CN110172095B

CN110172095B - Humanized monoclonal antibody of Zika virus with high neutralization activity and application thereof

Info

Publication number: CN110172095B
Application number: CN201910468062.8A
Authority: CN
Inventors: 高福; 严景华; 王奇慧; 仝舟
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2016-08-10
Filing date: 2016-08-10
Publication date: 2020-09-04
Anticipated expiration: 2036-08-10
Also published as: CN106279409B; CN110172095A; CN106279409A; CN110066333B; WO2018028635A1; CN110066333A

Abstract

The invention discloses a humanized monoclonal antibody of Zika virus with high neutralization activity and application thereof, belonging to the technical field of medicines. The invention uses Zika E protein expressed by escherichia coli as antigen, selects memory B cells which can specifically bind to Zika E protein from PBMCs of one patient in convalescence through flow sorting, then carries out RT-PCR on the selected single B cell to obtain variable region sequence and fragment of the antibody, and further connects the variable region sequence and the constant region to an expression vector. After mammalian cell expression and purification, a series of function tests are carried out, including the tests of the binding force with ZIKE-E protein, in vitro neutralization effect, in vivo protection capability and the like, and 3 humanized monoclonal antibodies with complete protection of Zika virus infection are obtained.

Description

Humanized monoclonal antibody of Zika virus with high neutralization activity and application thereof

Technical Field

The invention relates to a humanized monoclonal antibody of Zika virus with high neutralization activity and application thereof, belonging to the technical field of medicines.

Background

There is increasing evidence that Zika virus (ZIKV) can cause neonatal microcephaly as well as neurodevelopmental abnormalities, such as "guillain-barre syndrome" and the like. ZIKV, belonging to flaviviruses, is transmitted mainly by mosquito bites, but blood, sexual and maternal-fetal transmission routes have also been reported. In 1947, ZIKV was first isolated from macaques in jungle of the black-dry dada. The virus is prevalent mainly in tropical regions of africa and asia. In 2015, brazil exploded the zhaka epidemic, spreading to other countries as the population moved. This epidemic has now led to over 60 countries or regions with over 80,000 cases of infection. However, effective vaccines and therapeutic approaches against the virus are still lacking.

The neutralizing antibody has high specificity, can block the invasion of virus and is an effective means for treating virus infection. The flavivirus envelope protein E protein mediates the binding and invasion of the virus into host cells and is the major protective antigen of the virus. The X-ray crystallography structure shows that the flavivirus E protein has three domains: DI, DII and DIII. DIII is believed to be responsible for mediating binding of the virus to the receptor, and previous findings suggest that most potent neutralizing antibodies recognize the neutralizing epitope of DIII. However, recent data show that highly neutralizing epitopes are also present in the E protein dimers as well as with adjacent dimers on the surface of the virus. The DII header (amino acids 98-110) contains a highly conserved fusion region (FL) that plays a key role in the membrane fusion process of viral invasion. The conservation of the FL region is very high for different flaviviruses, and during viral infection immune cells produce large amounts of antibodies against FL.

Several neutralizing antibodies against flaviviruses such as dengue have been found to have broad spectrum neutralizing activity and can neutralize zika virus, such as: 2a10G6, a11, C8, etc., which typically bind to a region on or near the conserved fusion peptide. Recently, it was reported that neutralizing antibodies bound to protein E DIII were isolated from PBMC of Zika convalescent patients. Mouse hybridoma cells were also used to screen for zika-specific neutralizing antibodies capable of binding DIII. These antibodies are capable of protecting mice from lethal doses of virus to varying degrees. However, RNA viruses are characterized by high mutations under antibody pressure, and although some neutralizing antibodies have been identified, more new antibodies directed against different epitopes are essential for therapy. The aim of the present invention is to identify specific novel ZIKV neutralizing antibodies with protective effect.

Disclosure of Invention

In order to solve the problems, the invention firstly uses ZIKV-E protein expressed by escherichia coli as an antigen, screens memory B cells capable of specifically binding the ZIKV-E protein from PBMCs of a patient in the convalescent period through flow sorting, then carries out RT-PCR on the screened single B cells to obtain a variable region sequence and a fragment of an antibody, and further connects the variable region sequence and the fragment with a constant region into an expression vector. After mammalian cell expression and purification, a series of function tests are carried out, including the tests of the binding force with ZIKE-E protein, in vitro neutralization effect, in vivo protection capability and the like, and 3 human monoclonal antibodies with complete or partial protection of Zika virus infection are obtained.

A first object of the present invention is to provide an antibody, which is designated as Z3L1, Z20 or Z23; wherein the amino acid sequence of the heavy chain variable region of Z3L1 is SEQ ID NO. 1 and the amino acid sequence of the light chain variable region is SEQ ID NO.2, the amino acid sequence of the heavy chain variable region of Z20 is SEQ ID NO.3 and the amino acid sequence of the light chain variable region is SEQ ID NO. 4, the amino acid sequence of the heavy chain variable region of Z23 is SEQ ID NO. 5 and the amino acid sequence of the light chain variable region is SEQ ID NO. 6.

In one embodiment of the invention, the nucleotide sequence of the heavy chain of Z3L1 is SEQ ID NO. 7 and the nucleotide sequence of the light chain is SEQ ID NO. 8.

In one embodiment of the invention, the nucleotide sequence of the heavy chain of Z20 is SEQ ID NO. 9, and the nucleotide sequence of the light chain is SEQ ID NO. 10.

In one embodiment of the invention, the nucleotide sequence of the heavy chain of Z23 is SEQ ID NO. 11 and the nucleotide sequence of the light chain is SEQ ID NO. 12.

In one embodiment of the invention, the heavy chain of the antibody comprises a heavy chain variable region and a heavy chain constant region, wherein the amino acid sequence of the heavy chain constant region is shown as SEQ ID NO. 13.

In one embodiment of the invention, the light chain of the antibody Z20 or Z23 is a kappa chain, and the light chain of Z3L1 is a lambda chain; the light chain comprises a light chain variable region and a light chain constant region; the amino acid sequence of the light chain constant region of the kappa chain is shown in SEQ ID NO. 15, and the amino acid sequence of the light chain constant region of the lambda chain is shown in SEQ ID NO. 17.

The three antibodies of the invention are derived from the same patient, target envelope protein-E protein which is specific to the Zika virus, and inhibit infection of cells by the virus by inhibiting the receptor binding and/or membrane fusion process mediated by the E protein.

The second purpose of the invention is to provide the application of the antibody in preparing a medicament for treating and/or preventing Zika virus.

The third purpose of the invention is to provide a pharmaceutical composition, which contains the human monoclonal antibody Z3L1, Z20 and/or Z23.

In one embodiment of the present invention, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

The fourth purpose of the invention is to provide a kit, wherein the kit contains the antigen of the antibody, or a DNA molecule for coding the antigen, or a recombinant vector/expression cassette/transgenic cell line/recombinant bacterium for expressing the antigen.

The fifth object of the present invention is to provide a gene sequence encoding the human monoclonal antibody Z3L1, Z20 or Z23.

The heavy chain of the antibody comprises a heavy chain variable region and a heavy chain constant region, wherein the amino acid sequence of the heavy chain constant region is shown as SEQ ID NO. 13 (the nucleotide sequence is shown as SEQ ID NO. 14).

In one embodiment of the invention, the sequence encoding the heavy chain of the antibody comprises a CMV promoter sequence, an EcoR I cleavage site sequence, a leader sequence, a sequence encoding the heavy chain variable region, a sequence encoding the heavy chain constant region, and an XhoI cleavage site sequence, in that order.

In one embodiment of the invention, the light chain of the antibody is a kappa chain and/or a lambda chain; the light chain includes a light chain variable region and a light chain constant region.

In one embodiment of the invention, the sequence encoding the light chain of the antibody comprises a CMV promoter sequence, a first enzyme cleavage site sequence, a leader sequence, a sequence encoding the variable region of the light chain, a sequence encoding the constant region of the light chain, and an enzyme cleavage site sequence Xho I, in that order.

In one embodiment of the present invention, the kappa chain has the light chain constant region with the amino acid sequence shown in SEQ ID NO. 15 (the nucleotide sequence shown in SEQ ID NO. 16), and the first cleavage site is Sac I.

In one embodiment of the invention, the amino acid sequence of the light chain constant region of the lambda chain is shown in SEQ ID NO:17 (the nucleotide sequence is shown in SEQ ID NO:18), wherein the first enzyme cutting site is EcoR I.

In one embodiment of the present invention, the amino acid sequence of the leader sequence is shown as SEQ ID NO:19 (the nucleotide sequence is shown as SEQ ID NO: 20).

The invention also claims an expression vector and a cell containing the gene sequence or expressing the antibody.

The invention has the beneficial effects that:

the invention obtains 3 strains of human ZIKV antibody with high neutralizing activity: Z3L1, Z20 and Z23. The 3 strains of antibodies are completely different from the reported ZIKV antibody sequences and are 3 newly discovered antibodies. The binding constants of these three antibodies to ZIKV-E were 5.39. mu.M (Z3L1), 0.16. mu.M (Z20) and 0.44. mu.M (Z23), respectively. Three humanized antibodies all have strong ZIKV neutralizing activity. Also, Z3L1, Z20 and Z23 may completely or partially protect mice from lethal doses of ZIKV. The three-strain humanized antibody has the application value of clinical treatment and prevention of ZIKV.

Drawings

FIG. 1: ZIKV-E protein purification molecular sieve and SDS-PAGE results;

FIG. 2: Z3L1 purified Protein A (A) and molecular sieve chromatography (B);

FIG. 3: z20 purified Protein A (A) and molecular sieve chromatography (B);

FIG. 4: z23 purified Protein A (A) and molecular sieve chromatography (B);

FIG. 5: kinetic curves for Z20(a), Z23(B), and Z3L1(C and D) with ZIKV-E;

FIG. 6: neutralization curves of antibody to C6/36 amplified ZIKV;

FIG. 7: neutralization curves of antibodies against Vero-amplified ZIKV;

FIG. 8: protective effect of three antibodies on infected ZIKV mice; a is the survival rate of the mice and B is the change in body weight of the surviving mice.

Detailed Description

Example 1: expression and purification of Zika E protein

The ZIKV E (amino acid sequence shown in SEQ ID NO:21 and nucleotide sequence shown in SEQ ID NO: 22) extracellular region DNA fragment was digested with NdeI and XhoI, and then ligated to pET21a vector. Wherein the 3' end of the ZIKV E protein coding region is connected with a coding sequence of 6 histidine tags (hexa-His-tag) and a translation termination codon. The ligation product was then transformed into BL21 E.coli competent cells. The single clone was inoculated into 40mL of LB medium and cultured for 6-8 hours. Inoculated into 4L of LB medium, cultured at 37 ℃ until OD600 becomes 0.4-0.6, IPTG was added to a final concentration of 1mM, and the culture was continued at 37 ℃ for 4-6 hours. The inclusion bodies were harvested and renatured by dilution. The renaturation solution is changed into 20mM Tris, 150mM NaCl and pH8.0 buffer solution after being concentrated. The concentrated protein solution was further purified by size exclusion chromatography using AKTA-purifier (GE) and superdex200Hiload 16/60 column (GE) using buffer A (20mM Tris, 150mM NaCl, pH8.0) while monitoring the UV absorbance at 280nm, to recover the protein of interest and to identify the protein purity by SDS-PAGE. The results are shown in FIG. 1.

Example 2: isolation of ZIKV-E protein specific memory B cells

With patient informed consent, 15mL of blood was collected and PBMCs were isolated. Isolating the PBMCs at 10⁷density/mL was combined with incubation on ice for half an hour of ZIKV-E protein at a final concentration of 100nM, followed by washing 2 times with PBS and incubation with the following antibodies: anti-human CD3/PE-Cy5, anti-human CD16/PE-Cy5, anti-human CD235a/PE-Cy5, anti-human CD19/APC-Cy7, anti-human CD27/Pacific Blue, anti-human CD38/APC, anti-human IgG/FITC, and anti-His/PE. After half an hour incubation on ice, the antibodies were washed 2 times with PBS.

PE-Cy5 collected by FACSAria III sorting^-APC^-APC-Cy7⁺Pacific Blue⁺FITC⁺PE⁺The cells of (4) were collected directly into a 96-well plate at 1 cell/well.

Example 3: single B cell PCR, sequence analysis and design of humanized antibody

The B cells obtained in example 2 were reverse-transcribed by Superscript III reverse transcriptase (Invitrogen) primers shown in Table 1 (sequences shown by SED ID No.23 to SED ID No. 30), and reacted at 55 ℃ for 60 min.

TABLE 1 reverse transcription primers

Using this reverse transcription product as a template, PCR was performed using HotStar Tap Plus enzyme (QIAgen) to amplify an antibody variable region sequence (PCRa). Designing corresponding primers, wherein the reaction conditions are as follows: 95 ℃ for 5 min; 95 ℃ 30s, 55 ℃ (heavy chain/kappa chain)/50 ℃ (lambda chain) 30s, 72 ℃ 90s, 35 cycles; 72 ℃ for 7 min. This was used as a template for 1 additional round of PCR (PCRb) under the following conditions: 95 ℃ for 5 min; 95 ℃ 30s, 58 ℃ (heavy chain)/60 ℃ (kappa chain)/64 ℃ (lambda chain) 30s, 72 ℃ 90s, 35 cycles; 72 ℃ for 7 min.

1.2% agarose gel electrophoresis, and separating the PCR product. The size of the band is 400-500bp after the gel cutting recovery, and the band is sent to a sequencing company for sequencing. Sequencing results were analyzed using IMGT online software.

Analysis of the correct variable region sequence and the corresponding heavy chain/kappa chain/lambda chain constant region through bridging PCR connection, cloned into the expression vector pCAGGS. Wherein the heavy chain is linked to the lambda chain with EcoRI and XhoI and the kappa chain is linked to XhoI with SacI. B cell sequencing and expression plasmid construction were as follows:

the human antibody design strategy is as follows:

heavy chain: CMV promoter-EcoR I-Leader sequences-heavy chain variable region-C_H-Xho I；

Light chain (κ): CMV promoter-Sac I-Leader sequences-light chain variable region-C_L(κ)-Xho I；

Light chain (λ): CMV promoter-EcoR I-Leader sequences-light chain variable region-C_L(λ)-Xho I。

Wherein, the amino acid sequence of the Leader sequences is shown as SEQ ID NO:19 (the nucleotide sequence is shown as SEQ ID NO: 20).

Example 4: expression and purification of antibodies

293T cells were cultured in DMEM with 10% FBS. 293T was co-transfected with plasmids containing genes encoding the light and heavy chains of the specific antibodies. And (3) after 4-6 hours of transfection, continuously culturing the cells in serum-free DMEM for 3 days, collecting the supernatant, supplementing the DMEM, culturing for 4 days, and collecting the supernatant.

The collected supernatant was centrifuged at 5000rpm for 30min, mixed with an equal volume of buffer containing 20mM sodium phosphate (pH 8.0), filtered through a 0.22 μm filter and bound to a protein A pre-column (5mL, GE Healthcare). Bound protein was eluted with 10mM glycine (pH 3.0). The protein is collected, concentrated and then subjected to molecular sieve chromatography. The peak of interest was determined by SDS-PAGE and the results are shown in FIGS. 2, 3 and 4, indicating that the target protein was normally expressed.

Finally, three antibodies Z3L1, Z20, and Z23 that bind to ZIKV E protein and have strong neutralizing activity were obtained.

Wherein the amino acid sequence of the heavy chain variable region of Z3L1 is SEQ ID NO:1 (the nucleotide sequence is shown as SEQ ID NO:7) and the amino acid sequence of the light chain variable region is SEQ ID NO:2 (the nucleotide sequence is shown as SEQ ID NO: 8). The light chain of Z3L1 is of the lambda type, the light chain constant region C_L(λ)Has the amino acid sequence of SEQ ID NO:17 (the nucleotide sequence is shown as SEQ ID NO:18)

The amino acid sequence of the heavy chain variable region of Z20 is SEQ ID NO.3 (the nucleotide sequence is shown as SEQ ID NO. 9) and the amino acid sequence of the light chain variable region is SEQ ID NO. 4 (the nucleotide sequence is shown as SEQ ID NO. 10), the amino acid sequence of the heavy chain variable region of Z23 is SEQ ID NO. 5 (the nucleotide sequence is shown as SEQ ID NO. 11) and the amino acid sequence of the light chain variable region is SEQ ID NO. 6 (the nucleotide sequence is shown as SEQ ID NO. 12). The light chains of Z20 and Z23 are both kappa-type, the constant region C of the light chain_L(κ)Has the amino acid sequence of SEQ ID NO:15 (the nucleotide sequence is shown as SEQ ID NO:16)

The heavy chain constant region C of the antibodies Z3L1, Z20, Z23_HThe amino acid sequence of (A) is SEQ ID NO:13 (the nucleotide sequence is shown as SEQ ID NO: 14).

Sequence alignment with the reported human antibody with neutralizing ZIKV activity found three human antibodies of the invention: the heavy chains of Z20(IGVH 4-4 × 02-IGVD 3-3 × 01-IGVJ 4 × 02) and Z3L1(IGVH 3-30-3 × 03-IGVD6-13 × 01-IGVJ 4 × 02) have unique V-D-J gene rearrangement patterns; there were 3 strains of antibodies using the same IGVH germline gene as Z23, as shown in Table 2. However, the IGVD germline genes used by the 4-strain antibodies were all different, and had homologies with the amino acid sequence of Z23 of only 88.24, 84.3 and 90.76%, respectively.

TABLE 2 ZIKV neutralizing antibody comparison with the same IGVH Gene as Z23

Example 5: performance testing of human antibodies

(1) Detection of binding capacity of surface plasma resonance technology and ZIKV-E

Surface plasmon resonance analysis was performed using Biacore T100(Biacore Inc.). The method comprises the following specific steps:

first, an antibody against anti-human IgG was immobilized in a manner of amino coupling to channels (flowcells, Fc)1 and Fc2 of a CM5 chip. The fixed amount is controlled around a response value (RU) of 10,000. The channel was adjusted to Fc2, and then the purified antibody was bound by antibody capture, at which time the flow rate was controlled at 10. mu.L/min, the sample was injected for 1min, and the antibody capture was around 100 RU. And diluting ZIKV-E protein by 10mM HEPES, 150mM NaCl and pH 7.4 solution at a multiple ratio, adjusting the flow rate to 30 mu L/min, adjusting the channel to Fc2-Fc1 mode, and loading ZIKA-E protein one by one from low concentration. The curves constitute the kinetic curves shown in figure 5. The results are shown in Table 3. The calculation of binding kinetic constants was performed using BIAevaluationsoftware T100(Biacore, Inc.). The results of SPR revealed that all three antibodies were able to bind to the ZIKV-E protein with a dissociation constant of 0.16. mu.M to 5.39. mu.M.

TABLE 3 kinetic constants for binding of humanized antibodies to ZIKV E proteins

(2) Neutralization test

The purified antibody was diluted 3-fold, mixed with 1:150 diluted ZIKV (C6/36 or Vero amplification) and incubated at 37 ℃ for 60 minutes. The mixture was then added to 24-well plates, 300. mu.L/well, which had been plated with Vero cells. After incubation at 37 ℃ for 1 hour, each well was supplemented with 1mL of medium (DMEM, 10% FBS), and incubation was continued for 30 hours before staining. The cells were collected, treated with 4% paraformaldehyde, 0.05% soponin in PBS, and left on ice in the dark for 30 min. The cells were then washed 2 times with solution (PBS, 1% BSA, 0.01% soponin), incubated with 2. mu.g/mL Z1 antibody on ice for 30min, washed 2 times with solution, and incubated with 1:200 diluted anti-human IgG on ice for 30 min. After washing 2 times with the solution, the positive proportion of cells was determined by FACSCANTO. The neutralizing capacity of the antibody to ZIKV was calculated based on the positive ratio at different concentrations, with results as shown in fig. 6 and 7, and statistics of results as shown in table 4.

TABLE 4 neutralizing effect of three antibodies against different sources of viruses

^aA semi-inhibitory concentration;^bcoefficient of determination

(3) Animal protection test

Type I Interferon receptor (Interferon αβ R) knockout mice (B6.129S2-Ifnar1<tm1Agt>/Mmjax, Jackson Laboratories) in groups of 3-5.1 1 × 10 per mouse was intraperitoneally injected⁶ZIKV (GenBank access number: KX087101.2) by PFU. A single dose of 10mg/kg antibody Z3L1, Z20, Z23 or an equal volume of PBS 24 hours after infection was injected intraperitoneally into infected mice. Survival and weight changes of mice over 14 days were recorded. Mice that changed more than 20% in body weight or developed signs of paralysis were sacrificed. The results are shown in FIG. 8. As can be seen from fig. 8, 3 mice injected with PBS all died 7 days after infection, and 4 of 5 mice injected with control antibody 2G4 also died 8 days after infection (fig. 8A). In contrast, three mice each injected with Z3L1 and Z23 antibodies survived (fig. 8A) and the body weight was still in growth (fig. 8B), four of the 5 mice injected with Z20 antibody also survived and the surviving four mice also underwent weight gain. The results of this set of experiments show that three human monoclonal antibodies can completely (Z3L1 and Z23) or partially (Z20) treat ZIKV infected mice in mice.

At present, the published treatment of ZIKV infection in mouse modelsThe human antibody only has one strain, namely ZKA64, and the binding capacity of the human antibody and ZIKV-E is half maximum effect concentration EC₅₀65ng/mL, half inhibitory concentration IC₅₀0.155. mu.g/mL. IC of three humanized antibodies in this experiment₅₀0.17 to 0.89. mu.g/mL. In addition, in animal protection experiments, the dosage of the antibody used in the invention is 10mg/kg, which is far less than the antibody dosage 15mg/kg of ZKA64 reported in the literature. The three antibodies of the invention provide more novel antibodies against different epitopes for preventing RNA virus from mutating under antibody pressure.

In conclusion, 3 strains of humanized high-neutralization activity ZIKV antibody are obtained by screening memory B cells specifically bound with ZIKV-E of rehabilitation patients: Z3L1, Z20 and Z23. The 3 antibodies are completely different from the reported Zika antibody sequences and are 3 newly discovered antibodies. The binding constants of these three antibodies to ZIKV-E were 5.39. mu.M (Z3L1), 0.16. mu.M (Z20) and 0.44. mu.M (Z23), respectively. The three humanized antibodies all have strong neutralizing activity to Zika virus. Also, Z3L1, Z20 and Z23 may completely or partially protect mice from challenge with a lethal dose of zika virus. This suggests that the three humanized antibodies have application value in clinical treatment and prevention of Zika.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> institute of microbiology of Chinese academy of sciences

<120> high-neutralization-activity humanized monoclonal antibody of Zika virus and application thereof

<160>30

<170>PatentIn version 3.3

<210>1

<211>127

<212>PRT

<213> Artificial sequence

<400>1

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Ser Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp His Leu Gly Trp Ser Ser Ile Trp Ser Ala Pro Glu Ser

100 105 110

Phe Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210>2

<211>115

<212>PRT

<213> Artificial sequence

<400>2

Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln

1 5 10 15

Lys Val ThrIle Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn

20 25 30

Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu

35 40 45

Ile Tyr Asp Ser Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln

65 70 75 80

Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Ser Ser Leu

85 90 95

Ser Val Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln

100 105 110

Pro Lys Ala

115

<210>3

<211>119

<212>PRT

<213> Artificial sequence

<400>3

Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly

1 5 10 15

Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser

20 25 30

Asn Trp Trp Ser Trp Val ArgGln Pro Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu

50 55 60

Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser

65 70 75 80

Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Arg Asp Asp Leu Ser Pro Phe Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210>4

<211>110

<212>PRT

<213> Artificial sequence

<400>4

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp

20 25 30

Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile

35 40 45

Tyr Ala Ala Ser Ser Leu Gln SerGly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Arg

85 90 95

Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val

100 105 110

<210>5

<211>121

<212>PRT

<213> Artificial sequence

<400>5

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr

20 25 30

Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe

50 55 60

Glu Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Thr Gly Ile Ala Ala Ala Gly Phe Val Phe Asp Tyr Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>6

<211>109

<212>PRT

<213> Artificial sequence

<400>6

Asp Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ile Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Trp Thr

8590 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val

100 105

<210>7

<211>381

<212>DNA

<213> Artificial sequence

<400>7

gaggttcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60

tcctgtgcag cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct 120

ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtaa taaatactac 180

gcagactccg tgaagggccg attcaccatc tccagagaca attccaagag cacgctgtat 240

ctgcaaatga acaacctgag agctgaagac acggctgtgt attactgtgc gagagatcat 300

cttggttgga gcagcatctg gagcgccccc gagagctttc ttgactactg gggccaggga 360

accctggtca ccgtctcctc a 381

<210>8

<211>345

<212>DNA

<213> Artificial sequence

<400>8

cagtctgtgc tcacccagcc acctagcgtg tccgccgccc ctggccagaa ggtgacaatt 60

tcttgcagcg gctcttctag caacattggc aacaactacg tttcttggta tcagcagctg 120

cccggcaccg cccctaagct gctgatctat gactctaaca agagaccatc tggcattccc 180

gacagattca gcggctctaa gtccggcaca tccgccacac tgggcattac aggccttcaa 240

acaggcgacg aggccgacta ctactgcggc acatgggact cttctctgtc cgtgtgggtg 300

ttcggcggcg gcaccaagct gacagtgctg ggccagccaa aggcc 345

<210>9

<211>357

<212>DNA

<213> Artificial sequence

<400>9

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggggac cctgtccctc 60

acctgcgctg tctctggtgg ctccatcagc agtagtaact ggtggagttg ggtccgccag 120

cccccaggga aggggctgga gtggattggg gaaatctatc atagtgggag caccaactac 180

aacccgtccc tcaagagtcg agtcaccata tcagtagaca agtccaagaa ccagttctcc 240

ctgaagctga gctctgtgac cgccgcggac acggccgtgt attactgtgc gagagatcgg 300

gacgatttga gcccctttga ctactggggc cagggaaccc tggtcaccgt ctcctca 357

<210>10

<211>330

<212>DNA

<213> Artificial sequence

<400>10

gacatcgtga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggcaagtca gggcattaga aatgatttag gctggtatca gcagaaacca 120

gggaaagccc ctaagcgcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180

aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct 240

gaagattttg caacttatta ctgtctacag cataatagtt accctcggac gttcggccaa 300

gggaccaagg tggaaatcaa acgcaccgtg 330

<210>11

<211>363

<212>DNA

<213> Artificial sequence

<400>11

caggtgcagc tggtrcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60

tcctgcaagg cttctggata caccttcacc ggctactata tgcactgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggacgg atcaacccta acagtggtgg cacaaactat 180

gcacagaagt ttgagggcag ggtcaccatg accagggaca cgtccatcag cacagcctac 240

atggagctga gcaggctgag atctgacgac acggccgtgt attactgtgc gagaacgggt 300

atagcagcag ctggtttcgt ctttgactac tggggccagg gaaccctggt caccgtctcc 360

tca 363

<210>12

<211>327

<212>DNA

<213> Artificial sequence

<400>12

gacatcgtga tgacccagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60

ctctcctgca gggccagtca gagtgttatc agcaacttag cctggtacca gcagaaacct 120

ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc 180

aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct 240

gaagattttg cagtttatta ctgtcagcag tataataact ggtggacgtt cggccaaggg 300

accaaggtgg aaatcaaacg caccgtg 327

<210>13

<211>330

<212>PRT

<213> Artificial sequence

<400>13

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys

1 5 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr

65 70 75 80

Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys

100 105 110

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

115 120 125

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

130 135 140

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

145 150 155 160

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

165 170 175

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

180 185 190

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

195 200 205

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

210 215 220

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu

225 230 235 240

Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

245 250 255

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

260 265 270

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

275 280 285

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

290 295 300

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

305 310 315 320

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

325 330

<210>14

<211>993

<212>DNA

<213> Artificial sequence

<400>14

gcgagcacca aaggcccgag cgtgtttccg ctggcgccga gcagcaaaag caccagcggc 60

ggcaccgcgg cgctgggctg cctggtgaaa gattattttc cggaaccggt gaccgtgagc 120

tggaacagcg gcgcgctgac cagcggcgtg catacctttc cggcggtgct gcagagcagc 180

ggcctgtata gcctgagcag cgtggtgacc gtgccgagca gcagcctggg cacccagacc 240

tatatttgca acgtgaacca taaaccgagc aacaccaaag tggataaacg cgtggagccc 300

aaatcttgtg acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga 360

ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct 420

gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 480

tacgtggacg gcgtggaggt gcataatgcc aagacaaagc cgcgggagga gcagtacaac 540

agcacgtacc gtgtggtcag cgtcctcacc gtcctgcacc aggactggct gaatggcaag 600

gagtacaagt gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 660

aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcccccatc ccgggatgag 720

ctgaccaaga accaggtcag cctgacctgcctggtcaaag gcttctatcc cagcgacatc 780

gccgtggagt gggagagcaa tgggcagccg gagaacaact acaagaccac gcctcccgtg 840

ctggactccg acggctcctt cttcctctac agcaagctca ccgtggacaa gagcaggtgg 900

cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg 960

cagaagagcc tctccctgtc tccgggtaaa tga 993

<210>15

<211>105

<212>PRT

<213> Artificial sequence

<400>15

Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys

1 5 10 15

Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg

20 25 30

Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn

35 40 45

Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser

50 55 60

Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys

65 70 75 80

Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr

85 90 95

Lys Ser Phe Asn Arg Gly Glu Cys Ser

100 105

<210>16

<211>318

<212>DNA

<213> Artificial sequence

<400>16

gctgccccca gcgtgtttat cttccctccc agcgacgagc agctgaagag cggcaccgcc 60

agcgtggtct gtctcctgaa caacttctat cccagggagg ccaaggtcca gtggaaagtg 120

gacaacgccc tgcaaagcgg caatagccag gagtccgtca cagagcagga cagcaaggac 180

agcacctaca gcctgtccag caccctgacc ctcagcaagg ccgactacga gaagcacaag 240

gtgtacgctt gcgaggtgac ccatcagggc ctgtccagcc ccgtgaccaa gtccttcaac 300

aggggcgaat gcagctaa 318

<210>17

<211>101

<212>PRT

<213> Artificial sequence

<400>17

Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala

1 5 10 15

Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala

20 25 30

Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val

35 40 45

Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser

50 55 60

Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Arg Ser Tyr

65 70 75 80

Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr Val Ala

85 90 95

Pro Thr Glu Cys Ser

100

<210>18

<211>306

<212>DNA

<213> Artificial sequence

<400>18

gcccctagcg tgacactgtt ccctccatct agcgaagaac tgcaagctaa caaagccaca 60

ctcgtgtgcc tcattagcga cttctaccct ggcgccgtga ccgtggcctg gaaagcggac 120

tcctctccag tgaaggccgg cgtggagaca accaccccat ccaagcagtc taacaacaag 180

tacgccgcct cttcctacct gagcctcaca cctgagcagt ggaagtctca caggtcctac 240

tcttgccagg tgacccacga gggctccaca gtggaaaaaa ccgtggcccc aaccgagtgc 300

agctga 306

<210>19

<211>21

<212>PRT

<213> Artificial sequence

<400>19

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asp

20

<210>20

<211>63

<212>DNA

<213> Artificial sequence

<400>20

atggagacgg atacgctgct cctgtgggtt ttgctgctgt gggttccagg ttccactggt 60

gac 63

<210>21

<211>409

<212>PRT

<213> Artificial sequence

<400>21

Ile Arg Cys Ile Gly Val Ser Asn Arg Asp Phe Val Glu Gly Met Ser

1 5 10 15

Gly Gly Thr Trp Val Asp Val Val Leu Glu His Gly Gly Cys Val Thr

20 25 30

Val Met Ala Gln Asp Lys Pro Thr Val Asp Ile Glu Leu Val Thr Thr

35 40 45

Thr Val Ser Asn Met Ala Glu Val Arg Ser Tyr Cys Tyr Glu Ala Ser

50 55 60

Ile Ser Asp Met Ala Ser Asp Ser Arg Cys Pro Thr Gln Gly Glu Ala

65 70 75 80

Tyr Leu Asp Lys Gln Ser Asp Thr Gln Tyr Val Cys Lys Arg Thr Leu

85 9095

Val Asp Arg Gly Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys Gly Ser

100 105 110

Leu Val Thr Cys Ala Lys Phe Ala Cys Ser Lys Lys Met Thr Gly Lys

115 120 125

Ser Ile Gln Pro Glu Asn Leu Glu Tyr Arg Ile Met Leu Ser Val His

130 135 140

Gly Ser Gln His Ser Gly Met Ile Val Asn Asp Thr Gly His Glu Thr

145 150 155 160

Asp Glu Asn Arg Ala Lys Val Glu Ile Thr Pro Asn Ser Pro Arg Ala

165 170 175

Glu Ala Thr Leu Gly Gly Phe Gly Ser Leu Gly Leu Asp Cys Glu Pro

180 185 190

Arg Thr Gly Leu Asp Phe Ser Asp Leu Tyr Tyr Leu Thr Met Asn Asn

195 200 205

Lys His Trp Leu Val His Lys Glu Trp Phe His Asp Ile Pro Leu Pro

210 215 220

Trp His Ala Gly Ala Asp Thr Gly Thr Pro His Trp Asn Asn Lys Glu

225 230 235 240

Ala Leu Val Glu Phe Lys Asp Ala His Ala Lys Arg Gln Thr Val Val

245 250 255

Val Leu Gly Ser Gln Glu Gly Ala Val His Thr Ala Leu Ala Gly Ala

260 265 270

Leu Glu Ala Glu Met Asp Gly Ala Lys Gly Arg Leu Ser Ser Gly His

275 280 285

Leu Lys Cys Arg Leu Lys Met Asp Lys Leu Arg Leu Lys Gly Val Ser

290 295 300

Tyr Ser Leu Cys Thr Ala Ala Phe Thr Phe Thr Lys Ile Pro Ala Glu

305 310 315 320

Thr Leu His Gly Thr Val Thr Val Glu Val Gln Tyr Ala Gly Thr Asp

325 330 335

Gly Pro Cys Lys Val Pro Ala Gln Met Ala Val Asp Met Gln Thr Leu

340 345 350

Thr Pro Val Gly Arg Leu Ile Thr Ala Asn Pro Val Ile Thr Glu Ser

355 360 365

Thr Glu Asn Ser Lys Met Met Leu Glu Leu Asp Pro Pro Phe Gly Asp

370 375 380

Ser Tyr Ile Val Ile Gly Val Gly Glu Lys Lys Ile Thr His His Trp

385 390 395 400

His Arg Ser Gly Ser Thr Ile Gly Lys

405

<210>22

<211>1233

<212>DNA

<213> Artificial sequence

<400>22

atgattcgct gcattggcgt gagcaatcgc gactttgttg aaggcatgag cggtggcacc 60

tgggtggatg tggtgctgga acacggcggt tgcgtgaccg ttatggccca ggataagccg 120

acagtggaca tcgaactggt taccaccaca gtgagcaaca tggccgaggt tcgtagctac 180

tgctatgagg ccagcatcag cgacatggcc agtgacagtc gctgcccgac acagggcgag 240

gcctatctgg acaaacagag cgacacccag tacgtttgta aacgcaccct ggtggaccgt 300

ggttggggca atggttgtgg tctgtttggt aagggcagcc tggtgacctg cgccaaattc 360

gcctgcagca agaaaatgac cggcaagagc atccagccgg aaaacctgga gtaccgcatt 420

atgctgagcg tgcatggcag ccagcatagc ggcatgattg tgaacgacac cggtcatgag 480

accgatgaaa accgcgccaa agtggaaatc accccgaata gtcctcgtgc agaagccacc 540

ctgggcggtt ttggtagcct gggcctggat tgcgagcctc gtaccggtct ggattttagt 600

gatctgtatt acctgaccat gaataacaaa cattggctgg ttcacaagga atggttccac 660

gacatccctc tgccgtggca tgcaggtgca gataccggca caccgcattg gaacaacaaa 720

gaggccctgg tggagttcaa agatgcccac gcaaaacgcc agaccgttgt ggttctgggt 780

agtcaggaag gtgccgttca taccgcactg gccggtgccc tggaagccga aatggacggc 840

gccaaaggcc gcctgagcag tggtcatctg aaatgccgtc tgaagatgga caagctgcgc 900

ctgaagggcg tgagttacag tctgtgtacc gccgccttca ccttcaccaa gattcctgcc 960

gagaccctgc atggtacagt gaccgtggag gtgcagtatg caggtaccga tggtccgtgc 1020

aaagtgccgg cccagatggc cgtggacatg cagaccttaa ccccggtggg ccgcctgatt 1080

accgccaatc cggttattac cgaaagcacc gaaaacagca aaatgatgct ggaactggac 1140

cctccgtttg gcgatagcta catcgtgatt ggcgtgggtg agaagaagat cacacaccac 1200

tggcaccgta gcggcagtac catcggtaag taa 1233

<210>23

<211>20

<212>DNA

<213> Artificial sequence

<400>23

atggagtcgg gaaggaagtc 20

<210>24

<211>19

<212>DNA

<213> Artificial sequence

<400>24

tcacggacgt tgggtggta 19

<210>25

<211>19

<212>DNA

<213> Artificial sequence

<400>25

tcacggaggt ggcattgga 19

<210>26

<211>19

<212>DNA

<213> Artificial sequence

<400>26

caggcgatga ccacgttcc 19

<210>27

<211>19

<212>DNA

<213> Artificial sequence

<400>27

catgcgacga ccacgttcc 19

<210>28

<211>20

<212>DNA

<213> Artificial sequence

<400>28

aggtgtgcac gccgctggtc 20

<210>29

<211>20

<212>DNA

<213> Artificial sequence

<400>29

gcaggcacac aacagaggca 20

<210>30

<211>17

<212>DNA

<213> Artificial sequence

<400>30

aggccactgt cacagct 17

Claims

1. An antibody, wherein the amino acid sequence of the heavy chain variable region of the antibody is SEQ ID NO. 5 and the amino acid sequence of the light chain variable region of the antibody is SEQ ID NO. 6.

2. The antibody of claim 1, wherein the heavy chain of said antibody comprises a heavy chain variable region and a heavy chain constant region, wherein the amino acid sequence of the heavy chain constant region is set forth in SEQ ID NO. 13.

3. The antibody of claim 1, wherein the light chain of the antibody is a kappa chain and/or a lambda chain; the light chain comprises a light chain variable region and a light chain constant region; the amino acid sequence of the light chain constant region of the kappa chain is shown in SEQ ID NO. 15, and the amino acid sequence of the light chain constant region of the lambda chain is shown in SEQ ID NO. 17.

4. A pharmaceutical composition comprising the antibody of any one of claims 1 to 3.

5. Use of the antibody of any one of claims 1 to 3 for the manufacture of a medicament for the treatment and/or prevention of Zika virus.

6. A gene sequence encoding the antibody of any one of claims 1 to 3.

7. The gene sequence of claim 6, wherein the sequence encoding the heavy chain of the antibody in the gene sequence comprises a CMV promoter sequence, an EcoR I cleavage site sequence, a leader sequence, a sequence encoding the heavy chain variable region, a sequence encoding the heavy chain constant region, and an Xho I cleavage site sequence.

8. The gene sequence of claim 6, wherein the sequence of the gene sequence encoding the light chain of the antibody comprises a CMV promoter sequence, a first enzyme cutting site sequence, a leader sequence, a sequence encoding the variable region of the light chain, a sequence encoding the constant region of the light chain, and a Xho I enzyme cutting site sequence.

9. An expression vector comprising the gene sequence of claim 6.

10. A cell comprising the gene sequence of claim 6.

11. An expression vector expressing the antibody of any one of claims 1 to 3.

12. A cell expressing the antibody of any one of claims 1 to 3.