CN110195125B - Linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof - Google Patents
Linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof Download PDFInfo
- Publication number
- CN110195125B CN110195125B CN201910605499.1A CN201910605499A CN110195125B CN 110195125 B CN110195125 B CN 110195125B CN 201910605499 A CN201910605499 A CN 201910605499A CN 110195125 B CN110195125 B CN 110195125B
- Authority
- CN
- China
- Prior art keywords
- cucumber
- female
- molecular marker
- indel
- parthenocarpic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Environmental Sciences (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a linkage molecular marker of cucumber parthenocarpy major QTL Parth2.1 and application thereof. The linkage molecular marker Indel-16Y-46 of the cucumber parthenocarpic major QTL Parth2.1 comprises an upstream primer SEQ ID NO.1 and a downstream primer SEQ ID NO. 2. The molecular marker disclosed by the invention is applied to the molecular marker-assisted breeding of a new variety of the full-female strong parthenocarpic cucumber. The efficiency of the molecular marker of the invention for selecting Parth2.1 sites is 100%. The molecular marker-assisted breeding method of the full-female strong parthenocarpic cucumber new variety is developed based on the molecular marker, the obtained full-female strong parthenocarpic cucumber new variety is a European greenhouse type cucumber inbred line variety, has higher yield and excellent fruit quality, and can be directly used as a backbone parent for improving parthenocarpy and full-female of other varieties.
Description
Technical Field
The invention discloses a linkage molecular marker of cucumber parthenocarpy major QTL Parth2.1 and application thereof, belongs to the technical field of vegetable molecular genetic breeding, and can be used for cucumber parthenocarpy molecular marker-assisted breeding.
Background
The cucumber is one of the main vegetables cultivated in large area in China, and has extremely high social value and economic benefit. Parthenocarpy refers to the phenomenon in which an ovary develops into a fruit without pollination, fertilization, or other stimulation. The cucumber variety with strong parthenocarpy capacity has obvious yield increase potential, the yield can be generally increased by more than 20%, and the parthenocarpic fruits have improved quality and good commodity due to the seedless fruits, less pulp and thick pulp. Therefore, the parthenocarpy is an important economic trait closely related to the yield and quality of the cucumber, is one of the target traits for cucumber variety breeding, and has great utilization value in cucumber breeding.
At present, the breeding of cucumber parthenocarpic materials or varieties mainly depends on field flower bunching isolation for phenotype identification, the method is long in time consumption, needs a large amount of manpower and material resources, is easy to influence parthenocarpy by external conditions, is low in phenotype selection efficiency and large in breeding difficulty, and the bred cucumber varieties have the defects of unstable parthenocarpy, easy to influence by cultivation environments and the like. In recent years, with the development of molecular marker technology, many researchers use molecular markers linked with target trait QTL to perform auxiliary selection on germplasm, the method is not affected by gene expression and environmental factors, can perform selection in early generations, is simple to operate, and greatly improves the speed and accuracy of selection. The InDel (Insertion/Deletion) molecular marker is a marker developed based on whole genome re-sequencing, and can be efficiently and accurately used for genetic map construction and assisted breeding by using the molecular marker linked with target characters due to the advantages of wide distribution, high density, high stability and polymorphism rate in a genome, easy detection, co-dominant inheritance, good repeatability, low requirement on DNA quality and the like.
Based on the purposes, the cucumber parthenocarpy genetic mechanism and the parthenocarpy QTL positioning research are adopted. F is constructed by taking a strong parthenocarpic inbred line 'EC 1' as a female parent and a non-parthenocarpic inbred line '8419 s-1' as a male parent2:3Population and F4:5The remaining hybrid population (RHL, Residual heterozygous line), using F2:3The population locates the parth2.1 locus of the cucumber parthenocarpic major QTL (Zhe Wu, Ting Zhang, Lei Li, Jian Xu, Xiaodong Qin, Tinglin Zhang, Li Cui, Qunfeng Long, Ji Li and Jinfeing Chen. Identification of a stable major-effect QTL (Parth2.1) controlling parthenocarpy in cucumberer andassociated candidate gene analysis via whole genome re-sequencing[J]BMCplant biology,2016,16,182), but this article only makes a preliminary location of parth2.1, and molecular breeding using this gene requires further fine location, developing a more refined linked molecular marker of cucumber parth2.1, which is closer to the selection cucumber parthenocarpic major QTL lparthh 2.1 and has higher selectivity.
Disclosure of Invention
The invention aims to provide an efficient molecular marker-assisted breeding method for a new variety of full-female strong parthenocarpic cucumbers.
The purpose of the invention is realized by the following scheme:
the linkage molecular marker Indel-16Y-46 of the cucumber parthenocarpic major QTL Parth2.1 comprises the following primer sequences: the upstream primer SEQ ID NO.1, the downstream primer SEQ ID NO.2 and Indel-16Y-46 are peak markers within the Parth2.1 fine localization interval (physical distance 181 kb).
A molecular marking method of cucumber parthenocarpy major QTL Parth2.1, which takes DNA of a material to be selected as a template and carries out PCR amplification by using a primer pair of the molecular marker Indel-16Y-46 of claim 1; performing polyacrylamide gel electrophoresis separation analysis on the amplification product; the plant capable of amplifying the 105bp specific strip is a plant containing cucumber parth 2.1.
The molecular marking method preferably comprises:
(1) carrying out PCR amplification by using DNA of a material to be identified as a template and using the primer pair of the molecular marker Indel-16Y-46 as claimed in claim 1; the total volume of the PCR amplification reaction was 20. mu.l, including: 10 × buffer (containing Mg)2+) 2.0. mu.L, dNTP 2.0. mu.L, 1. mu.L of each of the forward and reverse primers, Taq enzyme (5U. mu.L)-1)0.25μL、DNA(10ng)1.0μL，ddH2O, 12.75 mu L, and the reaction program is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30S, annealing at 60 ℃ for 30S, extension at 72 ℃ for 1min for 20S, and 35 cycles; extension at 72 ℃ for 5min, storage at 10 ℃, detection of PCR products: the reaction product was electrophoresed on 7% native polyacrylamide gel and stained with silver nitrate;
(2) identifying Parth2.1 by using a labeled primer: the plant which can amplify the 105bp specific strip is a plant containing Parth 2.1.
The molecular marker disclosed by the invention is applied to the molecular marker-assisted breeding of a new variety of the full-female strong parthenocarpic cucumber.
A molecular marker assisted breeding method for a new variety of full-female strong parthenocarpic cucumbers comprises the following steps:
(1) taking a high-generation inbred line EC1 with strong parthenocarpy and full-female as a female parent, taking a high-generation inbred line 8419 without parthenocarpy capacity and weak female as a male parent, hybridizing to obtain F1, selfing a hybrid F1 to obtain F2, continuously constructing an F2:4 population in a single seed transmission mode, performing flower set treatment on female flowers on the day of flowering, observing whether an ovary expands after 7 days of treatment, if the ovary expands, determining that the ovary expands as parthenocarpic fruits, counting the number of parthenocarpic fruits, wherein the number of parthenocarpic fruits/the total number of single plant flower sets is parthenocarpic rate, and determining that the parthenocarpic rate exceeds 90% as strong parthenocarpy capacity; screening recombinant individuals with strong single-property and strong fructification from F2:4 population by the method;
(2) backcrossing and molecular marker assisted selection
The method comprises the following steps of respectively utilizing an InDel marker InDel-16Y-46 closely linked with a parthenocarpic major QTL Parth2.1 and a molecular marker SA166 linked with a full female shape to carry out genotype screening from the screened single plants with high parthenocarpic rate, and selecting the single plants with both InDel-16Y-46 and SA166 heterozygous, wherein the specific method comprises the following steps:
1) extracting DNA of a single plant material leaf as a template, and carrying out PCR amplification by using InDel-16Y-46 and SA166 molecular marker primers;
2) and (3) detecting a PCR product: the reaction product was electrophoresed on 7% native polyacrylamide gel and stained with silver nitrate;
3) the result judges that the InDel mark InDel-16Y-46 can amplify a single strip with the size of 135bp in cucumber materials without parthenocarpy, a single strip with the size of 105bp in strong parthenocarpy cucumber materials, two strips with the sizes of 105bp and 135bp can be amplified in a hybrid F1 of the strong parthenocarpy cucumber materials and the cucumber materials without parthenocarpy or a hybrid single plant with strong parthenocarpy in a group, and an SA166 mark can amplify a strip with the size of 166bp in all-female cucumber materials or other all-female single plants, and no strip is amplified in non-all-female materials; the InDel-16Y-46 and SA166 are heterozygous single strains, and 105bp, 135bp and 166bp bands can be amplified simultaneously;
the molecular marker InDel-16Y-46 closely linked with the parthenocarpic major QTL Parth2.1 comprises an upstream primer of SEQ ID NO.1 and a downstream primer of SEQ ID NO. 2; a molecular marker SA166, wherein the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO. 4;
(3) selecting the recombinant individual with the parthenocarpy rate of more than 90% in the individual plants which are screened in the step (2) and are heterozygous for both InDel-16Y-46 and SA166, carrying out backcross with 8419, and continuously selecting the individual plant which is heterozygous for both InDel-16Y-46 and SA166 in the backcross generation 1, and carrying out backcross with 8419; after backcrossing for 2 generations, continuously selecting the single plants in which both InDel-16Y-46 and SA166 are heterozygous for selfing, and finally obtaining the single plants in which the gene types of InDel-16Y-46 and SA166 are consistent with the EC1 band type, and other chromosome segments are 8419 band types, namely the novel cucumber variety with full-female strong parthenocarpy.
The new variety of the full-female strong parthenocarpic cucumber basically has the property of European greenhouse cucumber 8419, the parthenocarpic rate is more than 90 percent, and the new variety is a full-female inbred line.
The new cucumber variety with full-female strong parthenocarpy has strong plant growth, internode length of 10-12 cm, stem thickness of 0.7-0.8 cm, green leaves, average maximum leaf area of 23 multiplied by 22 cm, first female flower nodes positioned at 2-3 nodes, each node being a female flower without male flowers, commercial melons being linear and green, having white melons with thorns and more quantity, average cucumber length of 12-15 cm and thickness of 3-4 cm, and capable of bearing melons on main lateral vines.
Has the advantages that:
(1) according to the invention, through further construction of a backcross population, the fine positioning of Parth2.1 is completed by using a BC3S1 population, and meanwhile, the analysis of a double-parent sequencing result is combined, an InDel marker InDel-16Y-46 tightly linked with a major QTL site is developed and screened, a marker primer sequence is designed according to the result of double-parent genome sequencing, the Parth2.1 site selection efficiency of 30 strong parthenocarpy individuals and 15 non-parthenocarpy individuals in the F2:4 population is 100% by using the molecular marker InDel-16Y-46 tightly linked with the major QTL Parth2.1, and the molecular marker can be used as a linkage marker for identifying the strong parthenocarpy based on EC1, so that the breeding efficiency is improved.
(2) The invention develops a molecular marker assisted breeding method of a new variety of full-female strong parthenocarpy cucumber based on the linkage molecular marker Indel-16Y-46 of the cucumber parthenocarpic major QTL Parth2.1, and the new variety of full-female strong parthenocarpy cucumber obtained by the method is a European greenhouse type cucumber inbred line variety, has higher yield and excellent fruit quality, and can be directly used as a backbone parent for improving the parthenocarpy and the full-female of other varieties.
Drawings
FIG. 1: fine positioning of parthenocarpic major QTL Parth2.1
FIG. 2: the results of PCR amplification electrophoretograms using the DNA of the parental, hybrid F1, strong parthenocarpic homozygous/heterozygous single plant and non-parthenocarpic single plant as templates and using the InDel-16Y-46 labeled primers of the present invention show that 105bp single bands are amplified in EC1 (lane 3) and strong parthenocarpic inbred lines (lanes 6-14), and 105bp and 135bp bands are amplified in strong parthenocarpic heterozygous single plants (15-35); whereas 135 bands were amplified in both the non-parthenocarpic parent (lane 4) and the inbred lines (lanes 36-50).
Note: lanes 1 to 50 are shown from left to right; lanes 1, 2: marker; lane 3: EC 1; lane 4: 8419 s-1; lane 5: f1; lanes 6-14: strong parthenocarpic inbred lines; lanes 15-35: strong parthenocarpic heterozygous single plants; 36-50: non-parthenocarpic inbred lines
FIG. 3: the field performance of the new variety Parth139 of full-female strong parthenocarpy
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The specific implementation process of the present invention is illustrated to enable those skilled in the art to implement the invention without creative efforts, and the limitation of the embodiment should not be taken as a limitation to the protection scope of the inventor.
Example 1: parth2.1 linked molecular marker development and its molecular detection in the F2:4 population
1. Fine positioning and peak marker development of parthenocarpic major QTL Parth2.1
An F2 segregation population is constructed by taking a strong parthenocarpic inbred line 'EC 1' as a female parent and a non-parthenocarpic inbred line '8419 s-1' as a male parent, the primary positioning of a parthenocarpic major QTL part 2.1 is completed (Zhe Wu, Ting Zhang, Lei Li, Jian Xu, Xiaoong, Tinglin Zhang, Li Cui, Qunfeng Lou, Ji Li and Jinfeng Cheng Chen. Identification of a stable major-effect QTL (Parth2.1) controlling and verifying candidate in cut and assisted gene analysis via a genetic-research [ J ] survival-survival [ 2016,16,182) on the basis, the selection of a single-fruiting plant with a single-fruiting mark of a single-fruiting strain BC # 19 is carried in F83.83 and a single fruiting parent strain BC # 8490 is carried out by selecting a single-fruiting plant with a single fruiting mark of BC # 19, a single fruiting mark of BC # 8490 in a single fruiting inbred gene clone. Constructing a BC3S1 group, carrying out flower set processing on female flowers of each individual plant on the day of flowering in the group, observing whether an ovary expands or not after 7 days of processing, determining that the ovary expands to be parthenocarpic fruits if the ovary expands, counting the number of the parthenocarpic fruits of each individual plant in the BC3S1 group, and calculating the parthenocarpic rate (the number of the parthenocarpic fruits/the total number of the flowers set of the individual plant); 165 pairs of Indel molecular markers are developed in a part 2.1 initial localization interval through genome re-sequencing, and by using the markers and the statistical result of population parthenocarpy rate, the fine localization of part 2.1 is completed on a BC3S1 population, and the localization interval is reduced to be 181kb in physical distance, wherein InDel-16Y-46 is a peak marker of the fine localization interval (figure 1).
2. Molecular detection of InDel-16Y-46 in the F2:4 population
Parthenocarpic parent EC1, non-parthenocarpic parent 8419s-1, hybrid F1 of EC1 and 8418s-1, and a hybrid between F2:4, taking strong parthenocarpy and non-parthenocarpy single plants in the population as molecular detection objects, and carrying out PCR detection by using an InDel-16Y-46 labeled primer.
The PCR amplification reaction system comprises: 2.0. mu.L of 10 XBuffer (containing Mg2+), 2.0. mu.L of dNTP, 1. mu.L of each of the forward and reverse primers, 0.25. mu. L, DNA (10ng) 1.0. mu.L of Taq enzyme (5U. mu.L-1), and ddH2O, 12.75. mu.L of total reaction volume 20. mu.L. The reaction program is 94 ℃ pre-denaturation for 5min, each cycle is 95 ℃ pre-denaturation for 30S, 60 ℃ annealing for 30S, 72 ℃ extension for 1min for 20S, 35 cycles; extending for 5min at 72 ℃, and storing at 10 ℃. And (3) detecting a PCR product: the reaction products were electrophoresed on a 7% native polyacrylamide gel and stained with silver nitrate.
The results show that: the result shows that 105bp single bands are amplified in EC1 and the strong parthenocarpic inbred line, and 105bp and 135bp bands are amplified in the strong parthenocarpic heterozygous single plant; whereas 135 bands were amplified in both the non-parthenocarpic parent and the inbred line (FIG. 2). The selection efficiency of InDel-16Y-46 on Parth2.1 is 100%.
Example 2: the cultivation and application of a full-female strong parthenocarpic cucumber variety Parth139 comprise the following steps:
1. parent traits
(1) Full-female strong parthenocarpic character donor parent EC1
EC1(Zhe Wu, Ting Zhang, Lei Li, Jian Xu, Xiaodong Qin, Tinglin Zhang, Liui, Qunfeng Long, Ji Li and Jinfeng Chen.identification of a stable major-effect QTt L (Parth2.1) controlling partial cary in cumber and associated minor gene analysis via a wall gene-search [ J ] BMC plant biology,2016,16,182) is a full-female strong parthenocarpic European greenhouse type cucumber inbred material, which has strong plant growth, strong lateral branches, developed branch fruits, short bar shapes and parthenocarpic rates of more than 90%.
(2) Weak female, non-parthenocarpic parent 8419
8419 (Wuji, plum bud, Zhang Ding, Li Qu, & Rou group Peak, etc. (2015) qtl location of cucumber parthenocarpy character in Chinese agricultural science, 48(1), 112) 119.) is a European greenhouse type cucumber inbred line material with weak female and no parthenocarpy ability, and has strong plant growth, developed lateral branches, fruiting main vines, short bar-shaped commercial fruits and dark green fruit color.
2. Strong parthenocarpy and transformation and selection process of whole female:
(1) transformation of traits
And simultaneously performing seed soaking, germination accelerating, sowing, field planting and normal plant management on the EC1 and the EC 8419.
When EC1 grows to 3 leaves and 1 heart, 300mg/L silver nitrate solution is used for male induction for 1 time, and male induction is carried out for 1 time every other week.
In the flowering period, 8419 is used as a female parent, EC1 is used as a male parent, and F1 is obtained by hybridization, which comprises the following specific operations: in the afternoon before pollination, 8419 female flower buds and EC1 male flower buds with full yellow petals but not opened flower buds are selected for flower clamping to prevent pollen mixing; when the temperature of the greenhouse is increased to 25 ℃ in the morning on the day of flowering and the plant leaf margin gradually produces water, the pollen of the male flower of EC1 is pollinated to the head of the female flower of 8419, 3 male flowers are pollinated with one female flower, and the pollinated female flowers are separated for three days.
The hybrid F1 is selfed to obtain F2, and a set of F2:4 population containing 115 lines is constructed by single seed transmission. By carrying out flower set treatment on female flowers on the day of flowering, observing whether an ovary expands or not after 7 days of treatment, if the ovary expands, determining the ovary to be parthenocarpic fruits, counting the number of the parthenocarpic fruits, wherein the number of the parthenocarpic fruits/the total number of the single flower set is parthenocarpic rate, and the parthenocarpic rate exceeding 90% is determined to have strong parthenocarpic capacity. Individuals with all-females and high parthenocarpy rate were selected from the F2:4 population by this method.
(2) Backcrossing and molecular marker assisted selection
Respectively utilizing an InDel marker InDel-16Y-46 closely linked with a parth2.1 parthenocarpy major QTL and an all-female linkage marker SA166 to carry out genotype screening on the single plants with the characters identified as all-female high parthenocarpy rate, selecting the single plants with both InDel-16Y-46 and SA166 as heterozygous single plants, and specifically carrying out the following experimental steps:
1) extracting DNA of a single plant material leaf as a template, and carrying out PCR amplification by using InDel-16Y-46 and SA166 molecular marker primers;
2) the PCR amplification reaction system comprises: 10 × buffer (containing Mg)2+) 2.0. mu.L, dNTP 2.0. mu.L, forward and reverse primers each 1. mu.L, Taq enzyme (5U. mu.L)-1)0.25μL、DNA(10ng)1.0μL，ddH2O, 12.75. mu.L, total volume of reaction was 20. mu.L. The reaction program is 94 ℃ pre-denaturation for 5min, each cycle is 95 ℃ pre-denaturation for 30S, 60 ℃ annealing for 30S, 72 ℃ extension for 1min for 20S, 35 cycles; extending for 5min at 72 ℃, and storing at 10 ℃.
3) And (3) detecting a PCR product: the reaction products were electrophoresed on a 7% native polyacrylamide gel and stained with silver nitrate.
The InDel marker InDel-16Y-46 amplified the same single band of 135bp in cucumber material without parthenocarpy, such as 8419 or parthenocarpy individuals in the population, while a single band of 105bp in strong parthenocarpy EC1, and both bands of 105bp and 135bp in EC1 and 8419 hybrid F1 or heterozygous individuals with strong parthenocarpy in the population. The SA166 marker amplified a166 bp band in the all-female cucumber material EC1 or other all-female individuals, but no band in the non-all-female material. The InDel-16Y-46 and SA166 are heterozygous single strains, and 105bp, 135bp and 166bp bands can be amplified simultaneously;
the molecular marker InDel-16Y-46 closely linked with the parthenocarpic major QTL Parth2.1 is characterized in that the upstream primer sequence is AGTGCACTTCGTTTTGAACATCAT (SEQ ID NO.1), and the downstream primer sequence is AGGCAGGACAACCATGAATAAAAA (SEQ ID NO. 2); the SA166 marker linked with the whole female of cucumber has an upstream primer sequence of CAAAATGTCCTATGACTGGTAA (SEQ ID NO.3) and a downstream primer sequence of CATATTGATCACAATGTTCTTAAA (SEQ ID NO. 4).
Selecting a recombinant individual plant with high parthenocarpy rate and meeting the genotype, carrying out backcross with 8419, continuously selecting an individual plant with both InDel-16Y-46 and SA166 which are heterozygous in the backcross generation 1, and carrying out backcross with 8419; after backcrossing for 2 generations, continuously selecting the single plants in which both InDel-16Y-46 and SA166 are heterozygous for selfing, and finally obtaining the single plants in which the gene types of InDel-16Y-46 and SA166 are consistent with the EC1 band type, and other chromosome segments are 8419 band types, namely the novel cucumber variety with full-female strong parthenocarpy.
3. The new cucumber variety Parth139 with full-female strong parthenocarpy has the following characteristics:
parth139 basically has the property of European greenhouse cucumber 8419, has strong parthenocarpy capacity and is a full-female inbred line;
the new cucumber variety with full-female strong parthenocarpy has strong plant growth, internode length of 10-12 cm, stem thickness of 0.7-0.8 cm, green leaves, average maximum leaf area of 23 multiplied by 22 cm, first female flower nodes positioned at 2-3 nodes, each node being a female flower without male flowers, commercial melons being linear and green, having white melons with thorns and more quantity, average cucumber length of 12-15 cm and thickness of 3-4 cm, and capable of bearing melons on main lateral vines.
4. The new cucumber variety Parth139 with full-female strong parthenocarpy is applied as follows:
mixing Parth139 with common cucumber with high combining ability according to the weight ratio of 3: 1, planting and carrying out normal plant management. Isolating in the flowering period, and then carrying out artificial pollination by taking Parth139 as a female parent and a commonly cultivated cucumber as a male parent. And (4) collecting mature fruits on the Parth139 plants, cutting and washing seeds of the seeds, and airing and drying the seeds to obtain the first generation of hybrid seeds with full-female strong parthenocarpy.
Sequence listing
<110> Nanjing university of agriculture
<120> linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
agtgcacttc gttttgaaca tcat 24
<210>2
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aggcaggaca accatgaata aaaa 24
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
caaaatgtcc tatgactggt aa 22
<210>4
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
catattgatc acaatgttct taaa 24
Claims (6)
1. A method for screening cucumbers containing a parthenocarpic major QTL Parth2.1, which is characterized by comprising the following steps: taking DNA of a material to be selected as a template, and carrying out PCR amplification by using a primer pair of a molecular marker Indel-16Y-46; performing polyacrylamide gel electrophoresis separation analysis on the amplification product; the plant capable of amplifying the 105bp specific strip is a plant containing cucumber single-sexual-fruit major QTL Parth 2.1; the primer pair of the molecular marker Indel-16Y-46 is as follows: the upstream primer is SEQ ID NO.1, and the downstream primer is SEQ ID NO. 2.
2. The method of claim 1, wherein the method comprises:
(1) using DNA of a material to be identified as a template, and carrying out PCR amplification by using the primer pair of the molecular marker Indel-16Y-46; the total volume of the PCR amplification reaction was 20. mu.l, including: 10 XBuffer 2.0 uL, dNTP2.0 uL, forward and reverse primers 1 uL, Taq enzyme 0.25 u L, DNA (10ng)1.0 uL, ddH2O, 12.75 mu L, and the reaction program is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30S, annealing at 60 ℃ for 30S, extension at 72 ℃ for 1min for 20S, and 35 cycles; extension at 72 ℃ for 5min, storage at 10 ℃, detection of PCR products: non-denatured reaction product at 7%Performing electrophoresis on polyacrylamide gel, and staining with silver nitrate; wherein the buffer contains Mg2+Taq enzyme concentration of 5 U.mu.L-1The DNA concentration is 10 ng;
(2) identifying Parth2.1 by using a labeled primer: the plant which can amplify the 105bp specific strip is a plant containing Parth 2.1.
3. The use of the molecular marker Indel-16Y-46 as claimed in claim 1 for the molecular marker assisted breeding of a new variety of strong parthenocarpic all-female cucumbers.
4. A molecular marker assisted breeding method for a new variety of full-female strong parthenocarpic cucumbers is characterized by comprising the following steps:
(1) taking a high-generation inbred line EC1 with strong parthenocarpy and full-female as a female parent and taking a high-generation inbred line 8419 without parthenocarpy and weak female as a male parent, hybridizing to obtain F1, selfing a hybrid F1 to obtain F2, continuously constructing an F2:4 population in a single seed transmission mode, counting the parthenocarpy rate through female flowers, and screening a recombinant single plant with the parthenocarpy rate of more than 90% from the F2:4 population;
(2) backcrossing and molecular marker assisted selection
Respectively utilizing an InDel marker InDel-16Y-46 closely linked with a parthenocarpic major QTL Parth2.1 and a molecular marker SA166 linked with a full female shape to carry out genotype screening on the screened individuals with the parthenocarpic rate of more than 90 percent, and selecting the individuals with both InDel-16Y-46 and SA166 as heterozygous individuals, wherein the specific method comprises the following steps:
1) extracting DNA of a single plant material leaf as a template, and carrying out PCR amplification by using InDel-16Y-46 and SA166 molecular marker primers;
2) and (3) detecting a PCR product: the reaction product was electrophoresed on 7% native polyacrylamide gel and stained with silver nitrate;
3) the result judges that the InDel mark InDel-16Y-46 can amplify a single band with the size of 135bp in the cucumber material without parthenocarpy, and can amplify a single band with the size of 105bp in the cucumber material with the parthenocarpy rate of more than 90 percent, can amplify two bands with the sizes of 105bp and 135bp in the hybrid F1 of the strong parthenocarpy cucumber material and the cucumber material without parthenocarpy or the hybrid single plant with the strong parthenocarpy in the group, and the SA166 mark can amplify a band with the size of 166bp in the all-female cucumber material or other all-female single plants, and can amplify no band in the materials which are not all-female; the InDel-16Y-46 and SA166 are heterozygous single strains, and 105bp, 135bp and 166bp bands can be amplified simultaneously;
the molecular marker InDel-16Y-46 closely linked with the parthenocarpic major QTL Parth2.1 comprises an upstream primer of SEQ ID NO.1 and a downstream primer of SEQ ID NO. 2; a molecular marker SA166, wherein the upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO. 4;
(3) selecting the recombinant individual with the parthenocarpy rate of more than 90% in the individual in which both InDel-16Y-46 and SA166 screened in the step (2) are heterozygous, backcrossing the recombinant individual with 8419, and continuously selecting the individual in which both InDel-16Y-46 and SA166 are heterozygous in the backcross generation 1, and backcrossing the individual with 8419; after backcrossing for 2 generations, continuously selecting the single plants in which both InDel-16Y-46 and SA166 are heterozygous for selfing, and finally obtaining the single plants in which the gene types of InDel-16Y-46 and SA166 are consistent with the EC1 band type, and other chromosome segments are 8419 band types, namely the novel cucumber variety with full-female strong parthenocarpy.
5. A molecular marker assisted breeding method as claimed in claim 4, characterized in that the new species of full-female strong parthenocarpic cucumber has substantially the European greenhouse cucumber 8419 trait with a parthenocarpic rate of more than 90% and is a full-female inbred line.
6. The molecular marker assisted breeding method of claim 5, wherein the new cucumber species with full-female strong parthenocarpy has strong plant growth, internode length of 10-12 cm, stem thickness of 0.7-0.8 cm, green leaves, average maximum leaf area of 23 x 22 cm, first female flower nodes of 2-3 nodes, each node is a female flower without male flower, commercial cucumber is linear, green, and white in cucumber thorn, and has large number, average cucumber length of 12-15 cm and thickness of 3-4 cm, and main lateral tendrils can bear cucumber.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910605499.1A CN110195125B (en) | 2019-07-05 | 2019-07-05 | Linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910605499.1A CN110195125B (en) | 2019-07-05 | 2019-07-05 | Linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110195125A CN110195125A (en) | 2019-09-03 |
| CN110195125B true CN110195125B (en) | 2020-04-07 |
Family
ID=67755848
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910605499.1A Active CN110195125B (en) | 2019-07-05 | 2019-07-05 | Linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110195125B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114381548B (en) * | 2022-01-25 | 2023-09-26 | 南京农业大学 | Molecular marker assisted selective breeding method for multi-site selection of strong parthenocarpy trait of cucumber |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789562A (en) * | 2015-05-06 | 2015-07-22 | 南京农业大学 | Molecular marker Indel-T-47 for close linkage with cucumber parthenocarpic main-effect QTL (quantitative trait loci) |
| CN108929916A (en) * | 2018-08-12 | 2018-12-04 | 扬州大学 | With the InDel label of Parthenocarpy in Cucumber gene close linkage and its application and primer |
-
2019
- 2019-07-05 CN CN201910605499.1A patent/CN110195125B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110195125A (en) | 2019-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10143174B2 (en) | Pepper plant | |
| US11134627B2 (en) | Breeding method and application of new downy mildew-resistant interspecific hybrid Cucumis sativus variety | |
| CN113151532B (en) | Molecular marker Indel-LNT-36 closely linked with cucumber fruit multi-ventricular trait | |
| CN106888962A (en) | The method for cultivating perennial rice restorer using hero wild rice vegetative propagation characteristic long | |
| CN103355160A (en) | Gradually oozing between the Cucumis kind is the method that colony made up and be used for breed cucumber | |
| CN104313155A (en) | Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method | |
| CN113151553B (en) | Molecular marker coseparated with watermelon plant few lateral branch gene Clbl and application | |
| CN110195125B (en) | Linkage molecular marker of cucumber parthenocarpic major QTL Parth2.1 and application thereof | |
| CN113151550A (en) | Molecular marker CmSSR02 closely linked with main effect QTL fft2 of early flowering characteristics of melons and application thereof | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN101773067A (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
| AU2017381651B2 (en) | Prolific flowering watermelon | |
| CN114381548B (en) | Molecular marker assisted selective breeding method for multi-site selection of strong parthenocarpy trait of cucumber | |
| CN110527740B (en) | Molecular marker and primer closely linked with Indian pumpkin strong female gene and application | |
| CN105850722A (en) | Culture method for stable and homozygous tobacco chromosome single fragment substitution line | |
| CN107699630B (en) | Molecular marker linked with wheat disease-resistant gene Pm21 and application thereof in breeding | |
| Usman et al. | Lime breeding: a way forward | |
| CN114672581A (en) | Molecular marker of rice heterologous cytoplasmic fertility restoration QTL qRf5.1 and application thereof | |
| CN113621730A (en) | Molecular marker development method for late bolting character of leaf mustard, molecular marker and application | |
| CN116004896A (en) | Method for predicting melon fruit length based on QTL locus interaction and related molecular markers | |
| CN114793890A (en) | Efficient breeding method for two-line and three-line strong-advantage restorer line | |
| CN117867161A (en) | Molecular marker related to control of self-compatibility S site of wolfberry and obtaining method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |