form ligand of CXCR7, TC14012 or its functional analogue, and combinations thereof.

In the another embodiment of intravascular stent or the conduit with sacculus of the invention, the surface of the bracket or sacculus is also coated with the selective antagonist of a effective amount of CXCR4 or inhibits the nucleic acid molecules or expression vector of CXCR4 protein expression.In a specific embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

Intravascular stent of the invention or the conduit with sacculus be used to treat or prevent object injury of blood vessel and/or myocardial ischemia it is diseases related, the disease is selected from following set of: arrhythmia cordis and any combination thereof after heart failure, heart infarction after hemadostewnosis, PCI and Bypass Vascular Restenosis after Balloom, coronary heart disease, myocardial ischemia, myocardial infarction, heart infarction after thrombosis, thromboembolism, vascular damaged, damage.Preferably, it is coronary plaque and narrow that the injury of blood vessel is diseases related.Preferably, it is myocardial infarction that the myocardial ischemia is diseases related.

In addition, the present inventor is by experiment in vivo it has surprisingly been found that in the concentration with pathophysilogical significance, CXCL12 leads to thrombophilia.The present inventor is also surprisingly found that the enhancement effect of platelet activation is rather than the vascular wall CXCL12 as caused by the CXCL12 in circulation.Present inventors have further discovered that the trapping receptor endothelium CXCR7 of CXCL12 is required for maintaining the physiological levels of CXCL12, and inhibits CXCR7 the latter acts on blood platelet CXCR4 to causing CXCL12 to increase, to promote thrombosis.

Therefore, the present invention also provides treat or prevent object thrombosis related disease method, including to the object apply it is a effective amount of reduce circulation in CXCL12 the drug of level or activity the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof.

CXCR7 is the removing acceptor of CXCL12, mediates effective CXCL12 endocytosis and degradation.Therefore, in one embodiment, the horizontal drug for reducing the CXCL12 in circulation is the expression for increasing CXCR7 albumen and/or active drug, such as the expression vector of the polynucleotides comprising coding CXCR7 albumen or its function fragment.

In another embodiment, the drug of the level or activity for reducing the CXCL12 in circulation is anti-CXCL12 antibody.

In another embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

The present invention also provides the pharmaceutical composition of the thrombosis related disease for treating or preventing object, it includes a effective amount of drug of level or activity for reducing the CXCL12 in circulation or the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof.In one embodiment, the horizontal drug for reducing the CXCL12 in circulation is the expression for increasing CXCR7 albumen and/or active drug, such as the expression vector of the polynucleotides comprising coding CXCR7 albumen or its function fragment.In another embodiment, the drug of the level or activity for reducing the CXCL12 in circulation is anti-CXCL12 antibody.In another embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

The present invention also provides the drug of level or activity for reducing the CXCL12 in circulation or the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof purposes in the pharmaceutical composition for preparing thrombosis related disease for treating or preventing object.In one embodiment, the horizontal drug for reducing the CXCL12 in circulation is the expression for increasing CXCR7 albumen and/or active drug, such as the expression vector of the polynucleotides comprising coding CXCR7 albumen or its function fragment.In another embodiment, the drug of the level or activity for reducing the CXCL12 in circulation is anti-CXCL12 antibody.In another embodiment, the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, and combinations thereof.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the siRNA or its precursor for targeting CXCR4 gene transcript.In another embodiment, the nucleic acid molecules for inhibiting CXCR4 protein expression are the antisense RNAs for targeting CXCR4 gene transcript.

In addition, CXCR7 inhibitor has been proposed for the treatment of the diseases such as cancer recently.However, as described above, the present inventor using the inhibitor of such as CCX771 it has surprisingly been found that inhibit CXCR7 activity that can increase thrombus of heart blood vessel risk by increasing CXCL12 level in blood.Therefore, it is preferable to use not increasing the CXCR7 inhibitor of CXCL12 level in any treatment such as treatment of cancer using CXCR7 inhibitor.

The present invention also provides the pharmaceutical compositions for treating cancer, and it includes CXCR7 inhibitor, wherein the CXCR7 inhibitor does not increase blood CXCL12 level when being applied in subject.In some embodiments, the cancer includes but is not limited to liver cancer, breast cancer etc..

(i) drug candidate is applied to animal,

(i) drug candidate is applied to animal, and

In an embodiment for screening the method for drug that can be used in treatment or prevention cardiovascular disease of the invention, cardiac function of the activity of the CXCR7 albumen after promoting blood vessel endothelium proliferation, angiogenesis, promotion is promoted to damage vascular repair, reduce myocardial infarction area, improve Myocardial Remodeling after infarct, improve infarct.

As understood by those skilled in the art, the present invention above-mentioned drug or pharmaceutical composition can also include pharmaceutically acceptable carrier.Phrase " pharmaceutically acceptable " refers to the molecular entity and composition that undesirable, allergic or other unfavorable reactions will not be generated when being applied to animal (such as people) as required.The preparation of suitable pharmaceutical composition is those skilled in the art according to known to present disclosure, and be illustrated in " Remington:The Science and Practice of Pharmacy, " the 21st edition, 2005, it is expressly incorporated herein by reference.In addition, for human administration, it should be understood that preparation should also meet required by drug approval mechanism to the standard of aseptic, Pyrogenicity, overall security and purity.

" pharmaceutically acceptable carrier " used herein includes any and all solvents, decentralized medium, antioxidant, salt, coating, surfactant, preservative (such as methyl p-hydroxybenzoate or propyl ester, sorbic acid, antibacterial agent, antifungal agent), isotonic agent, solution retarding agents (such as paraffin), adsorbent (such as, kaolin, bentonite), drug stabilizing agent (such as, lauryl sodium sulfate), gel, adhesive (such as, syrup, Arabic gum, gelatin, sorbierite, tragacanth, polyvinylpyrrolidone, carboxymethyl cellulose, alginates), excipient (such as, lactose, polyethylene glycol), disintegrating agent (such as agar, starch, lactose, calcium phosphate, calcium carbonate, alginic acid, sorbierite, glycine), wetting agent (such as, hexadecanol, glycerin monostearate), lubricant, Sorbefacient (such as, quaternary ammonium salt), edible oil (such as, apricot kernel oil, cocounut oil, oily ester or propylene glycol), sweetener, flavoring agent, colorant, filler (such as, starch, lactose, sucrose, glucose, mannitol, silicic acid), tableting lubricant (such as, magnesium stearate, starch, glucose, lactose, chalk), sucking carrier (such as, hydrocarbon propellant), substance of buffer or the like and combinations thereof (see, for example, " Remington:The Science and Practice of Pharmacy, " the 21st edition, 2005).Any conventional carrier other than the conventional carrier incompatible with the active constituent is used for described therapeutic or pharmaceutical composition also in limit of consideration.

In any case, the composition may include a variety of antioxidants to block the oxidation of one or more components.The example of antioxidant includes ascorbic acid, cysteine hydrochloride, sodium sulfite, sodium hydrogensulfite, sodium pyrosulfite, ascorbyl palmitate, Butylated Hydroxytoluene, Butylated Hydroxyanisole, lecithin, propylgallate and tocopherol.In addition, prevent microbial action from can realize by using preservative, for example a variety of antibacterial agents of the preservative and antifungal agent, it includes but is not limited to parabens (for example, methyl p-hydroxybenzoate, propylparaben), methaform, phenol, sorbic acid, thimerosal or combinations thereof.

In some embodiments that the composition is liquid form, carrier can be solvent or decentralized medium, its include but is not limited to water, ethyl alcohol, polyalcohol (such as, glycerol, propylene glycol, liquid macrogol etc.), liquid (for example, triglycerides, vegetable oil, liposome) and combinations thereof.Mobility appropriate can be maintained, such as by using coating (such as lecithin) Lai Shixian；Required partial size is maintained to realize and being scattered in carrier (for example, liquid polyol or lipid)；By using surfactant (for example, hydroxypropyl cellulose) Lai Shixian；Or the combination of these methods.In many cases, isotonic agent (for example, sugar, sodium chloride or combinations thereof) is preferably comprised.

In some specific embodiments, it can be absorbed by the extension of medicament (for example, aluminum monostearate, gelatin or combinations thereof) the Lai Shixian composition for injection absorbed in the composition using delay.

As used herein, " effective quantity " or " therapeutically effective amount " refers to that be applied to object is at least enough to generate the amount of the substance of curative effect, compound, material or the composition comprising compound later.Therefore, be prevent, cure, improving, blocking or the symptom of partial block disease or illness necessary to amount.

The actual dose for applying the present composition to patient can be determined according to lower body and physiologic factor: weight, gender, severity of symptom, the type of treated disease, the therapy intervention being previously or is currently being, the unknown etiology disease of patient, administration time, the excretion rate of particular compound and administration method.Under any circumstance, the concentration of active constituent in composition will be determined by the medical worker for being responsible for application and is used for the suitable dose of individual subject.

Embodiment

Material and universal method

Mouse

The mouse lacked using tamoxifen-CreERT2 construction of strategy endothelium CXCR7.In short, (Nature cell biology.2015 as previously described；17:123-136) contain the mouse (CXCR7 in the site loxP- in CXCR7 flank ^f/f) CreERT2 (Cdh5 (PAC)-CreERT2+) mouse (Nature.2010 with the Cdh5- promoter driving provided by Ralf Adams；465:483-486) hybridize.The offspring CXCR7 of generation ^f/fCdh5-CreERT2+ hero mouse and CXCR7 ^f/fCdh5-CreERT2- female mice, which is mutually handed over, generates the animal (CXCR7 that endothelium CXCR7 conditionity knocks out ^f/fCdh5-CreERT2+, abbreviation cKO) and littermate control (CXCR7 ^f/fCdh5-CreERT2-, abbreviation Ctl).For the CXCR7 missing for inducing Cre enzyme to mediate, to experiment mice and littermate control intraperitoneal injection tamoxifen (Alfa Aesar, Heysham, England) (37.5mg/ml is dissolved in sunflower seeds oil), dosage is that 150mg/kg weight is daily, continuous three days.Then, it allows mouse to rest three days, carries out injecting for other three days later again.The effect that C57BL/6 mouse is overexpressed CXCR7 purchased from National Institute for Food and Drugs Control and for assessing the adenovirus in MI.All animal protocols obtain China national cardiovascular disease center, Fuwai Hospital, Experimental Animal Center, Institutional Animal nursing and the approval using the committee.

Human aorta sample

Human aorta sample is obtained from three dissection of aorta patients that Fuwai Hospital hospitalizes.During aorta prosthesis, sample collection enters physiological saline test tube, fixed in 10% formalin buffer to stay overnight, and further progress paraffin embedding and histotomy.

Femoral artery injury model

(Circulation.2011 as previously described；123:631-639) prepare femoral artery injury model.In short, passing through intraperitoneal injection yellow Jackets (70mg/kg) anesthetized mice.Groin incision exposure femoral artery in side simultaneously disconnects adjoint nerve and vein.Using 6-0 suture silk constraint femoral artery proximally and distally temporarily to control blood flow.The a bit of artery between rectus femoris and vastus medialis is separated, its proximal end is fettered with 6-0 suture silk, and laterally cut artery in this section.Then flexible guidewire (diameter 0.35mm, Cook Inc., IN, USA) is inserted into femoral artery from the section, and is inserted into 5mm or more to common iliac artery direction.By seal wire at this indwelling 3 minutes to strip off and expansion artery.Then seal wire is removed, the suture silk for fettering this section of arterial proximal is tightened.The suture silk for being used for middle clinopodium polycephalum is loosened so that femoral artery restoration of blood flow.Skin incision is closed using 5-0 suture silk.

Femoral artery is collected, paraffin embedding is continuously made the transverse section of 10-13 layers of damaged arteries from the distal end of femoral artery segment with 150 μm of interval, is used for morphology or histologic analysis.H&E dyeing is carried out to observe the severity of hyperplasia to the arterial section of damage the 28th day, the slice of hyperplasia most serious is used to compare.Using being installed on inverted microscope (DM6000B；Leica CCD camera) obtains image, is then measured using 6.0 software of Image-Pro Plus (Media Cybernetics) to image.Acquisition official jargon area, interior elastic layer internal area and outer elastic layer internal area are simultaneously analyzed.In order to assess endothelial regeneration and leukocyte infiltration/migration, using corresponding antibodies to progress immunostained for analysis in the middle part of the artery of damage the 7th day.

Myocardial infarction model

(Circulation research.2010 as previously described；107:1445-1453) chronic myocardial ischemia is caused by permanently ligaturing left anterior descending branch (LAD) coronary artery.In short, inhalation anesthesia wild type C57BL/6 mouse, opens chest, LAD is ligatured in the position apart from section start 2-3mm with 6-0 suture silk.To be overexpressed CXCR7, the 1 minute recombined adhenovirus (Ad-CXCR7) (using the 418-1506 nucleotide sequences of mouse CXC R7 mRNA (NM_001271607.1) for constructing recombined adhenovirus) or empty carrier, injection dosage to injection expression mouse CXC R7 in every mouse left ventricle is every mouse 1 × 10 before coronary artery ligation ⁹Plaque-forming unit.The success of confirmation ligation is raised by ST- sections of left ventricle color change and electrocardiogram (ECG).

Then closed-chest and stop anaesthetizing, continue to allow animal gradually to revive after ventilator feeds air 2-5 minutes.Heart function and left cell structure are measured by echocardiogram (2100 Imaging System of VisualSonics VeVo) at the 7th day, measurement index is left ventricular ejection fraction (EF), the variation (FAC) of left ventricle area, left ventricular interior diameter shorten score (FS), bicuspid valve diastole early late phase peak velocity ratio (E/A), left room anterior wall thickness (LVAW), left ventricular posterior wall thickness (LVPW) and bulk of left ventricle, and measure left room size.Acquisition heart and paraffin embedding after perfusion in (the 28th day) and formalin are fixed at the end of experiment.(Circulation.2015 is dyed by Masson；132:47-58) assess cardiac infarction situation.In short, obtaining a series of parasternal short axis slices (5 μm of thickness) with 200 μm of intervals.Representative middle layer slice dye using tri- color reagent of Masson (Leagene Biotec.Co, Ltd) and uses Zeiss optical microscopy (AXI0；Zeiss it) shoots.It is measured using 6.0 software of Image-Pro Plus (Media Cybernetics) and calculates infarct size.

Mouse hind leg ischemia model

It is caused posterior-limb ischemia (HLI) by ligaturing left femoral artery, ligatures position in femoral artery bifurcated and go out (Arteriosclerosis, thrombosis, and the vascular biology.2014 of the distal end at arteria saphena；34:408-418).Use laser Doppler flowmetry (LDF；PeriCam PSI) blood flow of hind leg is measured before ligation and after ligation immediately.Mouse of the hind limb blood flow decline not less than 50% will be done after ligation is included in this experiment.For the mouse of success Ligation of artery, blood flow three times was measured at the 4th, 7 and 14 day respectively.Blind is all made of to measure and analyze blood flow.At the 21st day, mouse was put to death by applying excessive sedative.Gastrocnemius, fixed and paraffin embedding, for analyzing vessel density are divided.In short, the maximum cross section of each gastrocnemius is taken to be dyed, disease three spatium intermusculares of random shooting in each slice.Then it counts and analyzes the blood vessel in photo.

Cell experiment

Cell separation: (Blood.2011 as previously described；118:464-472) separating mouse intrapulmonary chrotoplast (MLEC).In short, mouse is perfused by right ventricle with sterile PBS, haemocyte is removed.Separate the lobe of the lung, chopping, blend compounds protoenzyme (180-200U/mL；Worthington) in 37 DEG C of digestion (40 minutes).After through 75 μm of cell filter (BD Biosciences) filterings, with Dynabeads (Dynal Biotech) incubated cell of coating anti-mouse CD31 (BD Biosciences).With the cell on magnetic separator (Dynal) separation pearl, then it is cultivated 3 days in the coated culture dish/culture bottle of collagen I (Worthington), wherein containing addition 20% fetal calf serum (FBS), 1%AA (GIBCO) and 100mg/L endothelial cell growth supplement (ECGS；ScienCell DMEM).Dissociated cell and with coating rat anti-mouse CD102 (ICAM-2；Pharmingen Dynabeads) selects it.The MLEC of culture of isolated.

(Cell metabolism.2011 as previously described；13:592-600) separating mouse aortic endothelial cell (MAEC).In short, collecting aorta and removing periadventitial fat and connective tissue, and it is cut into 1-2mm ²Segment.It cultivates aorta segment 5-7 days in the medium, it is made to grow endothelial cell.Then endothelial cell is passed on and is cultivated.In order to separate human aorta endothelial cell (HAEC), the human aorta sample from Fuwai Hospital is collected in DMEM.It strips off aortic tunica intima layer and is handled in a manner of identical with MAEC culture.

(Journal of cellular and molecular medicine.2014 as previously described；18:2266-2274) separate Cardiac Fibroblasts.In short, the ventricle of separation newborn Wistar rats, cleans and shreds in PBS.Then tissue is digested in the PBS comprising 0.06% clostridiopetidase A (Worthington) in 37 DEG C.The cell suspending liquid of collection is centrifuged and is resuspended in the DMEM comprising 10%.By re-suspension liquid as in culture bottle and cultivate 90 minutes.Fibroblast tends to be attached to bottom.Remove non-adherent cell.It cultivates the Cardiac Fibroblasts of adherency and is then passed on pancreatin.

It is interfered by RNA and carries out gene silencing: in order to strike CXCR7, CXCR4, β-arrestin1 or β-arrestin2 albumen in low endothelial cell, carrying out siRNA gene silencing.In short, planting endothelial cell in 12 orifice plates.Before transfection, by 40pmol siRNA and 2.0 μ L Hieff Trans ^TMLiposomal Transfection Reagent (Yeasen, China) is mixed 20 minutes in 200 μ L DMEM.Change culture medium into DMEM.After twenty minutes, by (200 hole μ L/) in siRNA transfection reagent mixtures adding hole.Transfection continues 6 hours.Transfection media is discarded later, before further analysis, cell is cultivated in the culture medium containing 20%FBS no less than 6 hours.SiRNA for this research is as follows:

Negative control:

UUUUCCGAACGUGUCACGUTT；

Si-CXCR7:

CCCUGGAACAGAACACCAATT,

GCAACUACUCUGACAUCAATT,

GCAAGAUCACACACCUCAUTT；

Si-CXCR4 (Arteriosclerosis, thrombosis, and vascular biology.2014；34:1716-1722):

TGTCTCAACCGAGTCTGAATCTTCA,

TGGTACTTTGGGAAGTTCCTCTGCA,

CAGTTATCCTCATCCTGACTTTCTT,

GATCCGTATATTCACTTCCGATAAT；

si-β-arrestin1(Proceedings of the National Academy of Sciences of the United States of America.2010；107:628-632):

AGCCUUCUGUGCUGAGAAC；

si-β-arrestin2(Proceedings of the National Academy of Sciences of the United States of America.2010；107:628-632):

GGACCGCAAAGUGUUUGUG。

Cell Proliferation research: (the CCK-8 of Cell counting Kit -8 is used；Yeasen, Shanghai, China) measurement cell growth.In short, planting cell in 9 hole flat undersides.After cell adheres completely to bottom, the starved cells 6-8h in the culture medium containing 3%FBS but without ECGS.Then culture medium is replaced with culture medium-CCK-8 mixture (10: 1 volume ratio).After 4 hours, the light absorption value of 450nm is measured as background.Then it uses indicated reagent incubated cell 48 hours.Finally, replacing culture medium with culture medium-CCK-8 mixture again.After 4 hours, the light absorption value of 450nm is measured to show that cell is grown.It is as follows for the reagent concentration in cell research: 10ng/mL IL-1 β, 1 μM of CCX771 or CCX704 (by ChemoCentryx, Inc., Mountain View, CA, USA are provided two kinds of compounds).

Tubule forms measurement: hypoxemia-Conditioned immunolresponse forms measurement for endothelial tube.In short, the cardiac fibroblast in the DMEM comprising 3%FBS receives hypoxemia 12 hours caused by AnaeroPack-Anaero (MGC, Japan).Collection condition culture medium.Measurement is formed in order to carry out tubule, disperses in 96 orifice plates (40 μ L/well) for the Matrigel (Corning, NY, USA) of growth factor reduction using enfleurage pipe.It polymerize Matrigel 1 hour.Then endothelial cell is digested with pancreatin, be resuspended in Conditioned immunolresponse, and with 2 × 10 ⁴The concentration of cell per well is planted in plate.For inflammatory stimulus, cell is pre-processed 6-8 hours in the culture medium containing 20%FBS with IL-1 β (10ng/mL) or TNF α (25ng/mL).It is formed and is taken pictures using inverted phase contrast imaging microscope (Lycra, Germany) the observation micro-pipe with 5 × object lens within every 2 hours.From the 6th hour result for analyzing.Record and analyze at least 5 images from different cells.

Wound healing measurement: for cell migration assay, endothelial cell is implanted into 12 orifice plates.When reaching 90% growth and converging, cell is transfected with siRNA.Then it is cultivated cell 6-8 hours in the culture medium comprising 3%FBS and 10ng/mL IL-1 β.The cell monolayer in each hole is scraped to generate cell-free area using sterile pipette point later.The cell that removal falls off is cleaned with PBS.Damage is taken pictures and recorded immediately using the imaging microscope (Lycra, Germany) with 5 × object lens.After 24 hours, damage is taken pictures and recorded again.Each hole shoots 5 continuous microphotos.The cell compartment migrated to damage field is quantified using 6.0 software of Image-Pro Plus (Media Cybernetics).

Calcium ion response measurement: the cell with feminine gender siRNA or si-CXCR7 plants the overnight incubation in 96 orifice plates and in the culture medium comprising 20%FBS and 10ng/mL IL-1 β.For calcium ion fluorescent staining, cell Cal-520 ^TMDyestuff load solution (AAT Bioquest, Sunnyvale, CA) is cultivated 2 hours.Using FlexStation3 Microplate Reader (Molecular Devices, USA), respectively in the exciting light of wavelength 490 and 525nm and transmitting light detection fluorescence.After base line measurement in 17 seconds, 100ng/mL CXCL12 is added, and in addition measurement 78 seconds are responded to the calcium ion of generation.It adds within CXCR4 inhibitor AMD3100 (1 μ g/mL) 2 hours before CXCL12 stimulation.

Imaging flow cytometry measurement: it is expressed using the cell surface that ImageStreamX Mark II Imaging Flow Cytometer (Merck, Darmstadt, Germany) analyzes CXCR4 and CXCR7 in HUVEC.In short, the HUVEC for having transfected si-RNA or si-CXCR7 in 12 orifice plates is handled 6-8 hours with IL-1 β (10ng/mL).Then pancreatin digestion, centrifugation and the resuspension in 100 μ L FACS buffer solutions (HBSS comprising 0.6mg/mL bovine serum albumin(BSA) and 0.3mM EDTA).Antibody is added in cell suspension to be placed in and is dyed within 30 minutes on ice.With anti-CXCR7mAb, (11G8,1: 100) secondary antibody with Alexa Fluor-594- conjugation dyes CXCR7.CXCR4 is marked with CXCR4 antibody (mostly anti-, 1: 200, Sigma) and the secondary antibody of Alexa Fluor-488- conjugation.Then cell is analyzed and is taken pictures using ImageStreamX Mark II Imaging Flow Cytometer.

RNA separation and quantitative real-time PCR

In order to carry out RNA separation, the lytic cell in TRIzol (Invitrogen).Then solution and chloroform (5: 1, volume ratio) are mixed and is centrifuged (12,000g；15min；4℃).Water phase is collected, is mixed with isopropanol, centrifugation (12,000g；10min；4℃).After 75% alcohol washes, obtained RNA can be spare.It uses Select Master Mix (Invitrogen) carries out quantitative RT-PCR.The primer is as follows in this research:

β-actin is positive: ACCTTCTACAATGAGCTGCG；

β-actin is reversed: CTGGATGGCTACGTACATGG；

CXCR7 is positive: TTCATCAACCGCAACTACA；

CXCR7 is reversed: TCTCCTCTTCATACCACTCA；

CXCR4 is positive: CTCTACAGCAGCGTTCTC；

CXCR4 is reversed: TCAGGTATAGTCAGGAGGAG；

CXCL12 is positive: ACGGCTGAAGAACAACAA；

CXCL12 is reversed: GAAGATGAGGATGAGGAGAAT；

ENOS is positive: GGCATCACCAGGAAGAAG；

ENOS is reversed: GGACACCACATCATACTCAT.

Immunofluorescence

The slice (5 μm) of tissue from paraffin embedding is through dewaxing, rehydration, and by EDTA antigen retrieval water (PH 9.0；ZSGB-BIO, Beijing, China) in boil 2 minutes progress antigen retrievals.HUVEC is layered on coverslip (NUNC), and fixes 20 minutes in 4% paraformaldehyde.Then the lowlenthal serum of sample and the X-100 containing 0.3%Triton are incubated for, carry out closing and film rupture.It after incubation, is incubated overnight with primary antibody at 4 DEG C, sample and the secondary antibody that Alexa Fluor-594 is coupled and/or Alexa Fluor-488 is coupled are being incubated at room temperature 3 hours.With the VectaShield culture medium covering coverslip containing DAPI to contaminate core.Use the Zeiss inverted fluorescence microscope (AXI0 for being furnished with Zen software；Zeiss) or be furnished with 20 × water immersion objective laser scanning co-focusing microscope (SP8；Leica) slice is imaged.Image is analyzed using 6.0 software of Image-Pro Plus (Media Cybernetics, Inc.Rockville, MD, USA).Antibody used includes the anti-CXCR7 (11G8 of monoclonal antibody；1:100；There is provided by ChemoCentryx, Inc.), resist anti-vWF (1: 800 more；Sigma), resist anti-PDGF-BB (1: 200 more；Abcam), the anti-F4/80 (1: 50 of monoclonal antibody；BM8；Abcam), monoclonal antibody anti-beta Arrestin2 (1: 100；Abcam), resist anti-p-ERK (1: 100 more；CST).

Analysis in blood plasma

Blood plasma is obtained from the EDTA anticoagulation blood after centrifugation (6000g, 5min, 4 DEG C).User CXCL12ELISA kit (R&D Systems, Minnesota, USA) determines CXCL12 concentration.User PDGF-BB Quantikine ELISA kit (R&D Systems, Minnesota, USA) determines PDGF-BB concentration.Use automatic biochemistry analyzer (AU5421, Beckman Coulter, California, USA) to plasma glucose (GLU), total cholesterol, (CHOL, triglyceride (TG), free fatty acid (FFA), low density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C) and alanine aminotransferase (ALT) are measured.

Western blot analysis

In order to illustrate related signal path, by MAEC in the culture medium containing 3%FBS pre- starvation 6-8h, specified reagent temperature is added pre- 12 hours.Then containing protease inhibitors (Roche, Basel, Switherland) RIPA buffer in lytic cell, be centrifuged (15800g, cell lysate is mixed with sample-loading buffer after 10min) and is separated with 10%SDS-PAGE, is transferred on pvdf membrane later.Hybridized with specified antibody with film.Some films hybridize after decoloration with actin antibody again.Following primary antibody is used: for the polyclonal antibody (1: 1000 of phospho-ERK；CST), for the polyclonal antibody of ERK (1: 1000；CST), for the polyclonal antibody of phospho-P38 (1: 1000；CST), for the polyclonal antibody of P38 (1: 1000；CST), for the polyclonal antibody of phospho-JNK (1: 1000；CST), for the polyclonal antibody of JNK (1: 1000；CST), for the polyclonal antibody of phospho-eNOS (1: 500；CST), for the polyclonal antibody of CXCR4 (1: 1000；Sigma), and for CXCR7 polyclonal antibody (1: 500；Proteintech, Rosemont, USA).

Carotid thrombosis model

(Circulation research.2014 as previously described；114:947-956；Blood.2000；95:577-580) prepare mouse arteria carotis laser thrombus model.In short, the mouse (yellow Jackets, 70mg/kg) to anesthesia is injected intravenously rose-red (50mg/kg).Left common carotid is exposed to 2.5-mW green laser (540nm；Melles Griot Inc).With pulse Doppler (Transonic since there is damage, Sidney, Australia) continuously blood flow is detected until there is stable obstruction (being defined as no blood in 2 minutes), or continuously detect in the case where clog-free generation 90 minutes.Blocking time is defined as injury of blood vessel and originates to the time occurred between stable obstruction.In order to calculate average blocking time, for the animal of clog-free generation, blocking time is classified as 90 minutes.

Platelet aggregation measurement

ACD anticoagulant whole blood (ACD: blood volume ratio is 1: 9) is mixed with the preheating physiological saline of same volume, collagen (2 μ g/mL) induced aggregation is added.Sample is balanced 7 minutes at 37 DEG C before measurement.Then (1200rpm) carries out platelet aggregation under 37 DEG C of constant agitations in Chronolog710 aggregometer (Chronolog, Havertown, PA, USA).It records result and data is analyzed using Aggro/Link5 software (Chronolog, Havertown, PA, USA).

Platelet activation

In order to measure release of the CXCL12 from blood platelet, respectively in vivo with Activated in Vitro blood platelet.In vitro, platelet activation method is identical as measurement platelet aggregation method therefor.In short, ACD anticoagulant whole blood is mixed with the preheating physiological saline of same volume.Sample is balanced 7 minutes at 37 DEG C, collagen (2 μ g/mL) or U46619 (2mM is then added；Sigma) with activated blood platelet.It is centrifuged (6000g, 5min, 4 DEG C) after 30 minutes and collects blood plasma for detecting CXCL12.In vivo, it gives the mouse mainline U46619 of anesthesia (20ug/ mouse).EDTA anticoagulated whole blood is collected in 10 minutes.

Blood platelet is exhausted

By being injected intravenously CD41 antibody (20ug/ mouse；Ebioscience, USA) exhaust blood platelet.Respectively before the injection, injection after 2 hours and 5 days collection EDTA anticoagulant whole blood samples.

Study population

Patient in this research is 95 patients for being diagnosed as acute myocardial infarction AMI (AMI) and carrying out PCI immediately that Fuwai Hospital CCU is continuously taken in from August, 2014 in January, 2015.

People's blood is collected and platelet reactivity measurement

The ulnar vein blood of the 4 milliliters of citrate anticoagulations of acquisition in 4 days, detects platelet function using VerifyNow System (Accumetrics, San Diego, CA, USA) after PCI.Citrate anticoagulation blood is stored in 4 hours in room temperature and is measured for aspirin and P2Y12.As a result it is indicated with the P2Y12 reacton (PRU) of blood platelet and aspirin reacton (ARU).The Plavix of all patient equal oral aspirins and the 300mg of load before PCI for carrying out PCI, takes orally the aspirin of 100mg and the Plavix of 75mg daily later.If they did not take aspirin to the patient of STEMI before income, the aspirin of the 300mg of load is taken before PCI.Patient profiles are summarized in table 1.Approval of the scheme of this research through Beijing Union Medical College and the Fu Wai Hospital, Chinese Academy of Medical Sciences Medicine Ethics committee, and obtain the written informed consent of each patient.

The baseline of 1. patient of table characterizes

Statistical analysis

It is analyzed in the data that the different time points that one is tested obtain using the ANOVA of duplicate measurements.ANOVA comparison is carried out using Tukey multiple testing adjustment.When only comparing 2 average value, examined using double tail Mann-Whitney t.Logarithm (Mantel-Cox) is examined for comparing the survival difference between two groups.Data are indicated with average value ± SEM.Think there is statistically-significant difference when P < 0.05.

Embodiment 1: the endothelium expression of CXCR7 in mouse and people's damaged arteries

The vascular expression of CXCR7 in mouse is first checked for.CXCR7 low expression level (Figure 1A) in the endothelial cell that healthy mice disperses.However in damaged arteries, CXCR7 expression up-regulation, and be mainly seen in the endothelial cell of new intima, with endothelial cell marker vWF common location (Figure 1B).There is CXCR7 expression in the damaged endothelial cells of human aorta from the patient for carrying out dissection of aorta, especially in the capilary in atherosclerotic plaque shoulder (Fig. 1 C) and patch (Fig. 1 D).

Embodiment 2: the Neointimal formation after endothelium CXCR7 missing aggravation mouse endothelial denudation injury

Before tamoxifen induction, cKO mouse is similar with the CXCR7 baseline artery expression of littermate control (Fig. 1 E).After tamoxifen processing, mouse carries out internal boronization damage by angioplasty in femoral artery.The injury induced vascular proliferation response, the clinical restenosis after simulating percutaneous coronary intervention.All mouse do not carry out genetic manipulation related with lipid metaboli, and feed normal diet.

The mRNA expression of endothelium CXCR7 is substantially zero (Fig. 2A) from endothelial cell isolated in cKO mouse, further confirms that (Fig. 2 B) this results in damaged arteries immunostaining.The missing of CXCR7 and the expression (Fig. 2 G) for having not been changed CXCR4 and CXCL12.Internal boronization damage leads to neointimal hyperplasia.The missing of endothelium CXCR7 dramatically increases the ratio of new intima area and new intima and middle film, but does not change media thickness (Fig. 2 C-F).Endothelium CXCR7 lacks the weight or blood plasma lipide for not changing the normal mouse of these blood lipids.

Embodiment 3:CXCR7 increases the endothelial cell proliferation of IL-1 β processing and promotes the endothelial regeneration after internal boronization damage

7th day inspection early stage Vascular change after endothelial injuries.Endothelium CXCR7 depleted mice shows endothelial regeneration and is damaged (Fig. 3 A and 3B).The reduction (Fig. 3 C and 3D) of infiltrating mononuclear cells is also observed.It is interesting that the expression of PDGF-BB improves (Fig. 3 G) in theca interna (Fig. 3 E and 3F) and blood plasma.

In the endothelial cell for the culture for being isolated from mouse, IL-1 β stimulation makes CXCR7 (Fig. 4 A and 4B), CXCR4 and CXCL12 express up-regulation (Fig. 4 I).IL-1 β promotes the proliferation of the normally functioning endothelial cell of CXCR7, but does not promote the proliferation (Fig. 4 C and 4D) of CXCR7 deletion cells.In addition, with CXCR7 specific antagonists CCX771 (it has the IC50 of about 5.3nM, does not influence the combination of CXCL12 and CXCR4) (Journal of immunology.2009；183:3204-3211) and control compound CCX704 handles endothelial cell.CCX771 inhibits the proliferation of the endothelial cell of lung source (Fig. 4 C) and aorta source (Fig. 4 D).CCX771 processing reduces ERK phosphorylation, but does not influence JNK or p38 phosphorylation (Fig. 4 E and 4F).This promotes the effect of endothelial cell proliferation consistent with CXCR7.In no IL-1 β processing, the growth-promoting effect is unobvious (Fig. 4 J).In addition, CCX771 or siRNA strike the cell Proliferation (Fig. 4 G and 4H) in the presence of low CXCR7 inhibits IL-1 β in HUVEC.Using also observing similar results (Fig. 4 K) when TNF α.Injury of blood vessel is with the release of inflammatory factor, and CXCR7 can be induced by inflammatory stimulus, and in the proliferation for promoting inflammation associated endothelial cells.Therefore, CXCR7 can promote the endothelial regeneration of damaged blood vessels, promote endothelial cell reparation, mitigate hemadostewnosis caused by damaging.

CXCR4 siRNA or AMD3100 (a kind of CXCR4 antagonist, IC50 (the Journal of immunology.2009 with about 44nM；183:3204-3211), combination (the J Exp Med.2006 of CXCL2 and CXCR7 is not influenced；203:2201-2213) or the faint combination with CXCR7, Ki are about 34.5 μM of (Molecular pharmacology.2009；75:1240-1247)) proliferation of the endothelial cell handled is without significant difference (C and D of Fig. 4 L).As it can be seen that CXCR4 is inhibited not influence endothelial cell proliferation.

Embodiment 4: endothelium CXCR7 is most important to angiogenesis

Tubule forms the effect for checking CXCR7 in the reaction of endothelial cell new vascular generation.CXCR7 is blocked to significantly inhibit the angiogenesis (A and B of Fig. 5 A-D and Fig. 4 L) in HUVEC and HAEC and mouse EC by siRNA.In posterior-limb ischemia mouse model, endothelium CXCR7 missing significantly reduces the restoration of blood flow after femoral artery ligation, this can pass through laser-Doppler image checking (Fig. 5 E-G).Ischemic gastrocnemius medium vessels number, which reduces (Fig. 5 H and 5I), to be shown to the further histochemical staining of endothelium.Low CXCR7 or CXCR4 is struck by tiny RNA (si-RNA) transfection.The transfection control (si-Neg) in rat aorta endothelial cell (MAEC), si-CXCR7 (si-CXCR7 1, si-CXCR7 2, with si-CXCR7 3) or si-CXCR4 (si-CXCR4 1, si-CXCR4 2, si-CXCR4 3 and si-CXCR4 4) after 12 hours, determine CXCR7 (A) and CXCR4 (C) protein expression.A (CXCR4 immunoblotting picture) and B show CXCR7 strike it is low on CXCR4 express without influence.*, p < 0.05vs.si-Neg.

Therefore, the CXCR7 of endothelial cell plays a key effect in the angiogenesis for promoting ischemic induction, and before, the angiogenesis of ischemic induction is considered only mediating (Trends Immunol.2007 by the interaction of CXCL12 and CXCR4；28:299-307).

Embodiment 5: cardiac function and increase the death rate and infarct size after endothelium CXCR7 missing damage MI

Potential function of the endothelium CXCR7 in MI is had studied by ligaturing descending anterior branch., it is surprising that compared with control mice (Ctl), endothelium CXCR7 lacks (cKO) and significantly shortens time-to-live, and reduces the cumulative survival rate (Fig. 6 A) after MI in 30 days.CKO shows the cardiac function and remodeling significantly destroyed after MI, including reduced EF, E/A and LVAWd, although the baseline cardiac function of cKO does not change (Fig. 6 B-F, table 2 and 3).

Table 2. carries out cardiac ultrasonic to cKO and Ctl on the 7th day after MI

N=12 in two groups.

Data are indicated with average value ± SEM.

Table 3. carries out cardiac ultrasonic to untreated cKO and Ctl

N=7Ctl, 6cKO.

Data are indicated with average value ± SEM.

The immunofluorescence dyeing of infarcted hearts shows that the endothelium of control mice expresses CXCR7, but expression (Fig. 6 G) is had no in CXCR7 cKO mouse.Infarct size increases (Fig. 6 H and J) in Masson dyeing display cKO mouse heart, and infarcted region vessel density reduces (Fig. 6 I and K) at the same time.This, which shows that angiogenesis is impaired, can cause functional defect and increased myocardial fibrosis.It is worth noting that, although (J Am Coll Cardiol.2011 is worked in Cardioprotective of the supposition CXCL12 after MI before；58:2415-2423；J Exp Med.2006；203:2201-2213；Circulation research.2013；112:816-825), and this experiment also confirms that CXCL12 level is to increase (Fig. 7), but do not observe its protective effect to cardiac function after MI in endothelium CXCR7 deficient animal.

Embodiment 6: into infarcted hearts, gene delivery CXCR7 cardiac function and reduces infarct size after improving MI

In order to verify CXCR7 in vivo to the protective effect of heart infarction; we further construct the recombined adhenovirus (Ad-CXCR7) of expression CXCR7, and 1 minute left ventricular cavity (being detailed in material and universal method) by virion injection C57BL/6 mouse MI animal pattern before ligaturing descending anterior branch.The results show that Ad-CXCR7 delivering improves the cardiac function after MI compared with control vector, infarct size (Fig. 8, table 4) is reduced.

4. pairs of table have transfected adenovirus vector (Ad-Neg) or have expressed the mouse progress cardiac ultrasonic of the adenovirus (Ad-CXCR7) of CXCR7.

N=10Ad-Neg.11Ad-CXCR7.

Data are indicated with average value ± SEM.

The activation of embodiment 7:CXCR7 promotes endothelial cell proliferation and reduces infarct size

Mouse Aortic Endothelial cells are stimulated with IL-1 β, and with the selection agonist TC14012 of CXCR7 (https: //www.rndsystems.com/cn/products/tc-14012_4300) (Cayman Chemical, Michigan, USA it) handles cell 48 hours, then uses the (CCK-8 of Cell counting Kit -8；Yeasen, Shanghai, China) measurement cell growth.The results show that TC14012 remarkably promotes the growth (p < 0.05) (Fig. 9) of Mouse Aortic Endothelial cells in 100ng/mL compared with control (0ng/mL).

Influence of the selection agonist TC14012 of CXCR7 to myocardial infarction is had studied by ligaturing descending anterior branch.Ligation wild type C57BL/6 mouse coronary artery anterior descending branch causes ischemic, then injects TC14012, dosage 10mg/kg to mouse peritoneal, is dissolved in physiological saline, and injection in every 6 days is primary, totally 4 times, continues 24 days.The results show that TC14012 has been reduced significantly myocardial infarction area (Figure 10) caused by descending anterior branch ligation compared with control (physiological saline).

The above results prompt; the range of myocardial infarction caused by ischemic can be reduced using the selection agonist such as TC14012 activation CXCR7 of CXCR7; there is protective effect to ischemic myocardium; its reason and the activation of CXCR7 directly facilitate infarct location cardiac muscular tissue Endothelial Cell proliferation and vascularization it is associated, this is conducive to the recovery of the Myocardial Remodeling after MI and cardiac function.

Embodiment 8: the level of CXCL12 in endothelium CXCR7 missing and pharmacologic block CXCR7 raising circulation

In order to determine effect of the CXCR7 in thrombosis, CXCR7 conditionity knock-out mice (cKO) is constructed, and according to (The Journal of clinical investigation.2006 described in document；Photochemically-induced thrombosis assessment 116:1391-1399) is carried out to mouse.Compared with the control mice (Ctl) of littermate, cKO mouse forms the time blocked completely and significantly shortens (Figure 11 A&B).Endothelial cell missing CXCR7 leads to the horizontal raising (Figure 11 E) of CXCL12 in the circulating cycle, this (PLoS One.2010 consistent with the function of ligand street cleaner of CXCR7；5:e9175；Blood.2012；119:465-468).Similarly, with CXCR7 specific antagonists CCX771 (Journal of immunology.2009；183:3204-3211) pharmacology inhibits CXCR7 to also promote the formation (Figure 11 C&D) of thrombus and plasma C XCL12 is made to increase (Figure 11 F).And another ligand --- CXCL11 (the PLoS One.2010 that can be removed by CXCR7；5:e9175) --- it is not detected in all these mouse.The horizontal of CXCL12 in circulation is caused to increase and accelerate thrombosis response it can be seen that the expression or activity of endothelial cell CXCR7 reduce.

Embodiment 9: CXCL12 level is raised through CXCL12-CXCR4 signal pathway promotion thrombosis in circulation

In vitro, CXCL12 promotes platelet activation by its homoreceptor CXCR4.In order to which the CXCL12 in direct assessments is in vivo to the influence of thrombosis, venous channel is established directly by CXCL12 infusion (CXCL12 or infusion physiological saline that are dissolved in physiological saline with 0.25 or 0.5ng/min infusion) into blood flow (Figure 12 A) to mouse.By the plasma concentration for measuring CXCL12, it was demonstrated that CXCL12 can be successfully delivered (Figure 12 B).The moderate of CXCL12 is increased with concentration dependant manner promotion ex vivo platelet aggregation (Figure 12 C&D) in circulation after infusion.CXCL12 infusion also promotes thrombosis to accelerate (Figure 12 E&F) in vivo.It is pre-processed by using CXCR4 specific antagonists AMD3100, this pro-thrombotic effect (Figure 12 E&F) of CXCL12 can be eliminated.In addition, AMD3100 processing also eliminates the pro-thrombotic effect (Figure 13 A&B) caused by endothelial cell CXCR7 is knocked out.Therefore, by CXCR4 signal pathway, the raising on CXCL12 physiologic meaning in circulation causes thrombophilia.

Embodiment 10: blood platelet is facilitated and CXCL12 of the response after endothelial cell CXCR7 missing is increased

Blood platelet contains CXCL12 and discharges CXCL12 (The Journal of experimental medicine.2006 after activation；203:1221-1233), but it is unclear that whether blood platelet is the source of CXCL12 in vivo and whether blood platelet facilitates the raising of CXCL12 in cKO.

Firstly, with platelet agonist, i.e. U46619 or collagen handle in vitro whole blood and trigger intra platelet free calcium (Figure 14 A&B).Intravenous injection platelet activating agent U46619 makes the blood platelet in blood flow assemble (Figure 14 C) rapidly, and CXCL12 level about increases at double, and the blood platelet of this prompt activation is the important sources (Figure 14 D) of body-internal-circulation CXCL12.

Then, blood platelet is exhausted by injecting anti-CD41 antibody to mouse, which causes 2 hours blood platelets after injection substantially to be exhausted, the 5th talent restores (Figure 14 I).Blood platelet exhausts the CXCL12 decline made in circulation in cKO and Ctl, but the two is compared, and it is horizontal (Figure 14 G) that cKO mouse maintains higher CXCL12.Therefore, the CXCL12 in circulation also includes the CXCL12 from other sources in addition to blood platelet, and the CXCL12 level in circulation is by the adjusting of endothelial cell CXCR7.It is worth noting that, blood platelet is (Figure 14 H) larger to the contribution of the CXCL12 in circulation in cKO compared to Ctl.Pass through the expression (Circulation.2015 of the p- selectin (CD62P) of Flow Cytometry Assay blood platelet；132:47-58), compared to Ctl, it is found that cKO there are more CD62P positive blood platelets.This prompt, in cKO, platelet activation causes to recycle CXCL12 level raising (Figure 14 H).

Embodiment 11: the relevance of CXCL12 level and platelet reactivity in human blood circulation

Inventor further has studied the CXCL12 of circulation and the correlation of platelet reactivity in patients of acute myocardial infarction.The peripheric venous blood from continuous selected patient is collected, for measuring plasma C XCL12, and uses VerifyNow method in-site measurement platelet reactivity (being detailed in material and universal method part).The platelet reactivity of unexpectedly, CXCL12 level and ADP induction is positively correlated (Figure 15 A), this supports the CXCL12 in circulation to have direct effect to platelet activation.CXCL12 (Figure 15 B) uncorrelated to VerifyNow-AA, reason is perhaps related (table 1) with these patient's Aspirins, because of the TxB triggered by CXCL12 ₂Release has mediated platelet aggregation (Blood.2000 in vitro；96:50-57).

Claims

Increase the purposes of the expression and/or active first drug of CXCR7 albumen in the pharmaceutical composition for preparing the cardiovascular disease for treating or preventing object.
The purposes of claim 1, wherein increasing the selective agonist of expression and/or active first drug selected from CXCR7 of CXCR7 albumen or the expression vector of the polynucleotides comprising coding CXCR7 albumen or its function fragment.
The purposes of claim 2, wherein the selective agonist of the CXCR7 be selected from the activated form antibody of CXCR7, the activated form ligand of CXCR7, TC14012 or its functional analogue, and combinations thereof.
The purposes of any one of claim 1-3, wherein described pharmaceutical composition also includes the selective antagonist of a effective amount of CXCR4 or the nucleic acid molecules or expression vector for inhibiting CXCR4 protein expression.
The purposes of any one of claim 1-3, wherein the second Drug combination of the nucleic acid molecules or expression vector of pharmaceutical composition and a effective amount of selective antagonist comprising CXCR4 or inhibition CXCR4 protein expression.
The purposes of claim 4 or 5, wherein the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, TC14012 or its functional analogue, and combinations thereof.
The purposes of claim 4 or 5, wherein the nucleic acid molecules for inhibiting CXCR4 protein expression are selected from the siRNA of targeting CXCR4 gene transcript or the antisense RNA of its precursor and targeting CXCR4 gene transcript.
The purposes of any one of claim 1-7, wherein described pharmaceutical composition is used for the drug selected from inhibition platelet activation and/or aggregation and stablizes the Drug combination of patch.
The purposes of any one of claim 1-8, wherein described pharmaceutical composition is used to apply by way of oral, buccal, sucking, intravenous injection, intra arterial injection, intramuscular injection, subcutaneous injection, intraperitoneal injection or local application to object.
The purposes of claim 9, wherein the described pharmaceutical composition is for application in coronary artery.
The purposes of any one of claim 1-10, wherein the disease be selected from it is following set of: arrhythmia cordis and any combination thereof after heart failure, heart infarction after hemadostewnosis, PCI and Bypass Vascular Restenosis after Balloom, coronary heart disease, myocardial ischemia, myocardial infarction, heart infarction after thrombosis, thromboembolism, vascular damaged, damage.
The purposes of claim 1-11, wherein described pharmaceutical composition is for the heart reconstruction after the blood vessel endothelium injury for the treatment of object or the myocardial infarction of improvement object.
Intravascular stent or conduit with sacculus, wherein the surface of the bracket or sacculus is coated with a effective amount of expression for increasing CXCR7 albumen and/or active first drug.
The intravascular stent of claim 13 or conduit with sacculus, wherein first drug is selected from the selective agonist of CXCR7, includes coding CXCR7 albumen or the expression vector of polynucleotides of its function fragment and combinations thereof.
The intravascular stent of claim 14 or conduit with sacculus, wherein the selective agonist of the CXCR7 be selected from the activated form antibody of CXCR7, the activated form ligand of CXCR7, TC14012 or its functional analogue, and combinations thereof.
The intravascular stent of any one of claim 13-15 or conduit with sacculus, wherein the surface of the bracket or sacculus is also coated with the selective antagonist of a effective amount of CXCR4 or inhibits the nucleic acid molecules or expression vector of CXCR4 protein expression.
The intravascular stent of claim 16 or conduit with sacculus, wherein the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, and combinations thereof.
The intravascular stent of claim 16 or conduit with sacculus, wherein the nucleic acid molecules for inhibiting CXCR4 protein expression are selected from the siRNA or its precursor or the antisense RNA for targeting CXCR4 gene transcript of targeting CXCR4 gene transcript.
Reduce the CXCL12 in circulation the drug of level or activity the selective antagonist of CXCR4 or inhibit CXCR4 protein expression nucleic acid molecules or expression vector, or combinations thereof purposes in the pharmaceutical composition for preparing thrombosis related disease for treating or preventing object.
The purposes of claim 19, wherein the drug of the level or activity for reducing the CXCL12 in circulation is selected from the expression for increasing CXCR7 albumen and/or active drug and anti-CXCL12 antibody.
The purposes of claim 20, wherein the expression for increasing CXCR7 albumen and/or active drug are the expression vectors of the polynucleotides comprising coding CXCR7 albumen or its function fragment.
The purposes of claim 19, wherein the selective antagonist of the CXCR4 be selected from AMD3100 or its functional analogue, the blocking antibody of CXCR4 or its antigen-binding fragment, and combinations thereof.
The purposes of claim 19, wherein the nucleic acid molecules for inhibiting CXCR4 protein expression are selected from the siRNA of targeting CXCR4 gene transcript or the antisense RNA of its precursor and targeting CXCR4 gene transcript.
For the pharmaceutical composition for the treatment of cancer, it includes CXCR7 inhibitor, wherein the CXCR7 inhibitor does not increase blood CXCL12 level when being applied in subject.
Screen the method with the drug for treating cancer of high cardiovascular safety, comprising:

(i) drug candidate is applied to animal,

(ii) activity of the CXCR7 albumen in the tissue sample from the animal is measured, and

(iii) level of the CXCL12 albumen in the blood sample from the animal is measured,

Wherein active reduction of the activity of CXCR7 albumen relative to CXCR7 albumen in the identical tissue sample for the control-animal for not applying the drug candidate in the tissue sample of the animal, and in the blood sample of the animal content of CXCL12 albumen in the blood sample for the control-animal for not applying the drug candidate CXCL12 albumen be on close level or it is lower, prompting the drug candidate is the drug with the treating cancer of high cardiovascular safety.
Screening can be used in the method for treating or preventing the drug of cardiovascular disease, comprising:

(i) drug candidate is applied to animal, and

(ii) expression and/or activity of the CXCR7 albumen in the tissue sample from the animal are measured,

Wherein in the tissue sample of the animal expression of CXCR7 albumen and/or activity relative to CXCR7 albumen in the identical tissue sample for the control-animal for not applying the drug candidate expression and/or it is active raising show that the drug candidate can treat or prevent cardiovascular disease.
The method of claim 26, wherein the activity of the CXCR7 albumen is selected from Myocardial Remodeling after promoting blood vessel endothelium proliferation, promoting angiogenesis, promote damage vascular repair, reduce myocardial infarction area, improving infarct, improves the cardiac function after infarct.