CN110184255A - The gene for preventing and treating anthracnose - Google Patents

The gene for preventing and treating anthracnose Download PDF

Info

Publication number
CN110184255A
CN110184255A CN201910503428.0A CN201910503428A CN110184255A CN 110184255 A CN110184255 A CN 110184255A CN 201910503428 A CN201910503428 A CN 201910503428A CN 110184255 A CN110184255 A CN 110184255A
Authority
CN
China
Prior art keywords
pld
banana
anthracnose
gene
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910503428.0A
Other languages
Chinese (zh)
Inventor
李丽
孙健
易萍
李昌宝
周主贵
何雪梅
盛金凤
辛明
郑凤锦
唐雅园
李杰民
刘国明
李志春
零东宁
陈茜
肖占仕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangxi Zhuang Nationality Autonomous Region Academy of Agricultural Sciences
Original Assignee
Guangxi Zhuang Nationality Autonomous Region Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangxi Zhuang Nationality Autonomous Region Academy of Agricultural Sciences filed Critical Guangxi Zhuang Nationality Autonomous Region Academy of Agricultural Sciences
Priority to CN201910503428.0A priority Critical patent/CN110184255A/en
Publication of CN110184255A publication Critical patent/CN110184255A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
    • A23B7/00—Preservation or chemical ripening of fruit or vegetables
    • A23B7/14—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10
    • A23B7/153—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10 in the form of liquids or solids
    • A23B7/154—Organic compounds; Microorganisms; Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
    • A23B7/00—Preservation or chemical ripening of fruit or vegetables
    • A23B7/14—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10
    • A23B7/153—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10 in the form of liquids or solids
    • A23B7/157—Inorganic compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/04—Phosphoric diester hydrolases (3.1.4)
    • C12Y301/04004—Phospholipase D (3.1.4.4)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Abstract

The present invention relates to field of biotechnology, and in particular to the gene for preventing and treating anthracnose prevents and treats the phospholipase D albumen of anthracnose, the protein that the gene PLD α 2 being made of the amino acid sequence of sequence table SEQ ID NO:2 is encoded.The base sequence as described in sequence table SEQ ID NO:1 of gene PLD α 2 coding.The protein encoded with phospholipase D activity modulator effect in gene PLD α 2 or gene PLD α 2 prevents and treats banana anthracnose.

Description

The gene for preventing and treating anthracnose
[technical field]
The present invention relates to field of biotechnology, and in particular to prevents and treats the gene of anthracnose.
[background technique]
Banana is Musaceae (Musaceae) Musa (Musa) monocotyledon, is to be grown on subtropical and tropical zones A kind of Important Economic crop.Global about 100,000,000 tons of annual output of banana in recent years, it has also become the main economic branch in many areas in the world Column, position is at the forefront in the world always and growth trend is presented for China's banana production.Banana is typical climacteric type fruit, for a long time Storage and transport difficult, since harvesting is lost quite seriously with caused by transport.In recent years banana postpartum proportion of goods damageds in China's are up to close 50%, significantly larger than the 5% of the average loss rate 25% of China's postharvest fruit and vegetable and developed country.
Phosphatide is not only the framework ingredient of biomembrane, and can participate in a variety of physiology mistakes by the product generated after hydrolysis Cell effect caused by journey and environmental stimulus.Phosphatidase is the key enzyme for being catalyzed the first step of phospholipid hydrolysis, according to hydrolysis phosphorus The position difference of rouge can fall into 5 types phosphatidase, i.e., phospholipase A1 (PLA1), phospholipase A2 (PLA2), phospholipase B (PLB), Phospholipase C (PLC) and phospholipase D (PLD).The catalytic activity of phosphatidase show lipid metabolism, film build again, Lipid signaling molecule The generation of (such as InsP3, diacylglycerol, phosphatidic acid) and free fatty acid.Recent studies indicate that phosphatidase is several It plays an important role in all life stages of plant and response to environment.Phospholipase D (Phospholipase D, PLD), i.e., phosphatidyl choline Phospholipid hydrolase (EC 3.1.4.4), category catalytic phosphatase diester linkage hydrolyze one kind with Baseexchange The general name of enzyme.PLD is generally existing in plant tissue, is widely distributed in each position (root, stem, leaf, seed etc.).PLD is in plant Entire life process in play an important role, take part in plant growth and development and the adjusting reacted environment and biotic. Many studies have shown that the effect of PLD is not only in that the structure, function and stabilization for influencing film by the phosphatide in hydrolyzed cellular film Property, and signal transduction, the performance of hormonal action, cytoskeleton assembling, the ordering of intracellular protein kinases and actin, It is fissional occur, wear film transport, secretion, defense reaction and seed sprouting and cell ageing in all play important work With.PLD is indispensable in the defence signal that plant resists disease generates.When plant encroaches on by pathogenic microorganism, PLD meeting The contact site of microorganism and plasma membrane is concentrated on, the change of activity and positioning occurs, to resist the infection of pathogen.
PLD can be divided into PLD α (1,2,3), PLD β (1,2), PLD γ (1,2,3), PLD δ, PLD ε and PLD ζ (1,2) (Wangetal.,2006,QinandWang,2002).Wherein, except specific to 2 PLD containing animal of PLD ζ 1 and PLD ζ Pleckstrinhomology (PH) and phoxhomology (PX) structural domain (QinandWang, 2002), other 10 PLDs N-terminal have Ca2+The phosphatide binding site C2 structural domain of dependence.System research is carried out to PLD family, shows different PLD Molecular regulation it is different, difference (such as Ca including the enzyme activition factor2+, free fatty acid and phosphatidylinositols etc.) The specificity of the Preference (Hongetal., 2009a) of (Wangetal., 2006), substrate, subcellular localization and tissue expression (QinandWang,2002,ZhaoandWang,2004).The otherness of its biochemical characteristic and spatial and temporal distributions implys that plant PLD Biology active effects.Different types of PLD has different biological effects.Recently it is combined by molecular genetic manipulation Multiple technologies have gradually illustrated plant PLD wide participation various biological process, such as PLD α 1 regulates and controls stomatal conductance, water Divide stress, leaf senile and hormone response process (Fanetal., 1997, Sangetal., 2001, Zhangetal., 2004)； PLD δ participates in Apoptosis, glycometabolism, low temperature and Freezing stress reaction (Lietal., 2004)；The just regulation Thief zone side of body of PLD α 3 Compel process (Hongetal, 2008b)；The nitrogen signal response of PLD ε mediated plant and adjusting and controlling growth (Hongetal., 2009a)； PLD ζ s participate in the recycling of plant phosphorus, auxin transhipment and the processes such as root hair is raw (Lietal., 2006a, Liet al., 2006b,Cruz-Ramírezetal.,2006).In plant, PLD α 1 and PLD δ can respond ABA in plant and promote stomata It closes aspect and plays adjustment effect, however, the different phase (Guoetal., 2012b) in the signal pathway but occurs in they. The effect of PLD δ occurs mainly in plant to the response phase (Zhangetal., 2003) of active oxygen (ROS), and PLD δ's is super The tolerance for expressing plant pair freeze injury enhances (Lietal., 2004)；And the effect of PLD α 1 occur the upstream of PLD δ simultaneously Promote the generation (Zhangetal., 2009) of ROS.
Banana anthracnose (Colletotrichum musae) is also known as black rot, and ripe fruit rot disease belongs to fungal disease, by Banana colletotrichum causes, and is the more serious disease (Zhu etc., 2011) of one kind for occurring after Banana in preservation process.Disease Bacterium can infect in the field Chinese olive phase, be to be harvested with adhering to spore intrusion and being hidden with dormant state on Chinese olive to fruit maturation Just show symptom afterwards, so fruit maturity is higher, disease occur it is more serious, this to after Banana storage and conveyer belt come pole Big challenge (Faisal etc., 2012).
Had many reports for the prevention and treatment of banana anthracnose at present, banana anthracnose mainly use carbendazim, The chemical agents such as thiophanate methyl, P applied levels, iprodione, turkdo are prevented and treated, but since the unreasonable of chemical agent makes With the exceeded of pesticide residue of banana amount is be easy to cause, seriously endangers human health and caused huge to influence banana foreign trade Big loss.The probability fallen ill in relation to banana in the different phase anthracnose of growth and development is unclear, and phospholipase D is special It is not that the mechanism of action of the expression and banana of PLD α 2 under anthracnose stress is unclear.
[summary of the invention]
Goal of the invention of the invention is: in view of the above-mentioned problems, the application provides the gene of prevention and treatment anthracnose.
To achieve the goals above, The technical solution adopted by the invention is as follows:
The present invention relates to
The present invention relates to a kind of phospholipase D albumen for preventing and treating anthracnose, by the amino acid sequence of sequence table SEQ ID NO:2 The protein that the gene PLD α 2 of composition is encoded.
The present invention relates to a kind of phospholipase D albumen as described above, and the gene PLD α 2 is by sequence table SEQ ID NO: The coding of base sequence described in 1.
The present invention relates to a kind of gene PLD α 2 as described above, and wherein gene PLD α 2 is isolated from banana.
The present invention relates to a kind of genes for preventing and treating anthracnose, encode albumen described in claim 1.
The present invention relates to the applications of phospholipase D albumen as described above, with phospholipase D activity modulator effect in base Because of the protein that PLD α 2 or gene PLD α 2 is encoded, banana anthracnose incidence is prevented and treated；
The phospholipase D activity regulator is selected from n-butanol, 2,3- diphosphoglyceric acid, N- acyl ethanol amine, haemolysis phosphorus Acyl ethanol amine, Wortmannin, abscisic acid and CaCl2In any one or a few.
It is compiled by targetedly acting on gene PLD α 2 or gene PLD α 2 of the invention with phospholipase D activity regulator The protein of code, the generation of adjustable phosphatidic acid and the degradation of film rouge carry out the integrality of protective film, reach the disease for resisting anthracnose The infection of opportunistic pathogen improves Postharvest Banana Fruits quality to reach, and delayed fruit aging extends the purpose of the shelf life of banana.
In conclusion by adopting the above-described technical solution, the beneficial effects of the present invention are:
The present invention clones banana phospholipase D family new gene (gene PLD α 2), and is examined by real-time fluorescence quantitative PCR Survey the expression pattern that PLD gene changes over time under anthracnose stress, shadow of the gene PLD α 2 to banana anthracnose stressful environmental The factor of sound is related, can prevent and treat banana anthracnose, reaches and improves Postharvest Banana Fruits quality, and delayed fruit aging extends banana Shelf life purpose.Simultaneously also for illustrate regulatory mechanism of the anthracnose in banana provide deeper into theoretical foundation.
[Detailed description of the invention]
Relative expression of Fig. 1 PLD in different Banana Tissues；
Fig. 2 is inoculated with anthrax-bacilus to the influence diagram of 2 relative expression of PLD α；
Fig. 3 protein system chadogram structure figures；
Fig. 4 Tertiary structure predictions figure；
Influence diagram of Fig. 5 anthracnose to banana hardness；
Influence of Fig. 6 anthracnose to banana L value；
Influence of Fig. 7 anthracnose to banana a value；
Influence of Fig. 8 anthracnose to banana b value；
Fig. 9 is inoculated with influence of the banana anthracnose to banana membrane permeability；
Figure 10 anthracnose is on the active influence of banana SOD；
Figure 11 is inoculated with anthrax-bacilus to the active influence of banana LOX；
Figure 12 is inoculated with banana anthracnose to the active influence of PLD；
Figure 13 is inoculated with anthrax-bacilus to the active influence of banana PC content；
Figure 14 is inoculated with banana anthracnose to its active influence of PE content；
Figure 15 is inoculated with anthrax-bacilus to the active influence of banana PA content；
Figure 16 n-butanol+abscisic acid+CaCl2Influence result figure of the compounding agent processing to 2 gene expression of PLD α；
Figure 17 n-butanol+abscisic acid+CaCl2Influence result of the compounding agent processing to the disease incidence of banana anthracnose Figure；
Figure 18 n-butanol+abscisic acid+CaCl2Compounding agent processing is on the active influence result figure of banana PLD.
[specific embodiment]
Below with reference to specific embodiment, description is of the invention in further detail.It should be understood that these embodiments are intended merely to It illustrates the present invention, rather than limits the scope of the invention in any way.
1 test material
" the osmanthus any of several broadleaf plants No. 6 " of the test material banana variety selection main cultivation in Guangxi.
2 banana PLD α, 2 gene cloning
(1) banana RNA extraction and reverse transcription
Appropriate Banana peel liquid nitrogen grinding is taken, referring to RNAprep Pure polysaccharide polyphenol plant total RNA extraction reagent box (day Root) specification extraction total serum IgE.ReferenceII Q RT SuperMix for qPCR kit (promise is only praised) reverse transcription Synthesize the first chain cDNA and for the amplification experiment of subsequent RACE method.
(2) banana PLD gene is conserved sequence amplified
Known PLD protein sequence is searched by ncbi database and carries out sequence alignment, determines two sections of conservative amino Degenerate primer PLD-DP1 and PLD-DP2 (see the table below) is designed after acid sequence.Using the cDNA of Banana peel as template, degeneracy is utilized Primer carries out PCR amplification, 1% agarose gel electrophoresis testing goal segment, and DNA fragmentation connection cloning vector pMD-19T is simultaneously surveyed Sequence verifying.
(3) banana PLD full length gene sequence amplification
5 '-RACE and 3 '-RACE primer (see the table below), RACE method ginseng are separately designed according to the known array that previous step obtains It is carried out according to SMARTer RACE 5'/3'Kit (Clontech), PCR amplification obtains the flanking fragment at 5 ' ends and 3 ' ends and surveyed Sequence verifying.PCR reaction is as follows: 94 DEG C of denaturation 30sec, 68 DEG C of annealing 30sec, 72 DEG C of extension 3min, 25 recycle.According to above Sequencing result splices the cDNA full length sequence for obtaining PLD gene.
(4)
Primer Primer sequence (5 ' -3 ') Effect
PLD-DP1 THGTNATHGTNGAYCAYGARATGCC It is conserved sequence amplified
PLD-DP2 CRCADATDATRTAYTCRTCRTCNAC
5′-PLD1 TGATCCGGAGACTTGGCATGTTCAGA 5 ' RACE amplification
5′-PLD2 CGTCTTCCGTCATGTTCCCCGAG 5 ' RACE amplification
3′-PLD1 CGCTTGCCAAGAAGAACAGACGCTT 3 ' RACE amplification
3′-PLD2 CGAGTACATCATATGCGGGTCGGCC 3 ' RACE amplification
qPLD-F3 CCGCAACGACTTCCATCAG 2 gene by fluorescence quantitative PCR of PLD α
qPLD-R3 GGTGAGCCGCAGGAGAATA
qCAC-F CTCCTATGTTGCTCGCTTATG Reference gene quantitative fluorescent PCR
qCAC-R GGCTACTACTTCGGTTCTTTC
It clones obtained 2 gene order of banana PLD α and sees sequence table SEQ ID NO:1.
The analysis of 3 banana PLD α, 2 gene expression characteristics
Pass through NCBI ORF finder online software (http://www.ncbi.nlm.nih.gov/gorf/ Gorf.html the open reading frame (ORF) of sequence) is searched；Utilize BLASTP (http://www.ncbi.nlm.nih.gov/ BLAST/ similar sequences) are searched, carry out sequence alignment；By online software ExPASyProtParam (http: // Web.expasy.org/protparam/) the spies such as the amino acid sequence of analysis gene coding, the molecular weight of protein and isoelectric point Property；Its letter is analyzed using online software SignalP 4.1 (http://www.cbs.dtu.dk/services/SignallP/) Number peptide sequence；Use online software Phyre (http://www.sbg.bio.ic.ac.uk/phyre/html/index.html) Tertiary structure predictions are carried out to the amino acid sequence of gene coding；Chadogram is constructed using MEGA7.0.
The ORF length of banana PLD α 2 is 2448bp, encodes 815aa；The prediction result of TMHMM Server v.2.0 shows 2 albumen of banana PLD α is without transmembrane structure；SignalP 4.1Server shows the albumen no signal peptide sequence；By in ExPASy Protparam prediction 2 albumen of PLD α physicochemical property, the molecular weight of the albumen and theoretical isoelectric point pI value are respectively 92.51kDa with 5.80；Online secondary structure prediction is carried out to 2 albumen of PLD α by the SOPMA in ExPASy, the results showed that should Albumen is by alpha-helix (Alpha helix, 27.36%), extended chain (Extended strand, 19.63%), β-corner (Beta Turn, 5.28%) and four kinds of structure compositions of random coil (Random coil, 47.73%), wherein based on random coil.Egg White three-dimensional structure is predicted that prediction result is specifically shown as shown in Figure 4.By 2 protein sequence of banana PLD α and other plant The PLD protein sequence in source is compared and to construct systematic evolution tree as shown in Figure 3.
2 albumen of banana PLD α and the PLD family member of reported peanut, rice, oil palm have high homology.This Research shows that the PLD genetic pedigree having the same from different plant species and possible catalysis having the same and function.
The expression pattern of 4 different Banana Tissue phospholipase Ds
The total serum IgE of Banana Root, stem, leaf and fruit different tissues is extracted respectively, and extracting method is same as above.ReferenceII Q RT SuperMix for qPCR kit (promise is only praised) reverse transcription synthesizes the first chain cDNA and in -20 DEG C It saves, for subsequent real time fluorescent quantitative experiment (qRT-PCR).According to 2 gene design primer (seeing the above table) of banana PLD α, with CAC (clathrin adaptor complexes medium) gene is internal reference, carries out qRT- by template of the cDNA of each tissue PCR analysis.It is carried out using AnalytikJena qTOWERE2.2 fluorescent quantitation instrument, referring to ChamQTMColor QPCRMaster Mix kit (promise is only praised) establishes reaction system.PCR program is as follows: 95 DEG C of 5min, 95 DEG C of 15s, and 57 DEG C 15s, 72 DEG C of 20s, 45 circulations.
It is opposite in its hetero-organization by the result of Fig. 1 it is found that PLD α 1 and PLD α 2 are distributed mainly in immature pericarp Expression quantity is lower.
5 anthracnose coerce the expression pattern of phosphatidase PLD α 2 in lower Banana During Storage
For the expression changing rule of PLD α 2 in preliminary clear Banana During Storage, using qRT-PCR to storage 0,3,6, 8,10 and 12d Banana peel is sampled detection.Total RNAs extraction and reverse recording method are same as above.
In terms of Fig. 2, the expression changing rule of PLD α 2 in Banana During Storage is had studied, as the result is shown in storage 2 expression quantity of PLD α is presented first rise after downward trend, in storage 3d to reach to peak value, later with the extension of storage time, 2 expression quantity of PLD α constantly declines, and the expression quantity that anthracnose coerces lower banana PLD α 2 is lower than control group, illustrates 2 gene pairs charcoal of PLD α The effect of negative regulation is presented in subcutaneous ulcer disease stress.Rear banana anthracnose stress procedure is adopted in the participation of PLD α 2 as the result is shown, so as to cause cell The damage of film integrality and post-harvest fruits quality.
Influence of 6 Colletotrichum gloeosporioides Infections to quality comparison after Banana
(1) Guangxi " osmanthus any of several broadleaf plants No. 6 " newly picked is taken,
(2) banana anthracnose induces test material
Healthy banana: after the field planting of any of several broadleaf plants seedling, irregularly spray prevents and treats banana tikka, and controlling sick leaf rate is 0, to reduce field Between anthracnose bacterium source.Banana take out flower bud after, bract be not switched on before start bagging, with guarantee without anthracnose infection.When picking time, adopt The banana of receipts first carries out anthracnose and is separately cultured, and determines banana of the separation less than anthracnose as normal healthy controls.Charcoal Subcutaneous ulcer disease induces fruit: anthrax bacteria is separately cultured acquisition by this laboratory, and processing anthrax bacteria suspension concentration is 25 mitogenetic Spore/the visual field (10 × 20 times), uniform suspension fill healthy banana epidermis, and the banana after inoculation is protected at 28 DEG C Warm moisturizing.
It is transported to Guangxi storage & processing of fruits and vegetables new technology key lab immediately after banana harvesting.Select size phase Closely, the fruit that fruit colour is uniform, has no mechanical damage, is randomly divided into control group and experimental group.It is outstanding that experimental group is dipped in anthrax bacteria It is lain in after 5min in supernatant liquid in the hollow out disk for being cased with PE bags, heat and moisture preserving at 28 DEG C, control group is placed on sterile water process Under the same terms, sampled respectively at 0,3,6,8,10 and 12d, and observe anthracnose incidence.Each Banana peel samples liquid Pulverizer breaks into powder and saves backup in -80 DEG C of refrigerators after nitrogen is quick-frozen.
Influence of 6.1 Colletotrichum gloeosporioides Infections to hardness
From the Determination of Hardness of Fig. 5 the results show that the growth banana maturity with storage time constantly increases, anthracnose is invaded The aggravation of dye degree, the hardness of banana constantly reduce.Processing group compared with the control group difference is not significant.When 0-6d, banana hardness Sharply decline, processing group is down to 138.7N by 566.5N, reduces amplitude later and slows down, when arriving 12d, hardness number only has 31.5N
L* value indicates brightness, and L* value is bigger, and brightness is bigger；A* value indicates the red green deviation of coloring matter, and positive value is bigger, partially Bigger to red degree, negative is bigger, and the degree for being biased to green is bigger；B* value indicates that the champac of coloring matter is inclined To positive value is bigger, and the degree for being biased to yellow is bigger, and negative is bigger, and the degree for being biased to blue is bigger.
By the result of color difference meter measurement L, a, b value (Fig. 6, Fig. 7, Fig. 8) it is found that Banana after ripening degree is continuous with the time Increase, after 10d, there is the variation tendency significantly by green flavescence.Anthracnose infection and control group (blank group) a* value difference Different significant, more green in 8d and 12d control treatment color, the scab that L value generates after anthracnose infection as the result is shown makes L Value significantly reduces.These results suggest that pericarp turns Huang faster after anthracnose infection processing.
Influence of 6.2 Colletotrichum gloeosporioides Infections to banana cells membrane permeability
Banana structural constituent in storage is usually degraded and damages, and main feature is exactly that cell membrane integrity meets with To destruction.Fig. 9 shows that compared with the control group anthracnose infection processing group shows significant difference after 6d, and relative conductivity is most It is big to be worth up to 86%.After banana is by anthracnose infection, cell membrane is destroyed, and membrane permeability is gradually increased, to make intracellular Electrolyte Leakage so that the conductivity of cell leaching liquor is gradually increased.
Influence of 6.3 Colletotrichum gloeosporioides Infections to banana correlation enzyme activity
Variation of the Colletotrichum gloeosporioides Infection to banana SOD enzyme activity is had studied, from Figure 10 the result shows that banana SOD enzyme activity becomes Downward trend after first rising is presented in change trend.Banana SOD enzyme activity rapidly rises after Colletotrichum gloeosporioides Infection, when storing 3d, SOD Enzymatic activity reaches maximum value, rear in the trend being gradually reduced.The variation of control group banana SOD enzyme activity is not significant.Anthrax bacteria is invaded Dye banana SOD enzyme activity is apparently higher than control banana, shows Colletotrichum gloeosporioides Infection induction of banana SOD increased activity, but with storage Hide the extension of time, the banana SOD activity decline of Colletotrichum gloeosporioides Infection, it may be possible to since the amount of accumulated active oxygen excessively has exceeded The defence limit.
Lipoxygenase (LOX) be it is a kind of be widely present in the intracorporal protein containing nonheme iron of plant, it can be catalyzed The Oxygenation of the polybasic unsaturated fatty acids such as plant Linoleic acid and linolenic acid destroys phospholipid bilayer, so as to cause thin After birth destroys.LOX is the key enzyme of plant phospholipid metabolism, and during entire anthracnose stress, banana LOX activity is first increased After reduce, when storing 0-6d, LOX activity is gradually increasing, later slowly decline, and in entire storage period, anthrax bacteria is invaded The LOX activity contaminated in banana is higher than control group (see Figure 11).
Influence of 6.4 Colletotrichum gloeosporioides Infections to banana phospholipase D metabolic process
The PLD of meeting activated plant, makes its activity change when pathogen infection plant.Banana is by the micro- life of cause of disease When object environment stress, PLD activity is significantly improved, store 3d and 10d when arrive reach to peak value, PLD activity be 43.99U/mL with 42.49U/mL (see Figure 12).Banana PLD in degeneration-resistant reaction can be concentrated in the contact site of microorganism and plasma membrane, and activity occurs With the change of positioning, to resist the infection of pathogen, PLD is active to adjust holding and the intracellular region for facilitating membrane structure Domain structure it is complete, to help to maintain banana Post-harvest quality.Therefore PLD is generated in the defence signal that plant resists disease In it is indispensable.
In order to which whether clear anthracnose induces the hydrolysis of banana phosphatide, banana phosphatide is analyzed.Result of study Show that downward trend after first rising is presented in anthracnose inoculation group and control banana PC content during processing, anthracnose processing group is fragrant The PC content of any of several broadleaf plants is significantly higher than control group (see Figure 13).
Banana is after being inoculated with anthracnose, and downward trend after first rising, anthracnose inoculation is presented in PE content in storage When 0-3d, as the extension PE content of time rises, decline rapidly after 3d.Control group banana PE content is in 127-142 μm of ol model It encloses interior fluctuation, and is inoculated with anthracnose group PE content and is consistently higher than control group (see Figure 14).
Anthracnose stress can activate PLD and lead to the hydrolysis of phosphatide.Result of study shows that PA content is presented in storage period Downward trend after first rising, when storing 0-6d, ascensional range is very fast, and the decline of PA content, is inoculated with the banana of anthracnose after 6d Middle PA content is significantly higher than control group (see Figure 15).PLD main function is hydrolysis phosphodiester bond, and catalysis phosphatide forms triphosphoric acid Inositol (IP3), phosphatidic acid (PA) etc., wherein PA is the main metabolites of phospholipase D, and PA is intracellular important second messenger Carry out signal transduction effect；PLD can influence the stability and mobility of membranous system structure by hydrolytic phosphatide simultaneously.PLD's Activation promotes the generation of its product PA, and with the raising of free choline levels, shows that PC is the substrate of reaction.PLD is in banana During anthracnose Stress responses, PLD takes part in the degradation of cell membrane as the starting enzyme in lipid catabolism approach, together When PLD also play a significant role in terms of transmembrane signal conduction and cell adjustings, during this period, PLD is active and part PLD Enhancing trend is presented in mRNA expression, active to increase so that the integrality of cell membrane is destroyed, and is unfavorable for adopting rear banana product The holding of matter.
Influence of the 7 phospholipase D activity modulator effects in gene PLD α 2 to Glorosprium musarum Cookeet Mass
N-butanol is that one kind turns phosphatidyl reaction substrate, it is considered to be the specific inhibitor of PLD.Abscisic acid (ABA) energy Enough regulate and control the activity of plant mitochondria film bound phosphorus lipase D.CaCl2PLD activity can be adjusted, the hardness of cell membrane is maintained.
Take n-butanol, ABA and CaCl2Compounding agent (three kinds i.e. in phospholipase D activity regulator compounded after obtain Phospholipase D activity regulator) Banana swatches newly picked are handled, by the side of the expression pattern of the 5th above-mentioned phosphatidase PLD α 2 Method is respectively respectively 0,4,8,12,16,20,24 day to the processing time, while blank control group is arranged.Each time point arrives it Afterwards, the expression of banana phosphatidase PLD α 2 is detected respectively.
As a result it is specifically shown in Figure 16.Banana downward trend after the expression of storage PLD α 2 presents and first rises, was being stored The processing of journey compounding agent is able to suppress the variation of the expression of 2 gene of PLD α, and the expression of PLD α 2 is made to maintain initial level.Plant exists When by pathogenic microorganism environment stress, a series of degeneration-resistant reaction can generally also occur.In the phase interaction of plant and pathogen With in the process, in the case that n-butanol there are, PLD, which is preferentially catalyzed PC and turns phosphatidyl with short chain primary alcohol, reacts generation stabilization Phosphatidyl alcohol and water, many researchs are exactly to adjust the physiological function of PLD using this reaction.Ca2+The perfume (or spice) for having mediated PA to regulate and control Response of any of several broadleaf plants to Disease Stress, Ca2+It can be entered in cytoplasm by the channel on plasma membrane, cause the closing of stomata.Exogenous ABA and CaCl2Processing can promote plant Ca2+Concentration increases, raised Ca2+PLD α 2 is activated again, generates signaling molecule PA, and PA may be with Corresponding target protein combines, and induces Ca2+The raising of concentration.The result shows that compounding agent can be changed by adjusting the expression of PLD α 2 PLD activity, causes banana to change the sensibility of anthracnose.
" the osmanthus any of several broadleaf plants No. 6 " newly picked is taken, using 50+50 μm of ol/LABA+20mmol/L CaCl of μ L/L n-butanol2Compounding agent After processing banana 0,4,8,12,16,20,24 day, banana disease index is measured, banana PLD activity is detected.Together When blank group is set.
(1) disease index measures: being divided into 0~4 grade according to the fruit surface size that rots.Grade scale: 0 grade of fruit (nothing Scab), 1 grade of fruit (<1/10 scab), 2 grades of fruits (1/10~1/4 scab), 3 grades of fruits (1/4~1/2 scab) and 4 grades of fruits (>1/2 disease Spot).Lesion size, disease index (%)=Σ (rank × rank sample size of rotting)/(highest are measured after sampling daily Not × total number of samples amount) × 100%.
Banana state of an illness index results are shown in Figure 17.It can be seen that compounding agent processing can effectively inhibit the morbidity of banana anthracnose Rate.
(2) it is usually the phosphatide using phosphatidyl choline as substrate that banana PLD activity, which is detected using enzyme-linked colorimetric method, The phosphodiester bond of its end of enzyme D catalyzing hydrolysis generates phosphatidic acid and choline, and choline is raw under the catalytic action of choline oxidase At glycine betaine and H2O2, the H of generation2O24- amino Anodynine and re-distilled phenol be oxidized under Catalyzed Synthesis By Peroxidase pink Color substance (Trinder reaction), measures the light absorption value of the pink substance under 500nm wavelength, finds from choline standard curve The method of corresponding content of choline.
Banana PLD Activity Results are shown in Figure 18.It can be seen that compounding agent processing is able to suppress the active increase of banana PLD.
Above description is the detailed description for the present invention preferably possible embodiments, but embodiment is not limited to this hair Bright patent claim, it is all the present invention suggested by technical spirit under completed same changes or modifications change, should all belong to In the covered the scope of the patents of the present invention.
Sequence table
<110>Guangxi Autonomous Region Academy of Agricultural Sciences
<120>gene of anthracnose is prevented and treated
<160> 2
<170> SIPOSequenceListing 1.0
<210> 2
<211> 2448
<212> DNA
<213>artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
atgtcgcagt ttttgctgca tggagttctg catgctacga tttttgaggc gacgtcggta 60
tccgaccgtt gcagaatcac ccgccatgct cccaagttcg tccgcgagct cgtcgaggcc 120
gtcgaaaaga cggtgagttt cggaaagggg tggagcaggt tctacgcgac gatcgacatc 180
gagatggccc gacttggtcg gacgagggtg atcacggggc accacgggaa tccccgctgg 240
aacgagtcct tccacatcta ctgcgcccac acggccgcca acgtggtctt caccgtcaag 300
ctcgaggagc cgatcggagc cagagtggtc ggaagggcgt ctttgtccac cgaggagctc 360
ctcggctgtg cagaggtcga ccggtggctc gagattctcg acgaggaccg ccgtcctctc 420
cgtggcggac ctgcgatcca tgtcagtctc cgcttcgtcg cggccgacat ggatcccaac 480
tggggaaggg gcgtgctaag tattcgctac ccgggcgtcc cccacacgtt cttctctcag 540
aggccgggct gcagagtgac gctgtaccag gacacgcact cctccgacgg cttctttccc 600
aggattccgc tcgcggatgg caagcagttc gaggcccacc gatgctggga ggacatcttc 660
gacgccattc aggacgccca gcacctgatc tacatcacgg ggtggtccgt gtacaccgag 720
atcacgttgg tgagagaccc ccggcggccg aagcctgaag gcgacgtcac tctcggagag 780
ctgctcaaga ggaaggcgag ccaaggcgtt cgggtgctca tactcatctg gcacgacagg 840
acggcgttgg gactcggatc ggtgcactac gggggcatca tggacaccca ctgcgaggac 900
accttccgtt tcttcgaagg cagcgatgtg cactgtgtct tgtccggccg ggatcccgat 960
ctgggcgaca gcctcgttga ggacgtgaag gtcctctaca tgttcaccca tcatcagaag 1020
accgtcatcg tcgaccacgc gatgcctaac gggaactcca cgttgcggca gatcgtcagc 1080
ttcgtcggcg gcatcgacct ctgcgacggg aggtacgaca tgcagttcca ctctctgttc 1140
aggacgttgg ccgcggagca ccgcaacgac ttccatcagc ccaacttcga cgacgcgtcc 1200
ttggagcgag gcggcccgcg ggagccgtgg cacgactccc acacccggat cgaaggcccc 1260
gccgcctggg acgtgctgtt caacttcgag cagaggtgga ggaaacaggg aggcaaggat 1320
attctcctgc ggctcaccga tctgtccgac atcatcatcc ccccgtcttc cgtcatgttc 1380
cccgagcaca gagacacgtg gactgttcag ctgttccggt ccatcgacgc cagcgccgcc 1440
ttcggcttcc ccgagtcccc ggaggatgcc gccgcggtcg ggctcgtcag cgggaaggac 1500
aacgtcatcg accgcagcgt tcaggacgcg tacatccacg ccattcgtag ggccaagaac 1560
ttcatctaca tcgagaacca gtacttgatc gggagctcct tcgggtggaa ggccgacgac 1620
atcgagccca aggacatcgg cgcgctgcat ctgatcccca aggagctgtc gctgaagatc 1680
gctagcaaga tcgaagccgg ggagcgcttc gccgtctatg tggtcatgcc catgtggccg 1740
gagggcgcgc cggagctggg gcaaggccaa gccatcttgg actggcagcg gaggacgatg 1800
gagatgatgt acaccgacgt cgcgcaagcg ctccgagcca agggagtgga agccaacccc 1860
gaggagtacc tcaacttctt ctgcttggga aacagggagg tgaagaggag cggggaacac 1920
gagcctcggg agcatccgaa accggacacc aactacatga gatctcagga ggcgaggcga 1980
ttcatgatct acgttcacag caagctgatg atagttgacg acgagtacat catatgcggg 2040
tcggccaaca tcaaccagcg gtcgatggac ggaggaaggg actccgagat cgtcatgggg 2100
gcgtaccagc cgtaccatct gtcgacgacg gagccggcga gggggcagat ccatggcttc 2160
cgtatggcgc tctggtacga gcacctcggc gtgctcgacg acgacttcct ccacccggag 2220
agcctgcatt gcgtgcagaa ggtgaacaat atcgccgagc tgtactggga cctcttcacc 2280
ggcgagcggc aggacggtga cctccccggc catcttcttc cctatcccat cggcgtcaca 2340
tacgacggca gcatcacgca gctgccgggc ttcgagttct ttcccgacac gcggggccgt 2400
gttctgggaa ccaagtcggc ctacatcctg ccggttctca ccacctaa 2448
<210> 1
<211> 815
<212> PRT
<213>artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
Met Ser Gln Phe Leu Leu His Gly Val Leu His Ala Thr Ile Phe Glu
1 5 10 15
Ala Thr Ser Val Ser Asp Arg Cys Arg Ile Thr Arg His Ala Pro Lys
20 25 30
Phe Val Arg Glu Leu Val Glu Ala Val Glu Lys Thr Val Ser Phe Gly
35 40 45
Lys Gly Trp Ser Arg Phe Tyr Ala Thr Ile Asp Ile Glu Met Ala Arg
50 55 60
Leu Gly Arg Thr Arg Val Ile Thr Gly His His Gly Asn Pro Arg Trp
65 70 75 80
Asn Glu Ser Phe His Ile Tyr Cys Ala His Thr Ala Ala Asn Val Val
85 90 95
Phe Thr Val Lys Leu Glu Glu Pro Ile Gly Ala Arg Val Val Gly Arg
100 105 110
Ala Ser Leu Ser Thr Glu Glu Leu Leu Gly Cys Ala Glu Val Asp Arg
115 120 125
Trp Leu Glu Ile Leu Asp Glu Asp Arg Arg Pro Leu Arg Gly Gly Pro
130 135 140
Ala Ile His Val Ser Leu Arg Phe Val Ala Ala Asp Met Asp Pro Asn
145 150 155 160
Trp Gly Arg Gly Val Leu Ser Ile Arg Tyr Pro Gly Val Pro His Thr
165 170 175
Phe Phe Ser Gln Arg Pro Gly Cys Arg Val Thr Leu Tyr Gln Asp Thr
180 185 190
His Ser Ser Asp Gly Phe Phe Pro Arg Ile Pro Leu Ala Asp Gly Lys
195 200 205
Gln Phe Glu Ala His Arg Cys Trp Glu Asp Ile Phe Asp Ala Ile Gln
210 215 220
Asp Ala Gln His Leu Ile Tyr Ile Thr Gly Trp Ser Val Tyr Thr Glu
225 230 235 240
Ile Thr Leu Val Arg Asp Pro Arg Arg Pro Lys Pro Glu Gly Asp Val
245 250 255
Thr Leu Gly Glu Leu Leu Lys Arg Lys Ala Ser Gln Gly Val Arg Val
260 265 270
Leu Ile Leu Ile Trp His Asp Arg Thr Ala Leu Gly Leu Gly Ser Val
275 280 285
His Tyr Gly Gly Ile Met Asp Thr His Cys Glu Asp Thr Phe Arg Phe
290 295 300
Phe Glu Gly Ser Asp Val His Cys Val Leu Ser Gly Arg Asp Pro Asp
305 310 315 320
Leu Gly Asp Ser Leu Val Glu Asp Val Lys Val Leu Tyr Met Phe Thr
325 330 335
His His Gln Lys Thr Val Ile Val Asp His Ala Met Pro Asn Gly Asn
340 345 350
Ser Thr Leu Arg Gln Ile Val Ser Phe Val Gly Gly Ile Asp Leu Cys
355 360 365
Asp Gly Arg Tyr Asp Met Gln Phe His Ser Leu Phe Arg Thr Leu Ala
370 375 380
Ala Glu His Arg Asn Asp Phe His Gln Pro Asn Phe Asp Asp Ala Ser
385 390 395 400
Leu Glu Arg Gly Gly Pro Arg Glu Pro Trp His Asp Ser His Thr Arg
405 410 415
Ile Glu Gly Pro Ala Ala Trp Asp Val Leu Phe Asn Phe Glu Gln Arg
420 425 430
Trp Arg Lys Gln Gly Gly Lys Asp Ile Leu Leu Arg Leu Thr Asp Leu
435 440 445
Ser Asp Ile Ile Ile Pro Pro Ser Ser Val Met Phe Pro Glu His Arg
450 455 460
Asp Thr Trp Thr Val Gln Leu Phe Arg Ser Ile Asp Ala Ser Ala Ala
465 470 475 480
Phe Gly Phe Pro Glu Ser Pro Glu Asp Ala Ala Ala Val Gly Leu Val
485 490 495
Ser Gly Lys Asp Asn Val Ile Asp Arg Ser Val Gln Asp Ala Tyr Ile
500 505 510
His Ala Ile Arg Arg Ala Lys Asn Phe Ile Tyr Ile Glu Asn Gln Tyr
515 520 525
Leu Ile Gly Ser Ser Phe Gly Trp Lys Ala Asp Asp Ile Glu Pro Lys
530 535 540
Asp Ile Gly Ala Leu His Leu Ile Pro Lys Glu Leu Ser Leu Lys Ile
545 550 555 560
Ala Ser Lys Ile Glu Ala Gly Glu Arg Phe Ala Val Tyr Val Val Met
565 570 575
Pro Met Trp Pro Glu Gly Ala Pro Glu Leu Gly Gln Gly Gln Ala Ile
580 585 590
Leu Asp Trp Gln Arg Arg Thr Met Glu Met Met Tyr Thr Asp Val Ala
595 600 605
Gln Ala Leu Arg Ala Lys Gly Val Glu Ala Asn Pro Glu Glu Tyr Leu
610 615 620
Asn Phe Phe Cys Leu Gly Asn Arg Glu Val Lys Arg Ser Gly Glu His
625 630 635 640
Glu Pro Arg Glu His Pro Lys Pro Asp Thr Asn Tyr Met Arg Ser Gln
645 650 655
Glu Ala Arg Arg Phe Met Ile Tyr Val His Ser Lys Leu Met Ile Val
660 665 670
Asp Asp Glu Tyr Ile Ile Cys Gly Ser Ala Asn Ile Asn Gln Arg Ser
675 680 685
Met Asp Gly Gly Arg Asp Ser Glu Ile Val Met Gly Ala Tyr Gln Pro
690 695 700
Tyr His Leu Ser Thr Thr Glu Pro Ala Arg Gly Gln Ile His Gly Phe
705 710 715 720
Arg Met Ala Leu Trp Tyr Glu His Leu Gly Val Leu Asp Asp Asp Phe
725 730 735
Leu His Pro Glu Ser Leu His Cys Val Gln Lys Val Asn Asn Ile Ala
740 745 750
Glu Leu Tyr Trp Asp Leu Phe Thr Gly Glu Arg Gln Asp Gly Asp Leu
755 760 765
Pro Gly His Leu Leu Pro Tyr Pro Ile Gly Val Thr Tyr Asp Gly Ser
770 775 780
Ile Thr Gln Leu Pro Gly Phe Glu Phe Phe Pro Asp Thr Arg Gly Arg
785 790 795 800
Val Leu Gly Thr Lys Ser Ala Tyr Ile Leu Pro Val Leu Thr Thr
805 810 815

Claims (5)

1. a kind of phospholipase D albumen for preventing and treating anthracnose, which is characterized in that by the amino acid sequence of sequence table SEQ ID NO:2 The protein that the gene PLD α 2 of composition is encoded.
2. phospholipase D albumen according to claim 1, which is characterized in that the gene PLD α 2 is by sequence table SEQ ID The coding of base sequence described in NO:1.
3. phospholipase D albumen according to claim 1, which is characterized in that wherein gene PLD α 2 is isolated from banana.
4. a kind of gene for preventing and treating anthracnose, encodes albumen described in claim 1.
5. the application of phospholipase D albumen according to claim 1, which is characterized in that make with phospholipase D activity regulator For the protein that gene PLD α 2 or gene PLD α 2 is encoded, banana anthracnose is prevented and treated；
The phospholipase D activity regulator is selected from n-butanol, 2,3- diphosphoglyceric acid, N- acyl ethanol amine, hemolytic phosphatidyl Ethanol amine, Wortmannin, abscisic acid and CaCl2In any one or a few.
CN201910503428.0A 2019-06-11 2019-06-11 The gene for preventing and treating anthracnose Pending CN110184255A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910503428.0A CN110184255A (en) 2019-06-11 2019-06-11 The gene for preventing and treating anthracnose

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910503428.0A CN110184255A (en) 2019-06-11 2019-06-11 The gene for preventing and treating anthracnose

Publications (1)

Publication Number Publication Date
CN110184255A true CN110184255A (en) 2019-08-30

Family

ID=67721325

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910503428.0A Pending CN110184255A (en) 2019-06-11 2019-06-11 The gene for preventing and treating anthracnose

Country Status (1)

Country Link
CN (1) CN110184255A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101636446A (en) * 2007-01-17 2010-01-27 陶氏益农公司 Delivery of ethylene blocking and/or promoting agents

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101636446A (en) * 2007-01-17 2010-01-27 陶氏益农公司 Delivery of ethylene blocking and/or promoting agents

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
AHMED ZIENAB F R等: "《Postharvest dip treatment with a natural lysophospholipid plus soy》", 《POSTHARVEST BIOLOGY AND TECHNOLOGY》 *
C YI等: "《ATP-induced Changes in Energy Status and Membrane Integrity of Harvested Litchi Fruit and its Relation to Pathogen Resistance》", 《J. PHYTOPATHOLOGY》 *
DIPPE MARTIN等: "《Phospholipid acylhydrolases trigger membrane degradation》", 《FUNGAL GENETICS AND BIOLOGY》 *
ET AL: "《PREDICTED：Musa acuminata subsp malaccensis phospholipase D alpha 1-like (LOC103990011), mRNA》", 《NCBI REFERENCE SEQUENCE：XM_009409017.2》 *
HEWAJULIGE, I G N等: "《Pre-harvest "Tree Fresh" spray treatment reduces disease incidence and extends the harvesting season of "TJC"mango grown in Sri Lanka》", 《ACTA HORTICULTURAE》 *
LI等.: "《Cloning, Characterization, and Functional Expression of Phospholipase D alpha cDNA from Banana (Musa acuminate L)》", 《JOURNAL OF FOOD QUALITY 》 *
YOUNG SA等: "《Changes in the plasma membrane distribution of rice phospholipase D during resistant interactions with Xanthomonas oryzae pv oryzae》", 《PLANT CELL 》 *
李帅等: "《磷脂酶D 与病原微生物感染》", 《微生物学通报》 *
杨振: "《拟南芥保卫细胞质膜质子泵对质膜钙通道活性的影响》", 《河北师范大学硕士学位论文》 *
王瑞霞等: "《PLD基因的基本功能及在植物中的利用研究现状》", 《西北植物学报》 *
郭书谱编著: "《新版果树病虫害防治彩色图鉴》", 30 April 2010, 中国农业大学出版社 *

Similar Documents

Publication Publication Date Title
Flores et al. Ocatin. A novel tuber storage protein from the andean tuber crop oca with antibacterial and antifungal activities
Saa et al. Foliar application of microbial and plant based biostimulants increases growth and potassium uptake in almond (Prunus dulcis [Mill.] DA Webb)
Lobato et al. Effect of foliar applications of phosphite on post-harvest potato tubers
Shane et al. Shoot P status regulates cluster‐root growth and citrate exudation in Lupinus albus grown with a divided root system
Wu et al. Root colonization of encapsulated Klebsiella oxytoca Rs-5 on cotton plants and its promoting growth performance under salinity stress
Fontes et al. Grape berry vacuole: a complex and heterogeneous membrane system specialized in the accumulation of solutes
Or et al. Dormancy in grape buds: isolation and characterization of catalase cDNA and analysis of its expression following chemical induction of bud dormancy release
Peris-Felipo et al. Silicon beneficial effects on yield, fruit quality and shelf-life of strawberries grown in different culture substrates under different iron status
Liu et al. Coordinated regulation of arbuscular mycorrhizal fungi and soybean MAPK pathway genes improved mycorrhizal soybean drought tolerance
Yang et al. Effect of nodules on dehydration response in alfalfa (Medicago sativa L.)
Afroz et al. Comparative proteomic analysis of bacterial wilt susceptible and resistant tomato cultivars
Złotek et al. Effect of arachidonic acid elicitation on lettuce resistance towards Botrytis cinerea
Vergara et al. Dark septate endophytic fungi increase the activity of proton pumps, efficiency of 15 N recovery from ammonium sulphate, N content, and micronutrient levels in rice plants
Neuhaus et al. Transcript expression of Mg-chelatase and H+-ATPase isogenes in Vicia faba leaves as influenced by root and foliar magnesium supply
Zonouri et al. Effect of foliar spraying of ascorbic acid on cell membrane stability, lipid peroxidation, total soluble protein, ascorbate peroxidase and leaf ascorbic acid under drought stress in grapes
Wang et al. MaCDPK7, a calcium-dependent protein kinase gene from banana is involved in fruit ripening and temperature stress responses
Wijanarko et al. Production of a biopesticide based on a cysteine protease enzyme from latex and papaya (Carica papaya) for Spodoptera litura in red chili peppers (Capsicum annuum)
CN110205311A (en) A kind of gene PLD ζ preventing and treating anthracnose
Zhang et al. A transcriptional activator from Rhizophagus irregularis regulates phosphate uptake and homeostasis in AM symbiosis during phosphorous starvation
CN110184255A (en) The gene for preventing and treating anthracnose
Ahmad et al. Metabolic and physiological changes induced in Sesamum indicum infected by phytoplasmas
Kim et al. Ethylene mitigates waterlogging stress by regulating glutathione biosynthesis-related transcripts in soybeans
CN110106195A (en) A kind of gene PLD γ preventing and treating anthracnose
CN110129297A (en) A kind of phospholipase D albumen for preventing and treating anthracnose
Niklis et al. Ethylene production by Botrytis cinerea, kiwifruit and Botrytis rotted kiwifruit under several storage temperatures

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190830