CN110200992A - Application of the gold nanometer cage in anti-DNA damnification - Google Patents
Application of the gold nanometer cage in anti-DNA damnification Download PDFInfo
- Publication number
- CN110200992A CN110200992A CN201910558418.7A CN201910558418A CN110200992A CN 110200992 A CN110200992 A CN 110200992A CN 201910558418 A CN201910558418 A CN 201910558418A CN 110200992 A CN110200992 A CN 110200992A
- Authority
- CN
- China
- Prior art keywords
- gold nanometer
- nanometer cage
- cell
- application
- dna damage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/242—Gold; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
- A61K41/0042—Photocleavage of drugs in vivo, e.g. cleavage of photolabile linkers in vivo by UV radiation for releasing the pharmacologically-active agent from the administered agent; photothrombosis or photoocclusion
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
- A61K41/0052—Thermotherapy; Hyperthermia; Magnetic induction; Induction heating therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/02—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/19—Cosmetics or similar toiletry preparations characterised by the composition containing inorganic ingredients
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/06—Free radical scavengers or antioxidants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
- A61Q17/04—Topical preparations for affording protection against sunlight or other radiation; Topical sun tanning preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Inorganic Chemistry (AREA)
- Immunology (AREA)
- Dermatology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Toxicology (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Biochemistry (AREA)
- Birds (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The application that the invention discloses gold nanometer cages in anti-DNA damnification.It is verified by experiments, gold nanometer cage can mitigate the DNA Damage of active oxygen, chemotherapeutics (such as hydroxycarbamide) and Physics Irradiation (such as ultraviolet light, X-ray) induction, the proliferation activity for showing as promoting the cell of DNA damage, inhibits Apoptosis caused by DNA damage；Apoptosis of fibroblasts caused by ultraviolet irradiation is significantly inhibited, can be used for preparing anti-aging or radiation protection cosmetics；As pharmaceutical carrier, the characteristic with photo-thermal release will not retain gold nanometer cage for a long time in vivo, have good biological safety；It confirms that gold nanometer cage may additionally facilitate medulla hematopoietic system reconstruction, maintain immune system stable state, extension survival rate by x-ray irradiation mouse model, can be used for preparing the drug of prevention and treatment radioactivity bone marrow injury or treat the drug of alpastic anemia.
Description
Technical field
The invention belongs to bio-medical material technology and biomedicine fields, and in particular to gold nanometer cage material is in anti-DNA
Damage reduces Apoptosis and prevents and treats the application in bone marrow injury.
Background technique
DNA is the most important inhereditary material of body vital movement, the holding of molecular structure integrity and stability for
The survival of cell and the performance of normal physiological activity are of great significance.But the DNA moment face inside the organism or
External invasion, DNA damage generally occur in cell activities, may cause cell mutation, canceration even death.
DNA damage can be generated because of reasons such as DNA metabolism, chemicals (reagent) mutagenesis, ionising radiation and Damage Induced by Reactive Oxygen Species.DNA damage
DNA replication dna, transcription and protein synthesis are directly affected, and then influences the life such as cell growth, development, heredity, metabolism and breeding
Activity is to cause cell mutation, canceration, aging and the major reason of death.If too strong ultraviolet light can promote dry skin, add
Fast skin ageing generates or deepens blackspot and freckle, and excessive being exposed to the sun may cause cutaneum carcinoma, the people with photoallergy by
Ultraviolet light irradiation can cause dermatitis.And the extensive use of core and radiation, so that employee exposed to radiation and the public are by nuclear radiation
The probability of damage greatly increases, and nuclear radiation injury and protection are also more and more paid close attention to by educational circles and the public.By big agent
After measuring ionising radiation, acute radiation sickness can occur for exposed personnel, and such as causing acute radiation bone marrow injury, (also known as BM form is anxious
Property radiation sickness).
It is mainly at present to use the inhibitor that related pathways are reacted with DNA damage for the method for resisting DNA damage, it is such as poly-
Adenosine diphosphate ribose polymerase (PARP) inhibitor, ataxia-telangiectasia mutation/incoordination capillary
Congenital biliary dilatation and Rad3 GAP-associated protein GAP (ATM/ATR) kinase inhibitor, DNA dependent kinases (DNA-PKcs) inhibitor, inspection
Point kinases (Chk1/2) inhibitor, Cyclin Dependent Kinase (CDK) inhibitor and dnmt rna (MGMT) inhibit
Agent etc. or oxygen free radical scavenger (such as W2721), anti-inflammatory drug (such as glucocorticoid), cytokine class (such as G-CSF),
However, these inhibitor general actions act on all cells in protein kinase or using collaboration lethality, and steroids
Drug pair toxic action is larger, lack specific normal tissue and cell also has certain destructive power, and these drugs cannot quickly,
A large amount of free radicals that body is generated by DNA damage are efficiently removed, also there is certain drug resistance.
With the high speed development of field of nanometer material technology, various types of nano materials preventing, treating and targeting tumour
It shows good application prospect in administration, but and has no that a nano material can resist various types of DNA damages and clear
Except the report in terms of cell activity oxygen, promotion cell anti-aging.
Summary of the invention
In order to overcome the above-mentioned deficiencies of the prior art, the present invention provides gold nanometer cage materials to reduce DNA damage, resist carefully
The application of born of the same parents' apoptosis, to prevent and treat DNA damage caused by ultraviolet light and x-irradiation, chemotherapeutics etc., resist cell ageing, together
When additionally provide gold nanometer cage promote medulla hematopoietic system rebuild, maintain immune system stable state, extend in terms of
Using.
In a first aspect, claimed gold nanometer cage is inhibiting the application in DNA Damage.
Further, gold nanometer cage material can mitigate active oxygen, chemotherapeutics (such as hydroxycarbamide) and Physics Irradiation (such as purple
Outside line, X-ray) induction DNA Damage, promote the proliferation activity of the cell of DNA damage, inhibit thin caused by DNA damage
Born of the same parents' apoptosis.
In a specific embodiment of the present invention, the monocyte RAW264.7 handled through hydroxycarbamide (chemotherapeutics) is being added
After gold nanometer cage (10 μ g/mL), the early stage ratio of (Q3) and advanced stage (Q2) apoptotic cell is substantially reduced, apoptosis-related genes
The expression quantity of Bax, Bcl2 and Survivin are all remarkably decreased in 12h, the mark γ H of DNA double key fracture2The expression quantity of AX is aobvious
Writing reduces, and the cell proportion of highly reactive form of oxygen substantially reduces, it was confirmed that gold nanometer cage has Apoptosis caused by DNA damage bright
Aobvious inhibiting effect.
Second aspect, claimed gold nanometer cage are reducing answering in UV-induced apoptosis of fibroblasts
With.
In a specific embodiment of the present invention, Apoptosis L92 addition gold nanometer cage (10 μ g/mL) is laggard
Row ultraviolet irradiation compared with the control group, is added to the cell of gold nanometer cage through Flow cytometry, apoptotic cell
Ratio substantially reduces, and viable apoptotic cell drops to 21.3% from 31.8%, and non-viable apoptotic cell drops to 24% from 34.4%,
Confirm that gold nanometer cage significantly inhibits Apoptosis caused by ultraviolet irradiation.
The third aspect, application of the claimed gold nanometer cage in preparation anti-aging or radiation protection cosmetics.
Skin can be because the extraneous factors such as ultraviolet light cause fibroblast oxidative stress to increase, and active oxygen increases and causes
Dry skin, coarse, flexibility decrease, relaxation, the final wrinkle and skin aging, gold nanometer cage of generating can be used for preparing anti-aging
Skin care item and radiation protection cosmetics can be prepared into a variety of dosage forms, such as aqua, emulsion, creme by changing different auxiliary materials,
The reason of causing skin aging for extraneous factor plays 1) reduction skin oxidative stress reaction, reduces the generation of active oxygen；2)
Promote DNA damage reparation when skin aging, promotes the discharge of intracellular harmful substance；3) Apoptosis is reduced, cell is slowed down
Aging.
Fourth aspect, the purposes for the pharmaceutical carrier that claimed gold nanometer cage is discharged as photo-thermal.
In a specific embodiment of the present invention, rhodamine B is loaded into gold nanometer cage, irradiates and excites through near-infrared laser
Afterwards, gold nanometer cage converts light energy into thermal energy, is transferred to the cell membrane on nanocages surface, at high temperature hydrophobic contraction, by nanometer
Cage surface hole defect is opened, and high temperature accelerates the rhodamine B Brownian movement encapsulated inside gold nanometer cage at the same time, is shown as
The fast-pulse release of rhodamine B, is presented as illumination and drug release while property, therefore gold nanometer cage can be made under illumination
It is transported in vivo for pharmaceutical carrier, carries out specific irradiation in the time of needs and position, reach the selectivity release of drug
Effect；It is loaded into fluorescein as drug in gold nanometer cage material, discovery gold nanometer cage material has good internal metabolism effect
Rate will not retain for a long time in vivo, have good biological safety.
5th aspect, claimed gold nanometer cage is in preparation prevention or therapeutic radiation bone marrow injury drug
Using.
In a specific embodiment of the present invention, mouse is injected intravenously to gold nanometer cage (20 after half lethal dose roentgen radiation x
μ g/mL), (1 day, 3 days and 15 days) can significantly increase the quantity of the long-acting candidate stem cell in marrow in short period,
Total candidate stem cell and embryonal cell significantly increase in marrow after irradiation 15 days, and lymphocyte, myelocyte can be made long
Phase is maintained in stability range；The mouse after the x-irradiation of full lethal dose is arrived in gold nanometer cage (20 μ g/mL) intravenous injection
In vivo, dead since the 8th day, the 13rd day survival rate still has 60%, and final survival rate is 20%, it was demonstrated that gold nanometer cage can be shown
Write the service life for extending irradiation mouse.
6th aspect, application of the claimed gold nanometer cage in preparation treatment alpastic anemia drug.
In a specific embodiment of the present invention, building Induced Aplastic Anemia Mice model is irradiated using half lethal dose
Afterwards, discovery peripheral blood lymphocytes substantially reduces, and myelocyte obviously increases, it was demonstrated that impaired hematopoiesis, and use gold nanometer cage
After intravenous medical treatment, the ratio of the myeloid cell, lymphoid lineage cell that can make irradiation mouse quickly restores normal, and can make to drench
Bar cell, myelocyte are maintained in stability range for a long time.Prove that gold nanometer cage can treat marrow caused by alpastic anemia
Failure and hematopoietic disorders.
Further, gold nanometer cage described in above-mentioned every application is inner hollow, the porous cube nanocages of side wall,
Average diameter of particles is between 50-120nm, uniform particle sizes, particle diameter preferred 70-100nm, absorption peak 700-900nm, preferably
780~810nm can be synthesized by electrochemistry method of substitution, i.e., in purified silver cube, soluble gold salt solution, silver is added dropwise
Replaced by gold, to form the gold nanometer cage with hole on the surface of silver cube.
Beneficial effects of the present invention:
Gold nanometer cage material provided by the invention can substantially reduce chemotherapeutics, hydrogen peroxide, ultraviolet irradiation, x-ray spoke
According to caused DNA Damage, various apoptosis-related genes such as Bcl2 expression is reduced, and DNA damage marks γ H2AX expression to reduce,
Apoptotic cell is reduced, and cell activity increases.Meanwhile using the gold nanometer cage material for carrying medicine and modification, the drug of carrying is cooperateed with (such as
Antibiotic, anticarcinogen, anti-inflammatory agent, growth factor etc.), when drug plays antibacterial, antitumor and other effects to specific cells, protection
Normal cell is from damage.The present invention is entered in Mice Body using gold nanometer cage Material injection, can significantly improve x-irradiation mouse
Survival rate, hence it is evident that mitigate by the damage according to rear marrow hemopoietic stem cells, protection, the quantity and function for promoting stem cell promote
Into being divided into Lymphatic System, myeloid cell.
Gold nanometer cage material used in the present invention has good bioavilability and biocompatibility, while having reduction
DNA damage, promotes the effect of cell autophagy at anti-apoptotic, to protect cells from damage, prevents and treats ultraviolet light and x-ray spoke
According to damage, resist cell ageing, extension service life.
Detailed description of the invention
Form under Fig. 1 gold nanometer cage transmission electron microscope.
The ultraviolet absorption peak of Fig. 2 silver sum of cubes gold nanometer cage.
The influence of gold nanometer cage (NC) and gold nanorods (NR) cell proliferation under Fig. 3 .CCK8 experiment detection not isogeneous induction.
The redemption of Apoptosis caused by the DNA damage that Fig. 4 Flow cytometry gold nanometer cage induces hydroxycarbamide is made
With result.
Fig. 5 .RT-PCR detects gold nanometer cage to the Gene Expression of DNA damage related pathways.
Fig. 6 .Western Blot, which detects gold nanometer cage, influences the protein expression of DNA damage related pathways.
Influence of Fig. 7 flow cytomery gold nanometer cage to cell activity oxygen content.
Apoptosis situation after Fig. 8 flow cytomery ultraviolet irradiation.
The photo-thermal release characteristics of Fig. 9 load medicine gold nanometer cage.
The metabolic condition of Figure 10 gold nanometer cage in vivo.
The ratio of x-irradiation Bone Marrow Hematopoietic Stem Cells of Mice after the injection of Figure 11 Flow cytometry gold nanometer cage.
The ratio of x-irradiation mouse peripheral blood immunocyte after the injection of Figure 12 Flow cytometry gold nanometer cage.
Figure 13 gold nanometer cage saves result to the service life of full lethal dose x-irradiation mouse.
Specific embodiment
It elaborates below with reference to embodiment to specific embodiment provided by the invention.
The preparation method of 1 gold nanometer cage of embodiment
Present invention demonstrates gold nanometer cages to make the application in dying in resistance DNA damage, and the gold nanometer cage is cube
Nanometer basket structure, inner hollow, side wall are porous, and average diameter of particles is between 50-120nm, preferably 70-100nm, and partial size is equal
It is even, form such as Fig. 1 under transmission electron microscope；In near-infrared region, (700~900nm of wavelength) has a specific peak absorbance, preferably 780~
810nm, ultraviolet absorption peak such as Fig. 2.
Gold nanometer cage is synthesized using electrochemistry method of substitution, is included the following steps:
1) 50mL ethylene glycol is heated to 150 degree under magnetic stirring, the Na of 0.6mL 3.0mM is then added2S.2 minutes
Afterwards, the PVP solution (20mg/mL, 12.5mL) and hydrochloric acid solution (3.0mM, 5mL) of ethylene glycol preparation are rapidly joined.The reaction was continued 2
After minute, the silver trifluoroacetate solution (282mM, 4mL) that ethylene glycol is prepared is added.After persistently stirring 35 minutes, the color of solution
Become yellowish-brown, through supercooling, centrifugation, obtains silver nanoparticle cube after acetone and milli-Q water.
2) silver nanoparticle cube for taking step 1) to obtain is scattered in 100mL ultrapure water, and 100mgPVP is added, and stirring adds
Heat is to 100 DEG C.1.0mM HAuCl is added dropwise dropwise with the rate of 0.7mL/min with syringe pump4It is anti-that aqueous solution carries out electrochemical displacement
It answers.It is recorded in the absorption spectrum peak in 400 to 900nm wave-length coverage using double beam spectrophotometer in reaction process, at peak
Value, which rises to, stops reaction at about 800nm.After cooling, centrifugation, after ammonium hydroxide, ethyl alcohol and milli-Q water, the Jenner that is purified
Rice cage particle.
Above-mentioned gold nanometer cage material has the feature that
1) there is good mechanical flexibility and stability, surface is flat, is in atom level；
2) its nanocages wall thickness is adjustable, and range is 2~10nm, precision 0.5nm；
3) by simply control reaction solution gold chloride amount, can by the peak LSPR of nanocages be tuned to 600-1200nm
Any wavelength in range, suitable for the application under different excitation wavelengths；
4) with good stability.
The proliferation activity of 2 gold nanometer cage of embodiment promotion cell
DNA damage can be generated because of reasons such as DNA metabolism, chemicals (reagent) mutagenesis, ionising radiation and Damage Induced by Reactive Oxygen Species.
DNA damage directly affects DNA replication dna, transcription and protein synthesis, and then influences cell growth, development, heredity, metabolism and breeding
Etc. vital movements, whether can generate under different medicine irritations protection cell to study gold nanometer cage material and increase activity
Effect, we are passed through with the hydroxycarbamide of various concentration and the damage of low sugar medium treatment RAW264.7 cell inducing cell
The gold nanometer cage material that embodiment 1 synthesizes is added, and with the gold nanorods material of commercialization (Deco island gold, DKAU-5.4) conduct
Control detects the different active influences of nano material cell proliferation using CCK8 experiment.
Experimental method:
First by monocyte RAW264.7 (mouse source mononuclear macrophage, purchased from China typical culture collection
The heart, CCTCC) it is seeded in 96 porocyte culture plates, to be incubated at 37 DEG C, 5%CO containing 10%FBS24h is cultivated in incubator, so
After be changed to conditioned medium, including 1. low sugar DMEM culture medium (glucose content 1000mg/L)；2. the height of the hydroxycarbamide containing 0.5mM
Sugared DMEM culture medium (glucose content 4500mg/mL)；3. the DMEM in high glucose culture medium (glucose content of the hydroxycarbamide containing 1mM
4500mg/mL).Meanwhile 10 μ g/mL gold nanometer cage materials are added in experimental group, control group adds isometric distilled water, is cultivating respectively
1, after 2,3 days, 10 μ L CCK-8 solution are added into every hole, and avoid generating bubble, 1~4h (37 is then cultivated in incubator
DEG C, 5%CO2) after cultivation, the absorbance in every hole is detected at 450nm, and carry out data processing.
Experimental result: CCK-8 adds RAW264.7 cell in hydroxycarbamide and low sugar culture medium as the result is shown (see Fig. 3)
Absorbance decline, illustrates that cell is suppressed, and gold nanorods group all significantly inhibits the growth of cell in 3 days.And this is added
Inventing the gold nanometer cage provided can maintain and promote under low sugar state and low concentration HU processing from daystart is just significant
The metabolic activity of cell.
3 gold nanometer cage material of embodiment reduces Apoptosis and its mechanism caused by DNA damage
It is acted on to verify gold nanometer cage to the redemption of cellular damage, we further use hydroxycarbamide induced DNA damage
Influence of the state research gold nanometer cage to Apoptosis.
Experiment one: the change of Apoptosis by Flow Cytometry
(1) cell is handled: first by RAW264.7 cell inoculation in 6 porocyte culture plates, to be incubated at containing 10%FBS
37 DEG C, 5%CO24h is cultivated in incubator, is then changed to the culture medium of the hydroxycarbamide containing 0.5mM；Meanwhile 10 μ g/ are added in experimental group
The gold nanometer cage material that mL embodiment 1 synthesizes, control group add isometric distilled water.In order to study gold nanometer cage to the short-term of cell
The effect that damage and long-term induction are repaired is resisted, experimental group is divided into two groups: being detected after 1. cultivating 12 hours；2. cultivating
Conditioned medium is removed after 12h, is changed to fresh complete medium, continues culture for 24 hours.
(2) Flow cytometry: abandoning supernatant, and PBS washing is centrifuged (300g, 5 minutes).It is tied with 400 μ L Annexin V
Liquid suspension cell is closed, concentration is about 1 × 106cells/mL.5 μ L Annexin V-FITC dyeing is added in cell suspension
Liquid is mixed gently and is incubated for 15 minutes under the conditions of being protected from light in 4 DEG C.5 μ L PI dyeing liquors are added, mix gently under the conditions of 4 DEG C are protected from light
It is incubated for 5 minutes.Cell is transferred in streaming pipe, upper machine testing, data analysis, the result is shown in Fig. 4.
Experimental result: hydroxycarbamide processing can dramatically increase the ratio of early stage (Q3) and advanced stage (Q2) apoptotic cell in cell,
And compared with the control group, be added to the cell of gold nanometer cage, the ratio of apoptotic cell substantially reduce (the 1. group from 60% decline
To 40%, 2. group drop to 20%) from 40%, especially viable apoptotic cell substantially reduce (1. group drop to from 12%
8%, 2. group from 15% drop to 9%, the range of decrease is about 40%).And the addition of gold nanorods promotes the generation of apoptotic cell, tool
There is certain toxic effect.Illustrate that gold nanometer cage provided by the invention has apparent suppression to Apoptosis caused by DNA damage
Production is used.
Experiment two: inhibit the mechanism of Apoptosis using fluorescent quantitation Q-PCR detection gold nanometer cage material
(1) cell is handled: by RAW264.7 cell inoculation in 6 porocyte culture plates, to be incubated at 37 containing 10%FBS
DEG C, 5%CO24h is cultivated in incubator, is then changed to the culture medium of the hydroxycarbamide containing 0.5mM；Meanwhile 10 μ g/mL are added in experimental group
The gold nanometer cage material that embodiment 1 synthesizes, control group add isometric distilled water.RNA is extracted after culture 12 hours.
(2) Q-PCR is detected: being extracted total serum IgE using Trizol reagent (Takara, Japan) to specifications, is taken 1.0 μ g
RNA carries out reverse transcription, obtains cDNA.Into 96 orifice plates every hole be added 20 μ L reaction system (2 μ L cDNA, 10 μ L SYBR,
0.8 μ L primers F orward, 0.8 μ L primer Reserve, 6.4 μ L ddH2O), the primer sequence used is as follows: Bax:5 ' -3 ':
AGGATGCGTCCACCAAGAAGCT, 3 ' -5 ': TCCGTGTCCACGTCAGCAATCA；Bcl2:5 ' -3 ':
CCTGTGGATGACTGAGTACCTG, 3 ' -5 ': AGCCAGGAGAAATCAAACAGAGG；Survivin:5 ' -3 ':
CCTACCGAGAACGAGCCTGATT, 3 ' -5 ': CCATCTGCTTCTTGACAGTGAGG.Upper machine testing, and carry out data processing.
Experimental result: as shown in figure 5, compared with the control group, being added to its apoptosis-related genes of the groups of cells of gold nanometer cage
The expression quantity of Bax, Bcl2 and Survivin are all remarkably decreased in 12h.
Experiment three: inhibit the mechanism of Apoptosis using immunoblotting detection gold nanometer cage material
(1) cell is handled: by RAW264.7 cell inoculation in 6 porocyte culture plates, to be incubated at 37 containing 10%FBS
DEG C, 5%CO24h is cultivated in incubator, is changed to the culture medium of the hydroxycarbamide containing 0.5mM；Meanwhile experimental group is added 10 μ g/mL and implements
The gold nanometer cage material that example 1 synthesizes, control group add isometric distilled water.A is tested, generation of the gold nanometer cage to DNA damage is studied
Influence: 1. cultivate 12 hours after extract total protein；2. removing conditioned medium after culture 12h, it is changed to fresh complete culture
Base continues culture and extracts total protein afterwards for 24 hours, detects DNA damage mark γ H2The expression of AX；B is tested, gold nanometer cage pair is studied
The influence of checkpoint kinases 1/2 (CHK1/2) in the early process that DNA damage generates: in culture 30min, extraction is total after 2 hours
Albumen detects the phosphorylation level of checkpoint kinases 1/2 (CHK1/2).
(2) Western Blot is tested, detailed process are as follows: encapsulating-loading-electrophoresis-transferring film-confining liquid shakes closing 1
4 DEG C of hour → primary antibody overnight → recycling primary antibodies, TBST are washed 3 times, 5-10 minutes each → secondary antibody, and 1 hour → abandon secondary antibody, TBST
Washing 3 times, 5-10 minutes each → exposure detects and carries out data processing.Wherein, the primary antibody used is respectively as follows: the anti-GAPDH of mouse
(1:2000), the anti-β-actin of mouse (1:2000), rabbit-anti γ H2AX (1:1000), rabbit-anti p-CHK1/2 (1:1000)；Two used
It is anti-to be respectively as follows: goat-anti rabbit polyclonal antibody (1:7000), sheep anti mouse polyclonal antibody (1:10000).
As shown in fig. 6, the mark γ H of DNA double key fracture2AX has apparent expression quantity after adding hydroxycarbamide, and is added
Expression quantity significantly reduces after gold nanometer cage；And after hydroxycarbamide 30min and 2h is added checkpoint kinases 1/2 (CHK1/2) phosphoric acid
Change, the results showed that be significantly reduced after gold nanometer cage is added, it was demonstrated that gold nanometer cage provided by the invention induces hydroxycarbamide
DNA damage access is inhibited.
It tests four gold nanometer cage materials and reduces reactive oxygen species
(1) cell is handled: first by RAW264.7 cell inoculation in 6 porocyte culture plates, to be incubated at containing 10%FBS
37 DEG C, 5%CO24h is cultivated in incubator, is then changed to the culture medium of the hydroxycarbamide containing 0.5mM；Meanwhile 10 μ g/ are added in experimental group
The gold nanometer cage that mL embodiment 1 synthesizes, control group add isometric distilled water, and culture is detected after 12 hours.
(2) Flow cytometry: DCFH-DA is diluted according to 1:1000 serum-free medium, is made final concentration of 10 micro-
Mol/L.Cell collect after be suspended in DCFH-DA dilute, cell concentration be 1,000,000 to 20,000,000/milliliter, 37 DEG C
It is incubated for 20 minutes in cell incubator.It was mixed by inversion every 3-5 minutes, comes into full contact with probe and cell.Use serum-free
Cell culture fluid washs cell three times, does not enter intracellular DCFH-DA with abundant removal.Cell is transferred in streaming pipe,
Using 488nm excitation wavelength, machine testing in 525nm launch wavelength, data analysis.
Experimental result: as shown in fig. 7, hydroxycarbamide processing can dramatically increase the ratio (DCF of active oxygen in cell
Positive31.5%), and compared with the control group, it is added to the cell of gold nanometer cage, the cell proportion of highly reactive form of oxygen is significant
It reduces (DCF positive 14.6%), illustrates that gold nanometer cage provided by the invention has apparent suppression to the generation of active oxygen
Production is used.
This example demonstrates that gold nanometer cage can significantly increase cell of cell under the conditions of low nutrition and wound inducement agent
Activity reduces the generation of active oxygen, inhibits Apoptosis, promote the activity of cell by reducing DNA damage.
4 gold nanometer cage material of embodiment reduces UV-induced apoptosis of fibroblasts, is used to prepare sun-proof reparation shield
Skin product (1) cell processing: by Apoptosis L929 (being purchased from China typical culture collection center, CCTCC) inoculation
In 6 porocyte culture plates, to be incubated at 37 DEG C, 5%CO containing 10%FBS2After cultivating 4h in incubator, 10 μ are added in experimental group
The gold nanometer cage material that g/mL embodiment 1 synthesizes, control group add isometric distilled water.265nm ultraviolet irradiation 3 minutes.
(2) Flow cytometry: abandoning supernatant, and PBS washing is centrifuged (300g, 5 minutes).It is tied with 400 μ L Annexin V
Liquid suspension cell is closed, concentration is about 1 × 106cells/mL.5 μ L Annexin V-FITC dyeing is added in cell suspension
Liquid is mixed gently and is incubated for 15 minutes under the conditions of being protected from light in 4 DEG C.5 μ L PI dyeing liquors are added, mix gently under the conditions of 4 DEG C are protected from light
It is incubated for 5 minutes.Cell is transferred in streaming pipe, upper machine testing, data analysis.
Experimental result: as shown in figure 8, ultraviolet light irradiation can dramatically increase in cell, (Q3) and advanced stage (Q2) apoptosis is thin in early days
The ratio of born of the same parents, and compared with the control group, it is added to the cell of gold nanometer cage, the ratio of apoptotic cell substantially reduces, and withers in early days
It dies cell and drops to 21.3% from 31.8%, non-viable apoptotic cell drops to 24% from 34.4%.Illustrate gold provided by the invention
Nanocages significantly inhibit Apoptosis caused by ultraviolet irradiation.
Skin can include that illumination, smoking, harmful dust etc. cause fibroblast oxidative stress to increase because of extraneous factor,
Active oxygen increases and leads to dry skin, coarse, flexibility decrease, relaxation, final to generate wrinkle and skin aging.The present embodiment makes
Gold nanometer cage material can be used for preparing anti-aging skin care product and radiation protection cosmetics, can be by changing different auxiliary materials
The reason of being prepared into a variety of dosage forms, such as aqua, emulsion, creme, causing skin aging for extraneous factor plays 1) reduction skin
Skin response to oxidative stress reduces the generation of active oxygen；2) promote DNA damage reparation when skin aging, promote intracellular harmful
The discharge of substance；3) Apoptosis is reduced, cell ageing is slowed down.Its main feature is that: 1) pass through physical isolation and absorption ultraviolet light resistance
Only radiation enters human body；2) mitigate cell by promoting DNA to repair, reducing Apoptosis for entering the radiation injury of human body
The radiation hazradial bundle being subject to；3) activity, the strengthen immunity of body epidermal cell are improved；4) nano-scale particle reduces simple utilization
The mode that radiation resistance covers agent screening of radiation brings the senses of discomfort such as airtight of user.
The preparation and application of 5 gold nanometer cage material drug carrier system of embodiment
(1) preparation method of gold nanometer cage material drug carrier system
1. gold nanometer cage obtained in Example 1 carries out ultrasonic disperse, removes supernatant after centrifugation, obtain gold nanometer cage
Precipitating；
2. drug to be carried is dissolved in methanol solution, it is added in the gold nanometer cage material of purification, ultrasonic disperse；
3. gold nanometer cage-drug-methanol solution mixed system is added dropwise to tetradecyl alchohol liquid under the conditions of 56 DEG C
In, it stirs 30 minutes, after fully dispersed, 90 DEG C are stirred 2 hours, and methanol is made to volatilize；
4. being cleaned using methanol solution, it is centrifuged at a high speed, ultrasonic disperse is cleaned with ultrapure water, washed after repeating 2-4 times
Remove remaining organic solvent.
(2) the medicine controlled releasing characteristic of gold nanometer cage material drug carrier system
Photothermal response characteristic based on gold nanometer cage material, carrying medicine gold nanometer cage can be used for photo-thermal controlled-release.Using above-mentioned
Rhodamine B is loaded into gold nanometer cage by method, after near-infrared laser irradiation excitation, is released using spectrophotometer measurement
Rhodamine content, find laser irradiation after, rhodamine discharges at once, present ON/OFF effect, such as Fig. 9.It proves close red when using
When outer laser irradiation, gold nanometer cage converts light energy into thermal energy, transmits as the cell membrane on gold nanometer cage surface, hydrophobic at high temperature
It shrinks, nanocages surface hole defect is opened, high temperature adds the Brownian movement of the drug encapsulated inside gold nanometer cage at the same time
Fastly, the quick pulse release for showing as drug under illumination is presented as illumination and drug release while property.
(3) the internal metabolic characteristic of gold nanometer cage material
It is loaded into fluorescein as drug in gold nanometer cage material, can be used for developer progress optical imagery and positioning chases after
Track.Example 1: rhodamine B is loaded into gold nanometer cage using the above method, is entered in Mice Body by tail vein injection, by 24
After hour, the distribution of each organ and situation is retained in vivo using toy phosphorimager observation nano material, utilize fluorescence
Quantitative instrument detects distribution situation of the nano material in mouse blood, as a result such as Figure 10.Gold nanometer cage is entered by intravenous injection
After in vivo, organ distribution is mainly distributed in liver and kidney, and reaches peak the 3rd hour and the 6th hour respectively, later by
Gradually decline, plasma metabolism rate is close to 93% in 24 hours.By being loaded into fluorescent molecule, gold nanometer cage material can be effectively monitored
Internal metabolic rate and Tissue distribution effect, discovery gold nanometer cage material have good internal metabolic efficiency, will not grow in vivo
Time retains, and has good biological safety.It, can be by gold nanometer cage meanwhile using the photo-thermal release characteristics of gold nanometer cage
It is transported in vivo as pharmaceutical carrier, carries out specific irradiation in the time of needs and position, the selectivity for reaching drug is released
Put effect.
6 gold nanometer cage material protection acute radiation bone marrow injury of embodiment promotes medulla hematopoietic system to rebuild, maintains to exempt from
Epidemic disease systematic steady state extends survival rate
Experiment one: gold nanometer cage material promotes the medulla hematopoietic system after irradiation to rebuild
(1) experimental method
1. radiation treatment: mouse is packed into special organic glass box, with RS2000pro biology x-ray irradiation instrument into
The disposable roentgen radiation x of row, dosage rate 200cGy/min, irradiation dose 4.5Gy.Experimental group is by 8 20 μ of mouse tail vein injection
The gold nanometer cage that g embodiment 1 synthesizes, 8 mouse of control group inject distilled water.Duplicate injection is primary after 1 day.
2. in marrow hematopoietic cell subgroup analyze: take 100 μ L EDTA anticoagulations, be separately added into 2.5 μ L PerCP-CD3,
0.5 μ L FITC-CD4 and 2.5 μ L PE-CD8 is separately added into 2.5 μ L for detecting total T cell, CD4+ and CD8+T cell
PerCP-CD3,2.5 μ L APC-CD19 and 2.5 μ L PE-NK1.1 antibody, for detecting B cell and NK cell.Room temperature is protected from light training
After supporting 30min, add 2mL hemolysin lysed erythrocyte, after phosphate buffer washes 2 times, 20g/L paraformaldehyde solution is added
0.3mL, percentage of the flow cytometry lymphocyte subgroup in total lymphocyte.
(2) experimental result: as shown in figure 11, by the Mice Body after gold nanometer cage intravenous injection to half lethal dose irradiation
Interior, (1 day, 3 days and 15 days) can significantly increase the long-acting candidate stem cell (LT-HSCs) in marrow in short period
Quantity, after irradiation 15 days, total candidate stem cell (LSK) and embryonal cell (Lin-) significantly increase in marrow, it was demonstrated that this
The gold nanometer cage material that invention provides can significantly save the quantity of the marrow hemopoietic stem cells after x-irradiation.
Experiment two: gold nanometer cage material maintains the stable state of peripheral blood immunocyte after x-irradiation
(1) experimental method:
1. radiation treatment: mouse is packed into special organic glass box, with RS2000pro biology x-ray irradiation instrument into
The disposable roentgen radiation x of row, dosage rate 200cGy/min, irradiation dose 4.5Gy.Experimental group is by 8 20 μ of mouse tail vein injection
The gold nanometer cage that g embodiment 1 synthesizes, 8 mouse of control group inject distilled water.Duplicate injection is primary after 1 day.
2. hematopoietic cell subgroup is analyzed in peripheral blood: taking 100 μ L EDTA anticoagulations, be separately added into 2.5 μ L PerCP-
CD3,0.5 μ L FITC-CD4 and 2.5 μ L PE-CD8 are separately added into 2.5 μ L for detecting total T cell, CD4+ and CD8+T cell
PerCP-CD3,2.5 μ L APC-CD19 and 2.5 μ L PE-NK1.1 antibody, for detecting B cell and NK cell.Room temperature is protected from light training
After supporting 30min, add 2mL hemolysin lysed erythrocyte, after phosphate buffer washes 2 times, 20g/L paraformaldehyde solution is added
0.3mL, percentage of the flow cytometry lymphocyte subgroup in total lymphocyte
(2) it experimental result: as shown in figure 12, compared with non-irradiated mouse (dash-dotted gray line), is drenched by the mouse of x-irradiation
Bar cell substantially reduces, and myelocyte obviously increases, and by the Mice Body after gold nanometer cage intravenous injection to half lethal dose irradiation
It is interior, can make to irradiate the myeloid cell of mouse quickly, the ratio of lymphoid lineage cell restore it is normal (2 Zhou Shiyu normal mouses i.e. without
Notable difference), and lymphocyte, myelocyte can be made to be maintained in stability range for a long time.
Experiment three: gold nanometer cage material extends irradiation mouse survival rate
1. irradiating the building of model: 16 mouse being packed into special organic glass box, are penetrated with RS2000pro biology X
Line irradiation instrument carries out disposable roentgen radiation x, dosage rate 200cGy/min, and irradiation dose is 7.5G y.
2. experiment process: the gold nanometer cage that experimental group synthesizes 8 20 μ g embodiments 1 of mouse tail vein injection, control group
Gold nanorods (Deco island gold, DKAU-5.4) is injected, blank control mouse injects distilled water.Duplicate injection is primary after 1 day.Daily
Record mouse survival situation and body weights.
(2) experimental result: as shown in figure 13,8 mouse of blank control group were opening after 7.5Gy x-irradiation from the 6th day
Begin dead, the 6th day survival rate is 60%, and the 7th day all dead.And the death since the 3rd day of gold nanorods mouse has been injected,
0 is down to the 6th day survival rate.Gold nanometer cage provided by the invention is injected intravenously to after the x-irradiation of full lethal dose
Mice Body in, dead since the 8th day, the 13rd day survival rate still has 60%, and final survival rate is 20%, it was demonstrated that the present invention mentions
The gold nanometer cage of confession can significantly extend the service life of irradiation mouse.
Currently, nuclear industry, nuclear energy and nuclear radiation tech are widely used for national economy, military field and medical field,
The extensive use of core and radiation, so that employee exposed to radiation and the public are greatly increased by the probability of nuclear radiation injury, nuclear radiation
Damage and protection are also more and more paid close attention to by educational circles and the public.After by large dosage of ionising radiation, exposed personnel can
Acute radiation sickness occurs, wherein acute radiation bone marrow injury (also known as bone marrow form acute radiation sickness) is because its incidence is high, hardly possible is pre-
It is anti-and of increasing concern.Gold nanometer cage material is prepared into various forms medicament, can be used for preventing or treating acute radiation
Property bone marrow injury, applied to nuclear war, nuclear accident, employee exposed to radiation, tumor radiotherapy treatment patient etc. with acute radiation
Property bone marrow injury, i.e., be administered in advance or deliver medicine to the crowd that may meet with radioactivity bone marrow injury at once after irradiation, give prescription
Formula is not limited to take orally, inject.
Alpastic anemia is one group of marrow hematopoiesis function failure syndrome caused by Different types of etiopathogenises, is made with marrow
Haemocyte hypoplasia and peripheral blood whole blood trace elements are characterized, and clinically often show as anaemia, bleeding and infection；This disease disease
It is sufficiently complex to manage physiological mechanism, treatment difficulty is big, and curative effect is low.And the drug for treating alpastic anemia at present exists or treatment
The problems such as cost is excessively high or big to human body side effect or treatment cycle treatment is too long.Gold nanometer cage material can make serious failure
Marrow hemopoietic stem cells increase, and significantly improve the recovery and reconstruction of peripheral blood immunocyte, extend marrow failure mouse
In the service life, it can be used for preventing and treating acute or chronic alpastic anemia, administration mode is not limited to take orally, inject.
Claims (8)
1. gold nanometer cage is inhibiting the application in DNA Damage, which is characterized in that the application includes promoting DNA damage
Cell proliferation activity, inhibit DNA damage caused by Apoptosis.
2. application according to claim 1, which is characterized in that the cell includes because of active oxygen, chemotherapeutics, ultraviolet
The cell of DNA damage caused by line, X-ray.
3. gold nanometer cage is reducing the application in UV-induced apoptosis of fibroblasts.
4. application of the gold nanometer cage in preparation anti-aging or radiation protection cosmetics.
5. application of the gold nanometer cage in the pharmaceutical carrier for preparing photo-thermal release.
6. application of the gold nanometer cage in preparation prevention or therapeutic radiation bone marrow injury drug.
7. application of the gold nanometer cage in preparation treatment alpastic anemia drug.
8. application according to any one of claim 1 to 7, which is characterized in that the gold nanometer cage be inner hollow,
The porous cube nanocages of side wall, particle diameter 50-120nm, absorption peak 700-900nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910558418.7A CN110200992A (en) | 2019-06-25 | 2019-06-25 | Application of the gold nanometer cage in anti-DNA damnification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910558418.7A CN110200992A (en) | 2019-06-25 | 2019-06-25 | Application of the gold nanometer cage in anti-DNA damnification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110200992A true CN110200992A (en) | 2019-09-06 |
Family
ID=67794756
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910558418.7A Pending CN110200992A (en) | 2019-06-25 | 2019-06-25 | Application of the gold nanometer cage in anti-DNA damnification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110200992A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110974806A (en) * | 2019-12-27 | 2020-04-10 | 中山大学 | Amphiphilic nano cage with active oxygen sensitivity and preparation method and application thereof |
| CN111632142A (en) * | 2020-06-24 | 2020-09-08 | 南方科技大学 | X-ray response-based drug release system and preparation method and application thereof |
| CN112451532A (en) * | 2020-10-30 | 2021-03-09 | 天津科技大学 | Novel method for inhibiting toxic and side effects of DNA toxicity chemotherapy drug and application |
| CN116458497A (en) * | 2023-06-20 | 2023-07-21 | 细胞生态海河实验室 | Ovarian cell freezing solution and thawing solution and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108261548A (en) * | 2018-01-10 | 2018-07-10 | 浙江大学 | A kind of nano-complex and its preparation method and application |
-
2019
- 2019-06-25 CN CN201910558418.7A patent/CN110200992A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108261548A (en) * | 2018-01-10 | 2018-07-10 | 浙江大学 | A kind of nano-complex and its preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| YULAN WANG等: "Antibacterial properties and mechanisms of gold–silver nanocages", 《NANOSCALE》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110974806A (en) * | 2019-12-27 | 2020-04-10 | 中山大学 | Amphiphilic nano cage with active oxygen sensitivity and preparation method and application thereof |
| CN110974806B (en) * | 2019-12-27 | 2021-05-04 | 中山大学 | Amphiphilic nano cage with active oxygen sensitivity and preparation method and application thereof |
| CN111632142A (en) * | 2020-06-24 | 2020-09-08 | 南方科技大学 | X-ray response-based drug release system and preparation method and application thereof |
| CN111632142B (en) * | 2020-06-24 | 2022-08-23 | 南方科技大学 | X-ray response-based drug release system and preparation method and application thereof |
| CN112451532A (en) * | 2020-10-30 | 2021-03-09 | 天津科技大学 | Novel method for inhibiting toxic and side effects of DNA toxicity chemotherapy drug and application |
| CN116458497A (en) * | 2023-06-20 | 2023-07-21 | 细胞生态海河实验室 | Ovarian cell freezing solution and thawing solution and preparation method thereof |
| CN116458497B (en) * | 2023-06-20 | 2023-09-01 | 细胞生态海河实验室 | Ovarian cell freezing solution and thawing solution and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110200992A (en) | Application of the gold nanometer cage in anti-DNA damnification | |
| Sun et al. | In vitro and in vivo toxicity of black phosphorus nanosheets | |
| CN108671231B (en) | Multifunctional nano-carrier for tumor photothermal synergistic treatment and ultrasonic imaging and preparation method thereof | |
| Abdelhalim et al. | The effects of gamma-radiation on red blood cell corpuscles and dimensional properties in rats | |
| JP6099214B2 (en) | Pharmaceutical composition for protecting mammalian cells from ionizing radiation-induced damage | |
| Wang et al. | Ultrasound-induced cell death of nasopharyngeal carcinoma cells in the presence of curcumin | |
| Hsu et al. | Difference in the effects of radioprotection between aerial and root parts of Lycium chinense | |
| Stepanov et al. | The peculiarities of low-dose ionizing radiation influence on muscles metabolism in experimental animals | |
| JP6775589B2 (en) | Use of fullerenes / metallofullerenes in the manufacture of drugs to treat myelosuppression | |
| CN100372524C (en) | Amphotericin B nano preparation | |
| CN106606783B (en) | A kind of targeting is passed altogether to be released the drug of photosensitizer and chemotherapeutics and passs release system | |
| Cheng et al. | High-dimensional single-cell cartography tracking of immune cells subpopulation of mice peripheral blood treated with gold nanorods and black phosphorus nanosheets | |
| CN110354133A (en) | The application of tetrahydrobiopterin and drug | |
| CN106994118A (en) | A kind of preparation method and its usage for integrating photo-thermal and the nano liposomes of chemotherapy | |
| Hiraoka et al. | Changes in pH and blood flow induced by glucose, and their effects on hyperthermia with or without BCNU in RIF-1 tumours | |
| CN102363044B (en) | Application of three anthraquinone substances of targeted mitochondria as nasopharyngeal darcinoma radiosensitizers | |
| CN109846903A (en) | A kind of set medicine of combination lung lavage treatment pulmonary fibrosis | |
| CN112402605B (en) | Bionic nanoemulsion and preparation method and application thereof | |
| CN106822169B (en) | Application of cordycepin in preparation of medicine for preventing and/or treating radiation injury | |
| Jari et al. | Therapeutic effects of silver nanoparticles loaded with albendazole, mebendazole drugs in male albino mice infected with hydatid cysts | |
| Hameeda et al. | Comparison of effects of curcumin and nano-curcumin on the survival of human-derived mesenchymal stem cells: an experimental study | |
| CN110354257B (en) | Application and medicine of guanosine triphosphate cyclohydrolase 1 | |
| CN111358947B (en) | Application of 5-aminolevulinic acid hexyl ester ethosome in photodynamic anti-candida albicans biomembrane drug | |
| CN107582564A (en) | A kind of medicine of targeted therapy thyroid cancer and preparation method thereof | |
| Tishevskaya et al. | Effects of fullerenol C 60 (OH) 24 on physiological and compensatory erythropoiesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190906 |