CN110218235B

CN110218235B - Compound, preparation method thereof and application of compound as fluorescent polarization probe in LXR beta ligand screening

Info

Publication number: CN110218235B
Application number: CN201910392278.0A
Authority: CN
Inventors: 周晖皓; 张子振; 陈浩; 顾琼; 徐峻
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2019-05-09
Filing date: 2019-05-09
Publication date: 2020-09-25
Anticipated expiration: 2039-05-09
Also published as: CN110218235A

Abstract

The invention relates to a compound, a preparation method thereof and application of the compound as a fluorescent polarization probe in LXR β ligand screening, wherein the structural formula of the compound is shown as the formula (I):

the compound provided by the invention has fluorescent characteristics and has better specific binding to LXR β, the compound is used as a fluorescent polarization probe, and the screening of LXR β ligand and the evaluation of ligand affinity level can be realized by a competition method, based on the screening method established by the invention, 20 small molecular weight compounds capable of binding LXR β are obtained by screening, and a foundation is provided for the subsequent LXR β targeted drug design.

Description

Compound, preparation method thereof and application of compound as fluorescent polarization probe in LXR beta ligand screening

Technical Field

The invention relates to the technical field of biomedicine, in particular to a compound, a preparation method thereof and application of the compound as a fluorescence polarization probe in LXRbeta ligand screening.

Technical Field

Liver X Receptors (LXRs) belong to the nuclear receptor superfamily, and can regulate physiological processes related to cholesterol and fat metabolism, carbohydrate metabolism, anti-inflammation and the like by regulating the transcription of related genes. LXRs therefore also become important drug targets in nuclear receptors.

LXRs are mainly composed of a DNA binding domain, a ligand binding domain, and further have an activation domain 1(AF1) and an activation domain 2(AF2) at their N-and C-termini, respectively. LXRs were originally thought of as orphan receptors, but later studies thought that compounds that oxidize sterols, such as 24(S) -hydroxycholesterol, were their endogenous ligands. LXRs, like some nuclear receptors, are capable of forming heterodimers with RXRs. The LXR/RXR heterodimer binds to the promoter region of the corresponding target gene on DNA, binding to the LXR response element (LXRE). When an LXR agonist binds to the LXR ligand binding domain, co-activators can be recruited to promote transcription of downstream target genes.

Over a twenty-year study, numerous LXR agonists have been developed. Such as T091317, GW3965, etc., as typical. However, these compounds all have the side effect of raising triglycerides. LXRs consist of two subtypes, LXR α (NR1H3) and LXR β (NR1H 2). The two have 77% homology in sequence, but are distributed differently in vivo. LXR α is mainly expressed centrally in liver, small intestine, kidney, spleen and adipose tissue, while LXR β is widely distributed in vivo. Later studies demonstrated that these side effects could be due to LXR α, and subsequent drug development was mostly focused on the development of LXR β selective agonists. In addition, with the increased interest in LXRs, there is a greater understanding of LXR physiological functions and indications. From the initial development towards atherosclerosis, the range of indications has expanded to now to diabetes, alzheimer, atopic dermatitis and some cancers.

LXR-623 is the first LXR agonist to enter clinical trials developed by Wyeth, but ends up failing due to side effects in the central nervous system. BMS-852927, developed by Bristol-Myers Squibb, also failed clinical trials due to side effects such as elevated triglycerides. The development of other drugs is rapidly advanced, and at present, two drugs are in clinical trials. RGX-104 for the treatment of solid tumors and lymphoma has entered clinical stage I, and ALX-101 for the treatment of atopic dermatitis has entered clinical stage II. However, the search for LXR agonists with more diverse structures and more significant therapeutic effects remains a concern in both academia and industry.

In order to find novel LXR agonists, researchers have established several screening methods. Such as reporter gene experiments performed at the cellular level. However, the cell level screening experiment has the defects of many influencing factors, long screening period and the like, and the rapid large-scale screening of the compounds is difficult to realize. Screening methods at the protein level include fluorescence resonance energy transfer, homogeneous time-resolved fluorescence, AlphaScreen, and the like. However, these methods are based on the principle that LXRs are able to recruit co-activators upon binding of a ligand, and thus measure the ability of LXRs to recruit co-activators. The method for directly detecting the combination of the ligand and the LXR on the protein level is mainly a scintillation nearest neighbor method, and the detection is realized by a positive compound of a competitive isotope label of the ligand to be detected. Although this method is less protein-consuming, isotopically labeled compounds are difficult to obtain and difficult to achieve for screening purposes. Therefore, other methods for screening protein levels still need to be established.

Fluorescence polarization is a method that enables detection of molecular interactions. The ligand is marked by the fluorescent group, and a competition experiment is carried out, so that the detection of the binding capacity of the compound to be detected and the receptor can be realized. The basic principle is that the rotation speed of small molecules in a solution is higher than that of large molecules, so that the polarization value generated by a fluorescent compound which does not combine with the large molecules is lower; when the fluorescent compound binds to the macromolecule, the rotation slows, resulting in a higher polarization value. Therefore, the fluorescence polarization is a detection method which can realize detection on a micropore plate, has small reagent dosage and can realize high-throughput screening.

For other nuclear receptors, methods based on fluorescence polarization competition have been developed as corresponding detection methods and even commercial kits. However, detailed reports of the ability of compounds to bind to LXR using fluorescence polarization methods have not been reported for a long time.

Disclosure of Invention

The object of the present invention is to overcome the drawbacks and disadvantages of the prior art and to provide a compound. The compound provided by the invention has a fluorescent characteristic and has better specific binding to LXRbeta. The compound is used as a fluorescence polarization probe, and the screening of the LXRbeta ligand and the evaluation of the affinity level of the ligand can be realized by a competition method; based on the screening method established by the invention, 20 small molecular weight compounds capable of combining LXRbeta are obtained by screening, and a foundation is provided for the subsequent LXRbeta-targeted drug design.

Another object of the present invention is to provide a process for producing the above compound.

The invention also aims to provide application of the compound as a fluorescence polarization probe in LXR beta ligand screening.

Another object of the present invention is to provide a method for screening LXR β ligands.

In order to achieve the purpose, the invention adopts the following technical scheme:

a compound having the formula (I):

the compound provided by the invention has a fluorescent characteristic and has better specific binding to LXRbeta. The compound is used as a fluorescence polarization probe, and the screening of the LXRbeta ligand and the evaluation of the affinity level of the ligand can be realized by a competition method; based on the screening method established by the invention, 20 small molecular weight compounds capable of combining LXRbeta are obtained by screening, and a foundation is provided for the subsequent LXRbeta-targeted drug design.

The preparation method of the compound comprises the following steps:

s1: carrying out amide reaction on hyodeoxycholic acid and tert-butyl (6-aminohexyl) carbamate to obtain an intermediate 1 a;

s2: and deprotecting the intermediate 1a, and carrying out nucleophilic addition reaction with fluorescein isothiocyanate FITC at 50-60 ℃ to obtain the compound.

The amide reaction in S1 can be carried out according to conventional amide reaction conditions.

Preferably, the organic solvent used for the amide reaction in S1 is one or more of DMF, DHF or acetonitrile.

Preferably, the condensing agent used in the amide reaction in S1 is one or more of PyBoc, HOAT, HOBT, HBTU, or BOP.

Preferably, the base used in the amide reaction in S1 is one or more of N, N-diisopropylethylamine or triethylamine.

Preferably, the mole ratio of hyodeoxycholic acid to tert-butyl (6-aminohexyl) carbamate in S1 is 1: 1-1: 2

The deprotection reaction in S2 can be carried out according to conventional deprotection reaction conditions.

Preferably, the organic solvent used for the deprotection reaction in S2 is one or more of 1, 4-dioxane, DMF or THF.

Preferably, the acid used for the deprotection reaction in S2 is one of HCl, acetic acid or trifluoroacetic acid.

The nucleophilic addition reaction in S2 can be carried out according to conventional reaction conditions.

Preferably, the organic solvent used in the nucleophilic addition reaction in S2 is one or more of 1, 4-dioxane, DMF or THF.

Preferably, the base used in the nucleophilic addition reaction in S2 is one or more of DIPEA or triethylamine.

Preferably, the molar ratio of the intermediate 1a to fluorescein isothiocyanate in S2 is 1: 1-1: 2.

The application of the compound as a fluorescence polarization probe in LXR beta ligand screening is also in the protection scope of the invention.

The invention also claims a method for screening the LXR beta ligand, which comprises the following steps:

s3: mixing a compound according to claim 1, a protein comprising a LXR β ligand binding domain, and a test compound to form a mixture;

s4: and (3) measuring the polarization value of the mixture by using a fluorescence polarization technology, and confirming whether the compound to be tested is the ligand of LXRbeta or not according to the polarization value.

In general, a decrease in polarization value of greater than 25% of the detection window is considered to be a ligand for LXR β.

Preferably, the protein sequence of said LXR β ligand binding domain in S3 is:

MGHHHHHHGEGVQLTAAQELMIQQLVAAQLQCNKRSFSDQPKVTPWPLGADPASGSASQQRFAHFTELAIISVQEIVDFAKQVPGFLQLGREDQIALLKASTIEIMLLETARRYNHETECITFLKDFTYSKDDFHRAGLQVEFINPIFEFSRAMRRLGLDDAEYALLIAINIFSADRPNVQEPGRVEALQQPYVEALLSYTRIKRPQDQLRFPRMLMKLVSLRTLSSVHSEQVFALRLQDKKLPPLLSEIWDVHEGSGSGSHKILHRLLQDSSS。

preferably, the corresponding DNA sequence is:

ATGGGCGAGGGTGTCCAGCTAACAGCGGCTCAAGAACTAATGATCCAGCAGTTGGTGGCGGCCCAACTGCAGTGCAACAAACGCTCCTTCTCCGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGCGCAGACCCCGCGTCCGGCTCTGCCAGCCAGCAACGCTTTGCCCACTTCACGGAGCTGGCCATCATCTCAGTCCAGGAGATCGTGGACTTCGCTAAGCAAGTGCCTGGTTTCCTGCAGCTGGGCCGGGAGGACCAGATCGCCCTCCTGAAGGCATCCACTATCGAGATCATGCTGCTAGAGACAGCCAGGCGCTACAACCACGAGACAGAGTGTATCACCTTCTTGAAGGACTTCACCTACAGCAAGGACGACTTCCACCGTGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTTCGAGTTCTCGCGGGCCATGCGGCGGCTGGGCCTGGACGACGCTGAGTACGCCCTGCTCATCGCCATCAACATCTTCTCGGCCGACCGGCCCAACGTGCAGGAGCCGGGCCGCGTGGAGGCGTTGCAGCAGCCCTACGTGGAGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTGCGCTTCCCGCGCATGCTCATGAAGCTGGTGAGCCTGCGCACGCTGAGCTCTGTGCACTCGGAGCAGGTCTTCGCCTTGCGGCTCCAGGACAAGAAGCTGCCGCCTCTGCTGTCGGAGATCTGGGACGTCCACGAGGGCAGCGGCAGCGGCAGCCATAAAATTCTCCATAGATTATTACAGGATTCTTCTTCTTAA。

the invention also provides 20 micromolecular compounds capable of combining LXRbeta, and the structures of the micromolecular compounds are as follows:

wherein we provide a eutectic bonding mode of t-butyl 7-amino-3, 4-dihydroisoquinoline-2 (1H) -carboxylate (F3). We believe that the t-butyloxycarbonyl structure on this fragment can act as a dominant fragment of LXR β, acting to activate LXR β by forming a hydrogen bond with the 435-histidine. Our co-crystal structure also demonstrates such an agonistic pattern. In addition, the tert-butyl moiety on the tert-butoxycarbonyl group is surrounded by hydrophobic amino acids Leu449, Phe268, Leu345, Leu442 and Val439 in the pocket, and the benzene ring moiety of the dihydroisoquinoline forms pi-pi stacking with Phe329, so that the fragment can be stably incorporated in the pocket.

The binding mode of the compound fragment tert-butyl 7-amino-3, 4-dihydroisoquinoline-2 (1H) -carboxylate and LXRbeta is shown in figure 12.

Preferably, the ligand of LXR beta in S4 is one or more of F1-F20 and active molecules containing any one or more fragments of F1-F20.

Compared with the prior art, the invention has the following beneficial effects:

the compound provided by the invention has a fluorescent characteristic and has better specific binding to LXRbeta. The compound is used as a fluorescence polarization probe, and the screening of the LXRbeta ligand and the evaluation of the affinity level of the ligand can be realized by a competition method; based on the screening method established by the invention, 20 small molecular weight compounds capable of combining LXRbeta are obtained by screening, and a foundation is provided for the subsequent drug design of the target LXRbeta.

Drawings

FIG. 1 is the structure of FITC-hyodeoxycholic acid as a fluorescence polarization probe provided in example 1;

FIG. 2 is a synthetic route of FITC-hyodeoxycholic acid as a fluorescence polarization probe provided in example 1;

FIG. 3 is a saturation curve of FITC-hyodeoxycholic acid and LXR β for the fluorescence polarization probe provided in example 1;

FIG. 4 shows the total fluorescence intensity of FITC-hyodeoxycholic acid, a fluorescence polarization probe provided in example 1, as a function of the concentration of LXR β;

FIG. 5 is a plot of fluorescence polarization of FITC alone as a function of LXR β concentration;

FIG. 6 is a saturation curve of FITC-hyodeoxycholic acid and LXRbeta-A275I mutant as a fluorescence polarization probe provided in example 1;

FIG. 7 shows the results of the LXR positive compound fluorescence polarization competition assay; panel A shows the structure of the positive compound used and panel B shows the competition curve;

FIG. 8 is a dimethyl sulfoxide (DMSO) tolerance experiment for fluorescence polarization assay;

FIG. 9 is a measurement of the Z' factor;

FIG. 10 shows the results of fragment screening of 1074 fragments by fluorescence polarization competition;

FIG. 11 is a competition curve of fragment t-butyl 7-amino-3, 4-dihydroisoquinoline-2 (1H) -carboxylate (F3) tested by fluorescence polarization competition method;

FIG. 12 is a drawing illustrating the binding pattern of the fragment t-butyl 7-amino-3, 4-dihydroisoquinoline-2 (1H) -carboxylate (ball-and-stick model) with LXR β (cartoon model) (PDB No. 6JIO) by X-ray crystallography.

Detailed Description

The invention is further illustrated by the following examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. Experimental procedures without specific conditions noted in the following examples, generally according to conditions conventional in the art or as recommended by the manufacturer; the raw materials, reagents and the like used are, unless otherwise specified, those commercially available from the conventional markets and the like. Any insubstantial changes and substitutions made by those skilled in the art based on the present invention are intended to be covered by the claims.

The present invention adopts the following two methods to analyze fluorescence polarization (fluorescence polarization) of the fluorescence polarization probe.

(1) Saturation analysis experiment (Saturation assay): the method comprises the steps of mixing receptors with different concentrations and fluorescence polarization probes with certain concentrations, incubating for a certain time, and measuring the fluorescence polarization value of a system. The saturation experiments of the present invention are carried out as follows: LXR beta was diluted with test buffer, mixed with 10nmol/L fluorescence polarization probe and incubated, and then fluorescence polarization values were measured and analyzed by saturation curve.

(2) Competition analysis experiment (Competition assay): for determining the affinity of a ligand for a receptor. The method is characterized in that LXRbeta and a fluorescence polarization probe with fixed concentration are mixed with compounds to be detected with different concentrations, and then the fluorescence polarization value of a system is measured. The compounds compete for the fluorescence polarizing probe such that the fluorescence polarization value decreases as the concentration of the compound increases. The embodiment of the competition experiment in the present invention is as follows: and diluting the positive compound of the LXR beta with a test buffer, mixing and incubating the positive compound with 10nmol/L fluorescence polarization probe and 400nmol/L LXR beta protein, measuring the fluorescence polarization value of the system, and making a competition curve for analysis.

EXAMPLE 1 Synthesis of FITC-hyodeoxycholic acid

As shown in fig. 1 and 2, hyodeoxycholic acid is used as a raw material, and a product can be obtained through two-step reaction. The method comprises the following specific steps.

(1) Hyodeoxycholic acid (786mg,2mmol) is dissolved in DMF solution and 1040mg (2mmol) PyBop, 432mg (2mmol) tert-butyl (6-aminohexyl) carbamate and 0.33mL (2mmol) DIPEA are added and the reaction mixture is stirred at room temperature overnight, then the mixture is dissolved in 100mL DCM and the organic phase is washed with water (50mL × 6), anhydrous Na₂SO₄Drying, filtering, and concentrating under reduced pressure to obtain crude compound. Purification by silica gel column chromatography gave intermediate 1a as a white solid.¹HNMOL/LR(500MHz,Chloroform-d)4.01(dt,J＝11.95,4.75Hz,1H),3.57(tt,J＝10.76,4.71Hz,1H),3.45(d,J＝10.86Hz,1H),3.18(q,J＝6.76Hz,3H),3.07(q,J＝6.97Hz,2H),2.21(ddd,J＝15.02,10.48,4.99Hz,1H),2.11–1.99(m,1H),1.97–1.90(m,1H),1.91–1.78(m,1H),1.74(dt,J＝13.71,3.31Hz,2H),1.69–1.60(m,1H),1.60(s,0H),1.41(d,J＝5.10Hz,12H),1.07(ttd,J＝24.75,13.88,13.27,7.17Hz,5H),0.88(d,J＝6.41Hz,4H),0.86(s,2H),0.60(d,J＝5.94Hz,3H).¹³C NMOL/LR(125MHz,Chloroform-d)173.00,155.18,78.11,70.48,66.94,55.16,54.95,47.38,41.81,39.18,38.97,38.83,38.17,34.91,34.58,34.51,33.84,33.80,32.60,30.88,29.09,28.94,28.38,28.17,27.43,27.18,25.19,25.05,23.21,22.52,19.74,17.35,11.02.LC-MS(ESI):m/z＝491.3[M+H-Boc]⁺。

(2) 59mg (0.1mmol) of the intermediate was dissolved in 3mL of 2, 4-dioxane, 0.2mL of HCl (4M,2, 4-dioxane diluted) was added, stirred at room temperature for one hour, and concentrated under reduced pressure to give the crude product. The crude product was dissolved in 2mL of anhydrous DMF, and then 40mg (0.11mmol) of fluorescein isothiocyanate and 0.1mL (0.63mmol) of DIPEA were added thereto, followed by stirring at 80 ℃ overnight. The reaction solution was cooled and purified using reverse C-18 column to give the final product as an orange yellow color.¹H NMOL/LR(400MHz,Chloroform-d andMethanol-d4)7.98(s,1H),7.78–7.66(m,1H),7.06(d,J＝8.26Hz,1H),6.84(d,J＝8.94Hz,2H),6.60(d,J＝2.26Hz,2H),6.50(dd,J＝8.93,2.32Hz,2H),3.92(dt,J＝12.20,4.73Hz,1H),3.53(tt,J＝7.07,3.40Hz,2H),3.44(dq,J＝10.69,5.03,4.47Hz,1H),3.24(p,J＝1.63Hz,2H),3.09(t,J＝6.94Hz,2H),2.20–2.08(m,1H),2.05–1.95(m,1H),1.95–1.86(m,1H),1.78(dd,J＝10.18,5.34Hz,1H),1.69(d,J＝13.97Hz,1H),1.61–1.49(m,2H),1.49–1.40(m,1H),1.39–1.26(m,5H),1.21(d,J＝4.14Hz,1H),1.19(s,4H),1.14(d,J＝6.48Hz,2H),0.85(d,J＝6.39Hz,3H),0.82(s,3H).¹³C NMOL/LR(100MHz,chloroform-d andmethanol-d4)180.82,175.33,168.63,155.08,140.53,130.16,130.11,129.62,127.60,127.52,126.82,126.79,121.00,119.39,116.20,112.36,102.70,85.28,77.76,71.07,67.43,56.17,56.00,54.12,49.04,42.73,39.95,39.86,39.03,35.70,35.48,34.80,34.24,33.13,32.01,29.74,29.02,28.65,28.56,27.97,26.29,24.03,23.15,20.63,18.33,17.87,11.61.HRMS(ESI)for C₅₁H₆₅N₃O₈S[M+H]⁺,calcd 880.4565,found880.4549。

Example 2 construction of prokaryotic expression plasmid for human liver X receptor beta ligand binding domain

The DNA coding sequence of the ligand binding domain (amino acid sequence 215-461) of the human liver X receptor β (UniProt number P55055) is inserted into a pET28a (+) vector, a six histidine tag is inserted at the N end of the DNA coding sequence, and a sequence (amino acid sequence) which is combined with the nuclear receptor and is positioned on the SRC2 of a coactivator by connecting a GSGS short sequence at the C end₆₈₇HKILHRLLQDSSS₆₉₉). In addition, in order to reduce the surface entropy of the protein and avoid aggregation of the protein, promote expression of the protein, in the sequence₂₅₉QSRDAR₂₆₄Segment replacement by mutation₂₅₉ASGSAS₂₆₄Thus, a prokaryotic expression plasmid for expressing His6-LXR β -SRC2 protein is constructed, and the inserted DNA sequence is verified by sequencing.

The expressed protein sequence is as follows:

the corresponding DNA sequences were:

example 3 prokaryotic expression of the human liver X receptor beta ligand binding Domain

Transferring the pET28a-LXR β into escherichia coli BL21(DE3) for protein expression, culturing the bacteria by using LB culture medium, and performing shake culture at 220rpm of a shaker at 37 ℃ until the bacteria reach OD₆₀₀And (3) after reaching about 0.6, reducing the culture temperature to 18 ℃, adding 0.25mmol/L inducer isopropyl thiogalactoside (IPTG), continuing to culture, and after 18-20 hours, collecting the thalli by a centrifugal method.

Example 4 purification of human liver X receptor beta ligand binding Domain

The collected cells were resuspended in lysis buffer (50mmol/L Tris-HCl pH8.5, 400mmol/L NaCl, 5% glycerol, 20mmol/L imidazole, 2 mmol/L. beta. -mercaptoethanol), disrupted by sonication in ice bath, and centrifuged to remove impurities such as cell debris. And (3) loading the centrifuged supernatant onto a pre-balanced Ni-NTA affinity chromatography column, washing the hybrid protein by using 20 column volumes of lysis buffer, and eluting the target protein by using the buffer containing imidazole with gradient concentration. The fractions eluted were examined by SDS-PAGE, and fractions containing the target protein were concentrated and replaced with a molecular sieve buffer (20mmol/L of NaCl, pH8.5, 200mmol/L, 5% glycerol, 5 mmol/L. beta. -mercaptoethanol). Further purification of the protein was carried out using HiLoad 16/60Superdex200 preparation grade molecular sieves, the main peak was collected, concentrated and stored at-80 ℃.

Example 5 saturation experiment of fluorescent polarizing probes

Fluorescence polarization measurements were performed using a Victor X5 microplate reader (Perkin-Elmer). The experiment was performed using 384-well, black round bottom, NBS surface, polystyrene material in a microtiter plate (Corning).

In the saturation experiment, 10nmol/L fluorescence polarization probe FITC-hyodeoxycholic acid is mixed with 0-20 mu mol/L concentration gradient LXR β protein, 50mmol/L Tris, pH 8.0, 400mmol/L NaCl and 5mmol/L β -mercaptoethanol are used as buffer solutions for dilution, the mixed solution is incubated for 30 minutes at room temperature, then a microplate reader is used for reading, the adopted excitation wavelength and the emission wavelength are 485nm and 535nm respectively, Graphpad Prism 6.0 software is used for mapping, a curve is fitted by the following formula, and the dissociation constant K between the fluorescence polarization probe and a receptor can be calculated_d。

In the formula, FP_readIs the polarization value of the reading of the microplate reader; FP₀Polarization value for a single fluorescent molecule, without acceptor; FP_maxIs the polarization value after saturation by LXR β [ R]Is the concentration of LXR β protein^*]Is the concentration of the fluorescent polarizing probe; q is the ratio of the total fluorescence intensity of the fluorescent polarizing probe after saturation with the acceptor to the fluorescence intensity of the individual fluorescent molecules.

The saturation curve of FITC-hyodeoxycholic acid and LXR beta as a fluorescence polarization probe is shown in FIG. 3. The dissociation constant was 92.1. + -. 3.8 nmol/L. RXR alpha and RXR beta are used as negative control, and have no obvious nonspecific binding with a fluorescence polarization probe.

The total fluorescence intensity of the fluorescence polarization probe FITC-hyodeoxycholic acid as a function of LXR β concentration is shown in FIG. 4. The total fluorescence intensity does not vary much with the LXR β concentration, and a Q value of 1 is preferred.

The change in fluorescence polarization value of FITC with LXR β concentration is shown in FIG. 5. The polarization values did not change much with LXR β concentration, indicating that FITC did not bind significantly non-specifically to LXR β under the test conditions.

The saturation curves of the fluorescence polarization probe FITC-hyodeoxycholic acid and the LXRbeta-A275I mutant are shown in FIG. 6, with the position of A275 midway between the LXRbeta ligand binding pocket. Mutation of a275 to I can block entry of the fluorescence polarizing probe into the pocket. This is evidenced by a right shift of the binding curve. Specific binding of the fluorescent polarizing probe to LXR β was further demonstrated.

EXAMPLE 6 Competition assay for fluorescent polarizing probes

The experimental materials and apparatus used in this example were the same as those used in example 5.

The experiment uses 10nmol/L fluorescence polarization probe FITC-hyodeoxycholic acid, and 400nmol/L LXR β protein, the corresponding concentration gradient of the compounds to be tested are mixed, the dilution buffer solution is 50mmol/L Tris, pH 8.0, 400mmol/L NaCl, 5mmol/L β -mercaptoethanol, the mixed solution is incubated for 30 minutes in the temperature, then the reading is carried out by a microplate reader, the excitation wavelength and the emission wavelength are 485nm and 535nm respectively, graph is carried out by Graphpad Prism 6.0 software, the following formula is used to fit the curve, the K binding the compounds to be tested and LXR β can be calculated_i。

Wherein,

a＝K_d+K_i+[L^*]+[L]-[R]

b＝K_d([L]-[R])+K_i([L^*]-[R])+K_dK_i

c＝-K_dK_i[R]

[L]is the concentration of the test compound; k_dIs the dissociation constant of the fluorescent polarization probe molecule combined with LXR β obtained in the previous saturation experiment；K_iIs the dissociation constant of the test compound; the other parameters were the same as in example 5.

The test results for common LXR positive compounds are shown in table 1, and the competition curves are shown in fig. 7.

TABLE 1 measured K by fluorescence polarization_iComparison with the reported values (isotope competition method)

Example 7 dimethyl sulfoxide (DMSO) tolerance experiment

Polarization values for 400nmol/L LXR β binding to 10nmol/L fluorescence polarizing probe were determined at different DMSO concentrations. The results are shown in FIG. 8. DMSO up to 5% had little effect on the polarization value test.

EXAMPLE 8 determination of the Z' factor

On a 384 well plate, 50 μ L of a mixture containing 400nmol/L LXR β and 10nmol/L of a fluorescent polarizing probe was added to a final concentration of 10 μmol/L GW3965 as a positive control and no GW3965 as a negative control. The number of wells for positive control and the number of wells for negative control were 192, and the polarization value was measured and calculated as follows.

In the formula of₊And mu_-Average polarization values, SD, for positive and negative controls, respectively₊And SD_-Standard deviation for positive and negative controls, respectively. The test results are shown in fig. 9. The fluorescence polarization value of the positive control obtained by the experiment is 166 +/-6 mP, the fluorescence polarization value of the negative control is 311 +/-8 mP, and the Z' factor obtained by calculation is 0.71.

Example 9 fragment screening based on fluorescence polarization technique

Fragment screening was performed in 384-well plates using the same experimental materials and equipment as in example 5. The library of fragments used for screening should first be rejected for compounds that absorb at the detection wavelength, avoiding false positive results. Screening was performed using a 50. mu.L system containing 10nmol/L of fluorescent polarizing probe molecule, 400nmol/L of LXR β protein and 1mmol/L of each fragment. A fragment that can lower the fluorescence polarization value by 25% or more (4 times the standard deviation of the positive compound) compared to the positive compound (10. mu. mol/L GW3965) in the detection window can be considered as a fragment that can bind to LXR β. FIG. 10 and Table 2 show the results of fragment screening of 1074 fragments. Of these 20 fragments, F1-F20, which bind to LXR β, are as follows:

table 220K of the fragments obtained by screening_iValue of

a.K_iThe values were determined by the fluorescence polarization competition method provided by the present invention.

b.EC₅₀Refers to the results of co-activator recruitment experiments.

c. Refers to the maximum titer that can be achieved in the co-activator recruitment experiment compared to GW 3965.

Wherein the competition curve of the fragment t-butyl 7-amino-3, 4-dihydroisoquinoline-2 (1H) -carboxylate (F3) obtained by screening is shown in FIG. 11.

Example 10 Co-activator recruitment experiments

The co-activator recruitment experiment was performed using fluorescence polarization. mu.mol/LXR beta-LBD, 0.1. mu. mol/L of fluorescently labeled coactivator polypeptide fragment D22(Thermo Fisher) and the test compound were mixed. The excitation wavelength and emission wavelength were 485nm and 535nm, respectively. The fluorescence polarization was read with a microplate reader.

Example 11 crystallization of human liver X receptor beta ligand binding Domain

The fragment at a final concentration of 2mmol/L was mixed with the liver X receptor beta ligand binding domain at a final concentration of 10mg/mL, incubated overnight at 4 ℃ and centrifuged to remove the precipitate. The crystal of the human liver X receptor beta ligand binding domain is grown by a sitting-drop gas phase diffusion method, and the crystallization conditions are 100mmol/L Tris-HCl (pH 8.0) and 22 percent PEG 3350.

Diffraction data acquisition was performed at the Shanghai synchrotron radiation light source (SSRF) BL19U1 workstation. The diffraction data were processed using XDS software. The diffraction phase was analyzed by molecular replacement using the human liver X receptor beta ligand binding domain structure (PDB No.: 5HJP) as a template by the Phaser program. Manually correcting a real space and perfecting a protein structure model according to an electron density map by using a Coot program; and the structural model is automatically corrected in reciprocal space by using a Refmac5 program. And alternately carrying out structural correction on the real space and the reciprocal space until the structural model reaches higher quality. At the end of the structure correction, the fragment tert-butyl 7-amino-3, 4-dihydroisoquinoline-2 (1H) -carboxylate was added to the Coot program and further corrected by refmac 5. The binding mode is shown in fig. 12.

While the foregoing is directed to particular example embodiments of the present invention, numerous modifications and adaptations may be made by those skilled in the art without departing from the principles of the present invention. Rather, the scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> Zhongshan university

<120> compound, preparation method thereof and application of compound as fluorescent polarization probe in LXR beta ligand screening

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>274

<212>PRT

<213> protein sequence (2 Ambystoma latex x Ambystoma jeffersonianum)

<400>1

Met Gly His His His His His His Gly Glu Gly Val Gln Leu Thr Ala

1 5 10 15

Ala Gln Glu Leu Met Ile Gln Gln Leu Val Ala Ala Gln Leu Gln Cys

20 25 30

Asn Lys Arg Ser Phe Ser Asp Gln Pro Lys Val Thr Pro Trp Pro Leu

35 40 45

Gly Ala Asp Pro Ala Ser Gly Ser Ala Ser Gln Gln Arg Phe Ala His

50 55 60

Phe Thr Glu Leu Ala Ile Ile Ser Val Gln Glu Ile Val Asp Phe Ala

65 70 75 80

Lys Gln Val Pro Gly Phe Leu Gln Leu Gly Arg Glu Asp Gln Ile Ala

85 90 95

Leu Leu Lys Ala Ser Thr Ile Glu Ile Met Leu Leu Glu Thr Ala Arg

100 105 110

Arg Tyr Asn His Glu Thr Glu Cys Ile Thr Phe Leu Lys Asp PheThr

115 120 125

Tyr Ser Lys Asp Asp Phe His Arg Ala Gly Leu Gln Val Glu Phe Ile

130 135 140

Asn Pro Ile Phe Glu Phe Ser Arg Ala Met Arg Arg Leu Gly Leu Asp

145 150 155 160

Asp Ala Glu Tyr Ala Leu Leu Ile Ala Ile Asn Ile Phe Ser Ala Asp

165 170 175

Arg Pro Asn Val Gln Glu Pro Gly Arg Val Glu Ala Leu Gln Gln Pro

180 185 190

Tyr Val Glu Ala Leu Leu Ser Tyr Thr Arg Ile Lys Arg Pro Gln Asp

195 200 205

Gln Leu Arg Phe Pro Arg Met Leu Met Lys Leu Val Ser Leu Arg Thr

210 215 220

Leu Ser Ser Val His Ser Glu Gln Val Phe Ala Leu Arg Leu Gln Asp

225 230 235 240

Lys Lys Leu Pro Pro Leu Leu Ser Glu Ile Trp Asp Val His Glu Gly

245 250 255

Ser Gly Ser Gly Ser His Lys Ile Leu His Arg Leu Leu Gln Asp Ser

260 265 270

Ser Ser

<210>3

<211>804

<212>DNA

<213> DNA sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400>3

atgggcgagg gtgtccagct aacagcggct caagaactaa tgatccagca gttggtggcg 60

gcccaactgc agtgcaacaa acgctccttc tccgaccagc ccaaagtcac gccctggccc 120

ctgggcgcag accccgcgtc cggctctgcc agccagcaac gctttgccca cttcacggag 180

ctggccatca tctcagtcca ggagatcgtg gacttcgcta agcaagtgcc tggtttcctg 240

cagctgggcc gggaggacca gatcgccctc ctgaaggcat ccactatcga gatcatgctg 300

ctagagacag ccaggcgcta caaccacgag acagagtgta tcaccttctt gaaggacttc 360

acctacagca aggacgactt ccaccgtgca ggcctgcagg tggagttcat caaccccatc 420

ttcgagttct cgcgggccat gcggcggctg ggcctggacg acgctgagta cgccctgctc 480

atcgccatca acatcttctc ggccgaccgg cccaacgtgc aggagccggg ccgcgtggag 540

gcgttgcagc agccctacgt ggaggcgctg ctgtcctaca cgcgcatcaa gaggccgcag 600

gaccagctgc gcttcccgcg catgctcatg aagctggtga gcctgcgcac gctgagctct 660

gtgcactcgg agcaggtctt cgccttgcgg ctccaggaca agaagctgcc gcctctgctg 720

tcggagatct gggacgtcca cgagggcagc ggcagcggca gccataaaat tctccataga 780

ttattacagg attcttcttc ttaa 804

Claims

1. A compound having the structural formula (i):

2. a process for the preparation of a compound according to claim 1, comprising the steps of:

s2: and (3) deprotecting the intermediate 1a, and carrying out nucleophilic addition reaction with fluorescein isothiocyanate at 50-60 ℃ to obtain the compound.

3. The preparation method according to claim 2, wherein the organic solvent selected for the amide reaction in S1 is one or more of N, N-dimethylformamide, tetrahydrofuran or acetonitrile; the condensing agent selected in the amide reaction in S1 is one or more of PyBoc, HOAT, HOBT, HBTU or BOP; the alkali used in the amide reaction in S1 is one or more of N, N-diisopropylethylamine or triethylamine.

4. The preparation method according to claim 2, wherein the molar ratio of hyodeoxycholic acid to tert-butyl (6-aminohexyl) carbamate in S1 is 1:1 to 1: 2.

5. The preparation method according to claim 2, wherein the acid selected for the deprotection reaction in S2 is one or more of HCl, acetic acid or trifluoroacetic acid; the organic solvent for the deprotection reaction in the S2 is one or more of 1, 4-dioxane, N-dimethylformamide or tetrahydrofuran; the organic solvent used in the nucleophilic addition reaction in S2 is one or more of 1, 4-dioxane, N-dimethylformamide or tetrahydrofuran, and the base used in the nucleophilic addition reaction in S2 is one or more of DIPEA or triethylamine.

6. The method according to claim 2, wherein the molar ratio of the intermediate 1a to fluorescein isothiocyanate in S2 is 1: 1-1: 2.

7. Use of the compound of claim 1 as a fluorescent polarizing probe in LXR β ligand screening.

8. A method for screening LXR beta ligand is characterized by comprising the following steps:

9. The method of claim 8, wherein the protein sequence of said LXR β ligand binding domain in S3 is: MGHHHHHHGEGVQLTAAQELMIQQLVAAQLQCNKRSFSDQPKVTPWPLGADPASGSASQQRFAHFTELAIISVQEIVDFAKQVPGFLQLGREDQIALLKASTIEIMLLETARRYNHETECITFLKDFTYSKDDFHRAGLQVEFINPIFEFSRAMRRLGLDDAEYALLIAINIFSADRPNVQEPGRVEALQQPYVEALLSYTRIKRPQDQLRFPRMLMKLVSLRTLSSVHSEQVFALRLQDKKLPPLLSEIWDVHEGSGSGSHKILHRLLQDSSS are provided.

10. The method of claim 8, wherein the ligand of LXR β in S4 is one or more of F1-F20 and an active molecule containing any one or more fragments of F1-F20: