CN110194802B

CN110194802B - Recombinant targeted fusion protein TRAIL-SGRSA-GST and anti-tumor application thereof

Info

Publication number: CN110194802B
Application number: CN201910112876.8A
Authority: CN
Inventors: 马丹; 蔡振宇
Original assignee: Second Affiliated Hospital Army Medical University
Current assignee: Second Affiliated Hospital Army Medical University
Priority date: 2019-02-13
Filing date: 2019-02-13
Publication date: 2021-04-06
Anticipated expiration: 2039-02-13
Also published as: CN110194802A

Abstract

The invention relates to the field of genetic engineering protein drugs, in particular to a recombinant targeted fusion protein TRAIL-SGRSA-GST and an anti-tumor application thereof, wherein the recombinant targeted fusion protein TRAIL-SGRSA-GST consists of an amino acid sequence shown in SEQ ID NO. 2; the expression recombinant containing the gene, the engineering bacteria containing the expression recombinant, the recombinant targeting fusion protein TRAIL-SGRSA-GST expressed and separated by the engineering bacteria and the specific killing effect of the targeting fusion protein on colon cancer malignant tumor cells.

Description

Recombinant targeted fusion protein TRAIL-SGRSA-GST and anti-tumor application thereof

Technical Field

The invention relates to the field of genetic engineering protein drugs, in particular to a gene for coding a novel recombinant targeted antitumor drug fusion protein TRAIL-SGRSA-GST, an expression type recombinant vector containing the gene, an engineering bacterium containing the expression type recombinant vector, a targeted fusion protein TRAIL-SGRSA-GST expressed and separated by the engineering bacterium, and a specific killing effect of the targeted fusion protein on malignant tumor cells of colon cancer.

Background

The colon cancer is one of common malignant tumors, the incidence rate of the colon cancer is three first malignant tumors in developed countries in the west, the incidence rate of the colon cancer has a remarkable rising trend in recent years, and particularly, the incidence rate of the colon cancer is remarkably increased along with the improvement of living standard of people and the change of dietary structure in China. Although great progress has been made in the pathogenesis and clinical treatment of colon cancer, effective treatment of colon cancer has been a hotspot and difficulty in basic research and clinical treatment. The targeted therapy of the antitumor drug in local tumor is one of the important ways for effectively treating tumor. The discovery of TNF superfamily members has brought new opportunities for the treatment of tumors. TRAIL is a member of TNF superfamily members, and after being combined with corresponding receptors, TRAIL can start signal transduction in cells, and can rapidly induce apoptosis of various tumor cells and transformed cells in vivo, but has no toxic reaction to normal cells, and the mechanism is well recognized. This selective effect of TRAIL on tumor cells has made it attractive for the study of tumor therapy.

The research at present finds that when experimental animals are inoculated with tumor cells, the TRAIL protein is injected for a plurality of times, so that the growth of the tumor cells can be obviously inhibited, and even transplanted tumors can be eliminated; animal experiments have shown that TRAIL is safe to use, at least is considered to be minimally toxic to normal cells. This tumor cell-selective effect of TRAIL has seen promise in targeted therapy, however TRAIL proteins also have some practical drawbacks: firstly, only a large amount of TRAIL protein can inhibit the proliferation of tumor cells in vivo, but the large amount of TRAIL protein often has obvious killing effect on normal human liver cells, and hepatotoxicity becomes a main doubt for the application of large amount of TRAIL; ② the body widely expresses TRAIL receptor and injects exogenous TRAIL protein which will interfere the function of normal cell. Therefore, how to reduce the effective dose of TRAIL in tumor treatment and make TRAIL mainly play a role in tumor local targeting is the key for better performing TRAIL treatment on tumors.

Urokinase-type plasminogen activator is a glycoprotein containing 411 amino acid residues and having a molecular weight of about 50-60 KD, belongs to serine proteolytic enzymes, is an inactive single-chain precursor enzyme (pro-u-PA) when being secreted, can be activated into an active double-chain enzyme by a plasma enzyme after being combined with u-PAR on a cell membrane, and can reversely catalyze the conversion of plasma zymogen combined with a corresponding receptor into the plasma enzyme, so that the final result is that the number of the active u-PA and the plasma enzyme on the cell membrane of local tissues is increased. The expression level of u-PA and u-PAR is low in normal tissues, but the u-PA and the u-PAR are obviously over-expressed in almost all tumors (such as colon cancer, lung cancer, mononuclear and myeloid leukemia, pancreatic cancer, breast cancer, bladder cancer, liver cancer, gastric cancer, ovarian cancer, head and neck tumors and the like), namely the number and the activity of the u-PA on cell membranes of tumor tissues are far higher than those of the normal tissues.

Based on the biological characteristics of TRAIL in tumor resistance and the close relation between u-PA and tumor, we utilize the natural enzyme activity of u-PA on the surface of colon cancer cell to activate inactive TRAIL-GST with u-PA specific cleavage site sequence in the tumor tissue of high expression u-PA, and then act on the tumor locally, in order to overcome the toxic and side effects of prototype TRAIL and provide a high-efficiency and low-toxicity therapeutic drug for colon cancer patients.

Disclosure of Invention

The invention provides a targeting fusion protein TRAIL-SGRSA-GST of a new anti-colon cancer tumor medicament. The targeting fusion protein is a brand new molecule, which consists of human TRAIL, uPA and Glutathione S Transferase (GST) together, and has an amino acid sequence of SEQ ID NO. 2. In the construction of the fusion protein, the C end of 95 to 218 amino acids of human TRAIL is fused with a cleavage recognition amino acid sequence 'SGRSA' of uPA, and then a GST sequence (SEQ ID NO.1) is fused at the C end. The targeting fusion protein is endowed with a new characteristic that the targeting fusion protein shows low toxicity in the presence of GST fusion protein, and TRAIL only shows high killing effect on cells after GST amino acid sequence is cut by uPA through a specific recognition sequence 'SGRSA'. Compared with prototype TRAIL, the recombinant fusion protein TRAIL-SGRSA-GST has better application prospect.

The second purpose of the invention is to provide a gene for coding a novel antitumor drug targeting fusion protein TRAIL-SGRSA-GST, which has a nucleotide sequence of SEQ ID NO. 1.

The third purpose of the invention is to provide an expression recombinant vector pEX-C-GST containing the gene TRAIL-SGRSA-GST.

The fourth purpose of the invention is to provide an engineering bacterium pLT30GTI/BL21/DE3 containing the expression recombinant vector.

The fifth purpose of the invention is to provide the experimental evidence that the target fusion protein TRAIL-SGRSA-GST has specific killing effect on malignant colon cancer tumor cells.

In order to achieve the technical purpose, the technical scheme adopted by the invention is as follows:

the recombinant targeting fusion protein TRAIL-SGRSA-GST consists of urokinase type plasminogen activator (u-PA), tumor necrosis factor related apoptosis inducing ligand (TRAIL) and Glutathione S Transferase (GST) SEQ ID NO.2 amino acid sequence.

Further limited, the recombinant targeting fusion protein TRAIL-SGRSA-GST has a fusion gene consisting of a DNA sequence of SEQ ID NO. 2.

An expression type recombinant vector of the fusion gene comprises a recombinant targeting fusion protein TRAIL-SGRSA-GST consisting of a DNA sequence of SEQ ID NO. 2.

Further limited, the expression type recombinant vector of the fusion gene is an IPTG induction type expression recombinant vector, and the expression of the fusion gene TRAIL-SGRSA-GST is realized based on IPTG induction.

In a further limitation, the expression recombinant vector of the fusion gene is pEX-C-GST.

Further limited, the engineering bacteria are obtained by transfecting or transducing an expression type recombinant vector of a recombinant targeted fusion protein TRAIL-SGRSA-GST fusion gene consisting of a DNA sequence of SEQ ID NO. 2.

Further limited, the engineering bacteria are pLT30GTI/BL21/DE3 engineering bacteria, and are obtained by transforming Escherichia coli BL21/DE3 by an expression type recombinant vector pEX-C-GST.

A method for producing recombinant targeted fusion protein TRAIL-SGRSA-GST comprises the following steps, firstly, obtaining Escherichia coli BL21/DE3 by transfecting or transducing an expression type recombinant vector of a fusion gene of the recombinant targeted fusion protein TRAIL-SGRSA-GST consisting of a DNA sequence of SEQ ID NO. 2;

secondly, transforming escherichia coli BL21/DE3 by an expression recombinant vector pEX-C-GST to obtain pLT30GTI/BL21/DE3 engineering bacteria;

and thirdly, separating and purifying the engineering bacteria to obtain the recombinant targeted fusion protein TRAIL-SGRSA-GST.

Application of recombinant targeted fusion protein TRAIL-SGRSA-GST in preparation of medicines for killing colon cancer cells SW480, HCT116 and Lovo.

Application of recombinant targeted fusion protein TRAIL-SGRSA-GST in preparation of medicine for treating colon cancer malignant tumor, wherein the malignant tumor occurs in colon.

Drawings

FIG. 1, expression and purification of GST-tagged TRAIL fusion protein;

FIG. 2, TRAIL-SGRSA-GST specifically induces apoptosis of colon cancer cell lines;

FIG. 3, TRAIL-SGRSA-GST is not significantly toxic to normal hepatocytes;

FIG. 4, TRAIL-SGRSA-GST inhibits the growth of SW480 xenografts in vivo;

FIG. 5, pEX-C-GST map of the vector for expression of the fusion gene TRAIL-SGRSA-GST.

Detailed description of the preferred embodiments

The existing research shows that urokinase-type plasminogen activator (u-PA) as an important tumor marker is highly expressed in colon cancer, and based on the biological property of TRAIL protein for resisting tumor and the close relation between uPA and tumor, the natural enzyme activity of uPA on the surface of colon cancer cells is utilized to design a TRAIL-GST fusion protein expression plasmid with a uPA specific cleavage site sequence (FIG. 1A). Wherein the GST tag is positioned at the C end of the human TRAIL protein, and the u-PA specific cleavage site sequence is inserted between the TRAIL protein and the GST tag, and is named as TRAIL-SGRSA-GST. The PCR primers used for amplifying the human TRAIL DNA sequence are shown in Table 1, wherein the primers contain a sequence encoding u-PA specific cleavage site, and the names of the primers used for amplification are hTRAIL-F and hTRAIL-mu PA-R. The partial sequence of human TRAIL is amplified by using cDNA reverse transcription of total RNA extracted from human peripheral blood mononuclear cells as a template, and then cloned into a pEX-C-GST vector. The amino acid sequence of TRAIL-SGRSA-GST is shown in SEQ ID NO. 1; the DNA sequence is shown in SEQ ID NO.22. the constructed pEX-C-TRAIL-SGRSA-GST vector is transferred into engineering bacteria pLT30GTI/BL21/DE3, and TRAIL, TRAIL-GST and TRAIL-SGRSA-GST fusion protein are purified (figure 1B). In vitro incubation of TRAIL-SGRSA-GST protein with uPA we found that TRAIL-SGRSA-GST was successfully cleaved by uPA and released the TRAIL protein (FIG. 1C).

In which, FIG. 1, a GST-tagged TRAIL fusion protein was expressed and purified. FIG. 1(A) E coil expression human TRAIL fusion protein vector construction diagram. Wherein the cleavage site of uPA, SGRSA, is located between the TRAIL protein and the GST tag. FIG. 1 (B) Coomassie blue staining of the extracted purified protein shows that various versions of TRAIL protein with GST tag are expressed and successfully purified. FIG. 1 (C) Coomassie blue staining shows that GST-tagged TRAIL fusion protein with a cleavage site for uPA is successfully cleaved by uPA enzyme in vitro.

To verify whether TRAIL-SGRSA-GST specifically induces apoptosis of colon cancer cells, we incubated colon cancer cell line SW480 with TRAIL, TRAIL-GST and TRAIL-SGRSA-GST proteins, respectively. We found that TRAIL-GST exhibited low toxicity. However, TRAIL-SGRSA-GST and TRAIL protein were similar and both had strong killing effect on SW480 cells (FIG. 2A). To demonstrate whether the cytotoxicity of TRAIL-SGRSA-GST protein was mediated by the uPA enzyme in cells, we silenced uPA enzyme with shRNA gene in SW480 (FIG. 2B). We found that the sensitivity of uPA enzyme to TRAIL-SGRSA-GST-induced apoptosis was reduced in cells after silencing of uPA enzyme by shRNA gene, indicating that the cytotoxicity of TRAIL-SGRSA-GST protein was mediated by uPA enzyme in cells (FIG. 2C). We further incubated TRAIL-SGRSA-GST with other colon cancer tumor cell lines including HCT116, Lovo and HT 29. We found that TRAIL-SGRSA-GST significantly induced apoptosis of HCT116 and Lovo, but had no significant effect on HT29 cells, whereas HT29 cells demonstrated no expression of uPA enzyme (fig. 2D). Thus, these results indicate that TRAIL-SGRSA-GST specifically kills colon tumor cells mediated by uPA enzyme.

In FIG. 2, TRAIL-SGRSA-GST specifically induced apoptosis of colon cancer cell lines. FIG. 2(A) Annexin V flow cytometric analysis shows that TRAIL, TRAIL-SGRSA-GST can induce SW480 cell apoptosis obviously, but TRAIL-GST protein induces its apoptosis activity to reduce greatly FIG. 2 (B) Western blot analysis shows that we have established uPA stable RNA interference strain in SW480 cell successfully, FIG. 2 (C) Annexin V flow cytometric analysis shows that TRAIL-SGRSA-GST has no obvious apoptosis inducing effect on SW480 cell line with uPA stable RNA interference. FIG. 2 (D) Annexin V flow cytometric analysis shows that TRAIL-SGRSA-GST can significantly induce apoptosis of HCT116 and Lovo colon cancer cell line. But no apoptosis-inducing effect on the HT29 colon cancer cell line not expressing uPA.

To further verify whether TRAIL-SGRSA-GST is toxic to normal liver cells and tissues, we first compared the toxic effects of TRAIL, TRAIL-GST and TRAIL-SGRSA-GST on normal liver cells Chang cells. We found that TRAIL-SGRSA-GST protein exhibited very low toxicity compared to TRAIL and TRAIL-GST (FIG. 3A). We further injected GST, TRAIL, TRAIL-GST and TRAIL-SGRSA-GST proteins into the abdominal cavity of mice. HE staining of liver tissue sections of mice showed minimal damage to liver tissue by intraperitoneal injection of TRAIL-SGRSA-GST (FIG. 3B). Meanwhile, the analysis of alanine aminotransferase ALT and aspartate aminotransferase AST in the blood of the mice shows that: TRAIL-SGRSA-GST did not promote elevation of ALT and AST in blood (FIGS. 3C and D). Thus, the above studies demonstrated that TRAIL-SGRSA-GST is not significantly toxic to normal liver cells and tissues.

In FIG. 3, TRAIL-SGRSA-GST was not significantly toxic to normal hepatocytes. FIG. 3 (A) Annexin V flow cytometric analysis shows: compared with TRAIL, TRAIL-GST and TRAIL-SGRSA-GST can not obviously induce apoptosis of Chang cells of normal liver cells; FIG. 3 (B) mice were injected with large doses of I, PBS, II, TRAIL, respectively, in the abdominal cavity; IV, H & E staining analysis of liver sections after TRAIL-SGRSA-GST showed that: TRAIL-SGRSA-GST did not significantly induce liver damage in mice. FIG. 3 (C) analysis of alanine aminotransferase ALT and aspartate aminotransferase AST in blood after mice were injected intraperitoneally with large doses of PBS, GST protein, TRAIL, TRAIL-GST, TRAIL-SGRSA-GST, respectively, shows that: TRAIL-SGRSA-GST did not promote elevation of ALT and AST in blood.

To investigate whether TRAIL-SGRSA-GST also had inhibitory effects on tumor growth in vivo, we established a SW480 xenograft tumor model in nude mice. Tumor growth curves of TRAIL-SGRSA-GST administered with GST protein control, TRAIL, TRAIL-SGRSA-GST injected, showed that TRAIL-SGRSA-GST was as effective as TRAIL in inhibiting tumor growth (FIGS. 4A, B and C). Meanwhile, western blot analysis of tumor lysate shows that TRAIL-SGRSA-GST can obviously induce caspase-3 cleavage, and the occurrence of tumor cell apoptosis can be induced in TRAIL-SGRSA-GST. Therefore, the above results indicate that TRAIL-SGRSA-GST has a good inhibitory effect on colon cancer tumor, and has low cytotoxicity on normal cells and liver tissues.

FIG. 4, TRAIL-SGRSA-GST inhibits the growth of SW480 xenografts in vivo. FIG. 4 (A) model SW480 xenograft tumor in nude mice. Tumor growth curves of TRAIL-SGRSA-GST administered with GST protein control, TRAIL, TRAIL-SGRSA-GST injected with TRAIL showed that TRAIL-SGRSA-GST was as effective as TRAIL in inhibiting tumor growth. FIG. 4 (B) is a comparison of tumor images of GST protein control group and TRAIL-SGRSA-GST administration group. FIG. 4 (C) tumor weight statistics for GST protein control, TRAIL-administered group and TRAIL-SGRSA-GST-administered group. FIG. 4 (D) Western blot analysis of tumor lysates showed that TRAIL-SGRSA-GST significantly induced caspase-3 cleavage, suggesting that TRAIL-SGRSA-GST can also induce apoptosis in tumor cells in vivo.

The map of the vector pEX-C-GST for specifically expressing the fusion gene TRAIL-SGRSA-GST is shown in FIG. 5.

Wherein Table 1 shows all primers for cloning human TRAIL sequences, and Table 1 shows

The amino acid sequence of SEQ ID NO.2 TRAIL-SGRSA-GST is as follows,

MTSEETISTVQEKQQNISPLVRERGPQRVAAHITGTRGRSNTLSSPNSKNEKALGRKINSWESSRSGHSFLSNLHLRNGELVIHEKGFYYIYSQTYFRFQEEIKENTKNDKQMVQSGRSAMSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLEVLFQGPLGS

the specific DNA sequence of SEQ ID NO.1 TRAIL-SGRSA-GST is as follows,

5’-ATGTCTGAGGAAACCATTTCTACAGTTCAAGAAAAGCAACAAAATATTTCTCCCCTAGTGAGAGAAAGAGGTCCTCAGAGAGTAGCAGCTCACATAACTGGGACCAGAGGAAGAAGCAACACATTGTCTTCTCCAAACTCCAAGAATGAAAAGGCTCTGGGCCGCAAAATAAACTCCTGGGAATCATCAAGGAGTGGGCATTCATTCCTGAGCAACTTGCACTTGAGGAATGGTGAACTGGTCATCCATGAAAAAGGGTTTTACTACATCTATTCCCAAACATACTTTCGATTTCAGGAGGAAATAAAAGAAAACACAAAGAACGACAAACAAATGGTCCAAAGCCGAGCGCCCCGAATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCC--3’

sequence listing

<110> second subsidiary hospital of China civil liberation army, military and medical university

<120> recombinant targeting fusion protein TRAIL-SGRSA-GST and anti-tumor application thereof

<130> 2019101128768

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1050

<212> DNA

<213> SEQ ID NO.1 TRAIL-SGRSA-GST

<400> 1

atgtctgagg aaaccatttc tacagttcaa gaaaagcaac aaaatatttc tcccctagtg 60

agagaaagag gtcctcagag agtagcagct cacataactg ggaccagagg aagaagcaac 120

acattgtctt ctccaaactc caagaatgaa aaggctctgg gccgcaaaat aaactcctgg 180

gaatcatcaa ggagtgggca ttcattcctg agcaacttgc acttgaggaa tggtgaactg 240

gtcatccatg aaaaagggtt ttactacatc tattcccaaa catactttcg atttcaggag 300

gaaataaaag aaaacacaaa gaacgacaaa caaatggtcc aaagccgagc gccccgaatg 360

tcccctatac taggttattg gaaaattaag ggccttgtgc aacccactcg acttcttttg 420

gaatatcttg aagaaaaata tgaagagcat ttgtatgagc gcgatgaagg tgataaatgg 480

cgaaacaaaa agtttgaatt gggtttggag tttcccaatc ttccttatta tattgatggt 540

gatgttaaat taacacagtc tatggccatc atacgttata tagctgacaa gcacaacatg 600

ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc ttgaaggagc ggttttggat 660

attagatacg gtgtttcgag aattgcatat agtaaagact ttgaaactct caaagttgat 720

tttcttagca agctacctga aatgctgaaa atgttcgaag atcgtttatg tcataaaaca 780

tatttaaatg gtgatcatgt aacccatcct gacttcatgt tgtatgacgc tcttgatgtt 840

gttttataca tggacccaat gtgcctggat gcgttcccaa aattagtttg ttttaaaaaa 900

cgtattgaag ctatcccaca aattgataag tacttgaaat ccagcaagta tatagcatgg 960

cctttgcagg gctggcaagc cacgtttggt ggtggcgacc atcctccaaa atcggatctg 1020

gaagttctgt tccaggggcc cctgggatcc 1050

<210> 2

<211> 351

<212> PRT

<213> SEQ ID NO.2 TRAIL-SGRSA-GST

<400> 2

Met Thr Ser Glu Glu Thr Ile Ser Thr Val Gln Glu Lys Gln Gln Asn

1 5 10 15

Ile Ser Pro Leu Val Arg Glu Arg Gly Pro Gln Arg Val Ala Ala His

20 25 30

Ile Thr Gly Thr Arg Gly Arg Ser Asn Thr Leu Ser Ser Pro Asn Ser

35 40 45

Lys Asn Glu Lys Ala Leu Gly Arg Lys Ile Asn Ser Trp Glu Ser Ser

50 55 60

Arg Ser Gly His Ser Phe Leu Ser Asn Leu His Leu Arg Asn Gly Glu

65 70 75 80

Leu Val Ile His Glu Lys Gly Phe Tyr Tyr Ile Tyr Ser Gln Thr Tyr

85 90 95

Phe Arg Phe Gln Glu Glu Ile Lys Glu Asn Thr Lys Asn Asp Lys Gln

100 105 110

Met Val Gln Ser Gly Arg Ser Ala Met Ser Pro Ile Leu Gly Tyr Trp

115 120 125

Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr Leu

130 135 140

Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp Lys

145 150 155 160

Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu Pro

165 170 175

Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile Ile

180 185 190

Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys Glu

195 200 205

Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr

210 215 220

Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys Val

225 230 235 240

Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp Arg

245 250 255

Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro Asp

260 265 270

Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro Met

275 280 285

Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile Glu

290 295 300

Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile Ala

305 310 315 320

Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His Pro

325 330 335

Pro Lys Ser Asp Leu Glu Val Leu Phe Gln Gly Pro Leu Gly Ser

340 345 350

Claims

1. A recombinant targeting fusion protein TRAIL-SGRSA-GST is characterized by consisting of an amino acid sequence shown in SEQ ID NO. 2.

2. An expressible recombinant vector for fusion of genes, comprising: comprises a DNA sequence encoding SEQ ID NO. 2.

3. An engineering bacterium, which is characterized in that: comprising the expressible recombinant vector of claim 2.

4. A method of producing the recombinant targeted fusion protein TRAIL-SGRSA-GST of claim 1, characterized in that: comprises the following steps of (a) carrying out,

a first step of obtaining Escherichia coli from the expressive recombinant vector of claim 2 by transfection or transduction;

and secondly, separating and purifying the escherichia coli to obtain the recombinant targeted fusion protein TRAIL-SGRSA-GST.

5. The use of the recombinant targeted fusion protein TRAIL-SGRSA-GST of claim 1 in the preparation of a medicament for killing colon cancer cells SW480, HCT116 and Lovo.

6. The use of the recombinant targeted fusion protein TRAIL-SGRSA-GST as claimed in claim 1 in the preparation of a medicament for killing uPA-expressing colon cancer cells.