CN110144315B - Halorubrum sp.HRM-150 and method for producing carotenoid by fermenting same - Google Patents
Halorubrum sp.HRM-150 and method for producing carotenoid by fermenting same Download PDFInfo
- Publication number
- CN110144315B CN110144315B CN201910463640.9A CN201910463640A CN110144315B CN 110144315 B CN110144315 B CN 110144315B CN 201910463640 A CN201910463640 A CN 201910463640A CN 110144315 B CN110144315 B CN 110144315B
- Authority
- CN
- China
- Prior art keywords
- hrm
- strain
- fermentation
- carbon source
- collecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a Halorubrum sp.HRM-150 strain and a method for producing carotenoid by using the strain through fermentation, belonging to the technical field of natural carotenoid production. The preservation number of the Halorubrum sp.HRM-150 strain is CGMCC No. 17350. The halofuum sp.HRM-150 strain provided by the invention is extreme halophilic archaea, and is fermented in a continuous fermentation mode, so that the wet weight of the obtained fermented thallus is up to 20g/L, and the pigment content is up to 1.25% ww.
Description
Technical Field
The invention relates to the technical field of natural carotenoid production, and particularly relates to a Halorubrumsp.HRM-150 strain of a salt red bacterium and a method for producing carotenoid by fermenting the Halorubrumsp.HRM-150 strain of the salt red bacterium.
Background
Carotenoids (Carotenoids) are a generic term for two major Carotenoids, the carbon-hydrogen Carotenoids (carotenes) and the oxygen-containing Carotenoids (xanthophylls), generally consisting of 8 isoprenoid units, and appear yellow, orange-red or red. The natural carotenoid mainly comes from plants, animals and microorganisms, can be used as a coloring agent and an antioxidant, and has wide application prospects in the aspects of improving the immunity of organisms, inhibiting the growth of tumor cells and the like.
Lycopene as a rare hydroxylated C in carotenoids50The carotenoid belongs to high-carbon carotenoid, the capability of the bilirubin for removing hydroxyl free radicals is stronger than that of β -carotene, and the antioxidant capability of the lycopene is 50 percent higher than that of β -carotene, but no carotenoid produced by utilizing microbial fermentation is found at presentCarotene is reported.
Disclosure of Invention
The invention aims to provide a Halorubrum sp.HRM-150 strain and a method for producing carotenoid by fermenting the same. The strain provided by the invention can produce carotenoid.
The invention provides a Halorubrum sp.HRM-150 strain with the preservation number of CGMCCNo.17350.
The invention also provides application of the strain in the technical scheme in production of carotenoid.
Preferably, the carotenoids include bilirubin, monoanhydroheverin, lycopene and beta-carotene.
The invention also provides a method for producing carotenoid by the strain in the technical scheme, which comprises the following steps:
1) inoculating Halorubrum sp.HRM-150 strain into a fermentation culture medium for continuous fermentation culture; the fermentation medium contains 1% by mass of a nitrogen source and 1% by mass of a carbon source, and the salinity is 150-250; the conditions of the fermentation culture are as follows: starting the rotation speed of 200rpm, increasing the rotation speed to 400rpm in the logarithmic phase of growth, supplementing a carbon source when the fermentation lasts for 50-54 h, and ending the fermentation within 80-84 h;
2) collecting thalli, and adding distilled water to obtain cell lysate;
3) mixing cell lysate, trichloromethane and methanol in a volume ratio of 1:1:2, shaking, standing for more than 4 hours, collecting a lower organic phase, performing rotary evaporation concentration on the organic phase, and removing residual solvent by using nitrogen.
Preferably, the nitrogen source of step 1) comprises yeast extract and acid hydrolyzed casein.
Preferably, the carbon source of step 1) comprises soluble starch.
Preferably, the step 1) is implemented by supplementing a carbon source with a fermentation medium with a mass fraction of 1%.
Preferably, the conditions for collecting the bacterial cells in step 2) are as follows: centrifuging at 8000rpm at 4 deg.C for 10min, and collecting precipitate.
Preferably, the temperature of the water bath for rotary evaporation concentration in the step 3) is 30-35 ℃, and the rotating speed is 100 rpm.
The invention provides a Halorubrum sp.HRM-150 strain. The HRM-150 strain provided by the invention is an extreme halophilic bacterium, and the HRM-150 strain of the erythrorhizon archaea is fermented in a continuous fermentation mode to obtain a fermented thallus with the wet weight of up to 20g/L and the pigment content of up to 1.25% ww.
Drawings
FIG. 1 shows the colony morphology of HRM-150 provided by the present invention;
FIG. 2 is an electron microscope image of HRM-150 strain provided by the present invention;
FIG. 3 is a HRM-150 phylogenetic tree-growing analysis based on 16S rRNA fragment sequences provided by the present invention;
FIG. 4 is a growth curve of HRM-150 strain provided in example 1 of the present invention under different culture conditions;
FIG. 5 shows the wet weight of the HRM-150 strain provided in example 1 under different culture conditions;
FIG. 6 shows the results of TLC and silica gel column chromatography separation of HRM-150 crude cytochrome extract provided in example 1 of the present invention;
FIG. 7 shows the results of the pigment composition antioxidant level test provided in example 1 of the present invention.
Biological preservation information
Halorubrum sp, the strain number is HRM-150, the preservation place is the China general microbiological culture Collection center, the address is No. 3 of Xilu No.1 of Beijing university and Chaoyang district, the microorganism research institute of Chinese academy of sciences, the preservation time is 2019, 3 and 18 days, and the preservation number is CGMCC No. 17350.
Detailed Description
The invention provides a Halorubrum sp.HRM-150 strain with the preservation number of CGMCCNo.17350.
In the invention, the colony morphology of the halorubium sp.HRM-150 strain is shown in figure 1, and the colony is red, round and smooth; the electron microscope image of the strain is shown in FIG. 2, and the cells are in the form of short rods. In the invention, the 16S rRNA sequence of the Halorubrum sp.HRM-150 strain is shown in SEQ ID NO.1, and the full length of the 16S rRNA gene sequence is as follows:
GATTCGACGTTCGTGGAACGCCTCATCCGGACCTCACTCGGGTGCTTTGACGGGCGGTGTGTGCAAGGAGCAGGGACGTATTCACCGCGCGCTTGTGACACGCGATTACTACCGAATCCAGCTTCATGTGGGCGAGTTGCAGCCCACAATCCGAACTACGATCGAGTTTCTGAGATTACCGTCTCCTTTCGGAGTTGGAACCCTTTGTCTCGACCATTGTAGCCCGCGTGTTGCCCAGCACATTCGGGGCATACTGACCTACCGTTGCCCGTTCCTTCCTCCGTGTTAGCCACGGCGGTCCCCCTACTGTCCCCAGCTACCTCGCGGTACTGCTGGCAAGTAAGGGTGCGGGTCTCGCTCGTTGCCTGACTTAACAGGACGCCTCACGGTACGAGCTGACGGCGGCCATGCACCTCCTCTCTGAAACTCGGACAAGGTCATCAACCTGGTCGTCATTATTACAGTCGATGCTGGTGAGATGTCCGGCGTTGAGTCCAATTAAACCGCAGGCTCCTCCGGTTGTAGTGCTCCCCCGCCAATTCCTTTAAGTTTCATCCTTGCGGACGTACTTCCCAGGCGGTCTGCTTAGCGGCTTCCCTACGGCACAGCACCCACTCGTAGTGGGAGCCACACCTAGCAGACATTGTTTACGGCCAGGACTACCCGGGTATCTAATCCGGTTCGAGACCCTGGCTTTCGTCCCTCACTGTCGGATCCGTCCTCGCGACGTGCTTTCGCCATCGGCGGTCCGTCCAGGATTACGGGATTTCACTCCTACCCCGGACGTACCCGTCGCGCCTTCCGGTCCCAAGCCACGCAGTTTCTACCGGGCGCCCACCTGTTGGGCAGGTGGATTTCCCGATGGACTTGCGCGGCCAGCTACGGACGCTTTAGGCCCAATAAGATCGGCCATCACTTGGGCTGCCGGTATTACCGCGGCGGCTGGCACCGGTCTTGCCCAGCCCTTATTCTGGTACCACCTTACGGTACCGAAAAGCACAGGCGCTATGCCTGTGCACTTGGGATCCCCCTATCGCACTGTCGTGCAGTGTAAAGGTTTCGCGCCTGCTGCGCCCCGTAGGGCCCGGAATCTTGTCTCAGATTCCGTCTCTGGGTTCTCACTCTCATGACCCATACCGATTATTGGCACGGTGGGCCGTTACCCCACCGTCTACCTAATCGGCCGCAGCCACATCCTTCGGCGCCGGAGCGTTTGGCATACCACTCATTCCAGTGGTGGTATGGTATACACTATTAGCCTCAGTTTCCCGAGGGTATTGTGTTCCGAAGGGTAGTTTGGCCACGTGTTACTGAGCTATTCGCCACGAGTCTGAACTCGTGCGAC。
the results of phylogenetic tree analysis based on the 16S rRNA fragment sequences are shown in FIG. 3. And (3) searching a sequence with higher similarity from Genebank, constructing a phylogenetic tree, and finding that the similarity between the Halorubrum sp.HRM-150 strain and four Halorubrum strains in an NCBI database is more than 99.8%.
The invention also provides application of the strain in the technical scheme in production of carotenoid. In the present invention, the carotenoids include lycopene, monoanhydrogenin, lycopene and beta-carotene. Wherein the carotenoid has the highest content of the lycopene.
The invention also provides a method for producing carotenoid by the strain in the technical scheme, which comprises the following steps:
1) inoculating Halorubrum sp.HRM-150 strain into a fermentation culture medium for continuous fermentation culture; the fermentation medium contains 1% by mass of a nitrogen source and 1% by mass of a carbon source, and the salinity is 150-250; the conditions of the fermentation culture are as follows: starting the rotation speed of 200rpm, increasing the rotation speed to 400rpm in the logarithmic phase of growth, supplementing a carbon source when the fermentation lasts for 50-54 h, and ending the fermentation within 80-84 h;
2) collecting thalli, and adding distilled water to obtain cell lysate;
3) mixing cell lysate, trichloromethane and methanol in a volume ratio of 1:1:2, shaking, standing for more than 4 hours, collecting a lower organic phase, performing rotary evaporation concentration on the organic phase, and removing residual solvent by using nitrogen.
The invention inoculates salt red fungus Halorubrum sp.HRM-150 strain into fermentation culture medium for continuous fermentation culture; the fermentation medium contains 1% by mass of a nitrogen source and 1% by mass of a carbon source, and the salinity is 150-250; the conditions of the fermentation culture are as follows: starting the rotation speed of 200rpm, increasing the rotation speed to 400rpm in the logarithmic phase of growth, supplementing a carbon source when the fermentation lasts for 50-54 h, and ending the fermentation within 80-84 h. In the present invention, the nitrogen source includes yeast extract and acid hydrolyzed casein. In the present invention, the carbon source includes soluble starch. In the invention, the carbon source with the mass fraction of 1% of the fermentation medium is supplemented. The Halorubrum sp.HRM-150 strain can grow under the condition of high salt, and the pollution in the fermentation process can be reduced due to higher salinity setting.
After fermentation is finished, the invention collects thalli and adds distilled water to obtain cell lysate. After the distilled water is added, the vibration is preferably carried out, so that the thalli and the distilled water are fully and uniformly mixed, the thalli can be cracked by utilizing osmotic pressure change, and the extraction, the separation and the purification of the pigment are convenient. In the present invention, the conditions for collecting the bacterial cells are preferably: centrifuging at 8000rpm at 4 deg.C for 10min, and collecting precipitate.
After cell lysate is obtained, the cell lysate, trichloromethane and methanol are mixed according to the volume ratio of 1:1:2, the mixture is vibrated and stands for more than 4 hours, a lower organic phase is collected, the organic phase is subjected to rotary evaporation and concentration, and residual solvent is removed by using nitrogen. In the invention, the temperature of the water bath for rotary evaporation concentration is 30-35 ℃, and the rotating speed is 100 rpm.
The halorubium sp.hrm-150 strain and the method for producing carotenoids by fermentation thereof according to the present invention will be described in further detail with reference to the following specific examples, which include, but are not limited to, the following examples.
Example 1
1) Carbon and nitrogen source single factor experiment (96-well plate experiment)
The carbon source used included: soluble starch, sucrose, glucose, lactose; the nitrogen sources include: gelatin, yeast extract and acid hydrolyzed casein (4/3, g/g), the pH of the culture medium is 7.0-7.2, and the culture medium is used after sterilization. The carbon (C) and nitrogen (N) sources included three levels, 0.5%, 1%, and 1.5%, respectively, and were controlled from this group of blank media. The inoculation amount of the thalli is 1 percent.
The Growth of the cells was determined using a Growth curve analyzer (OY Growth cultures FP-1100-C, Finland). The thallus accumulation is carried out in a pore plate matched with the instrument, and 200-400 mu L of culture solution is added into each pore for experiment. The experimental conditions are as follows: detection of OD600And OD494The temperature is 37.0 ℃, the rotation speed is 150rpm, and the time is 6 d. The growth curve results are shown in FIG. 4 (wherein FIG. 4a shows that the strain uses soluble starch as carbon source and yeast extract as yeast extract&The cell growth condition when acid hydrolysis casein and gelatin are used as nitrogen sources; FIG. 4b shows the bacterial strain in yeast extract&Cell growth when acid-hydrolyzed casein was used as a nitrogen source and soluble starch, sucrose, glucose, and lactose were used as carbon sources, respectively).
2) Optimum carbon nitrogen source proportion experiment (500mL shake flask experiment)
According to the above results, the strain HRM-150 was able to exhibit a large amount of growth of the cells in the medium in which soluble starch and yeast extract & acid-hydrolyzed casein were present together. Experimental design orthogonal experiments were performed with the addition amounts of 0.5%, 1%, and 1.5% for the carbon-nitrogen source, respectively. The experiment uses a nitrogen source group without adding carbon source at three levels as a control, and other experiment conditions are not changed.
The thallus is cultured by using a constant temperature shaking table (HMY-211B, Oenon, China). The experimental conditions are as follows: the temperature was 37.0 ℃ and the rotation speed was 150rpm, and the culture was carried out for 12 days. Sampling every 1d, determining OD600. And the wet weight of the cells at the end of the fermentation experiment was determined. The results of the constant cell measurements are shown in FIG. 5 (in FIG. 5a, the effect of different amounts of nitrogen sources on the growth of the strain when no carbon source was added, in FIG. 5b, the effect of different amounts of carbon sources on the growth of the strain when the amount of nitrogen sources was 0.5%, in FIG. 5c, the effect of different amounts of carbon sources on the growth of the strain when the amount of nitrogen sources was 1%, and in FIG. 5d, the effect of different amounts of carbon sources on the growth of the strain when the amount of nitrogen sources was 1.5%).
In the case of no carbon source, the wet weight of HRM-150 cells increased with the increase in the nitrogen source addition ratio, and the wet weight of cells reached the highest value (4.15g/L) in the modified CM medium (i.e., 17.5 g/L). When the nitrogen source addition ratio was 0.5%, the carbon source was added to promote the growth of the cells. When the amount of the carbon source added was 1.5%, the wet weight of the cells reached the maximum (7.30 g/L). When the nitrogen source addition ratio is 1%, the addition of the carbon source similarly promotes the growth of the cells, but the influence of the three levels of the carbon source on the growth of the cells is not very different, and the wet weight of the cells reaches the highest value (8.47g/L) when the 1% carbon source is added. When the nitrogen source addition level was 1.5%, the wet weight of the cells was the highest (8.81g/L) when 1% of the carbon source was added.
In conclusion, in the group without carbon source addition, the increase of the nitrogen source addition level can increase the thallus accumulation amount; the carbon source is added under the same nitrogen source level, the thallus accumulation amount is greatly increased, the thallus accumulation amount is increased along with the increase of the proportion of the added carbon source, and the addition level of the carbon source does not generate great difference to the thallus accumulation amount except for the 1 percent nitrogen source addition group. In consideration of cost, the levels of 1% nitrogen source and 1% carbon source were selected for the mass culture of HRM-150 cells.
3) Fermentation experiment (5L full-automatic continuous fermentation tank)
The optimum carbon-nitrogen ratio is obtained by the experiment, namely the fermentation medium comprises the following components: 10g/L yeast extract and 7.5g/L acid hydrolyzed casein, and the carbon source is selected from soluble starch 10 g/L. Fermentation control conditions: salinity of 150; the initial rotation speed is 200rpm, and the rotation speed gradually increases to 400rpm until the logarithmic growth phase; adding 10g/L soluble starch when the fermentation time reaches 54h, and finishing the fermentation after 84 h. The wet weight of the cells was measured to be 20 g/L.
Collecting thallus at 8000rpm for 10min at 4 deg.C by high-speed refrigerated centrifuge (H-2050R, Hunan apparatus, China), and placing the collected thallus at 4 deg.C for use. The pigment is extracted and then separated by silica gel column chromatography (the result is shown in figure 6), and four main components are separated from HRM-150 cells and are respectively named as R1-R4. The analysis and identification show that the components R1, R2, R3 and R4 are respectively beta-carotene, lycopene, monoanhydrocysteine and bilirubin, and the yield is respectively 7.46, 10.82, 7.45 and 5.36mg/L (shown in Table 1).
Table 1 shows Halorubrum HRM-150 pigment components and contents.
An anti-oxidation experiment (as shown in fig. 7, wherein fig. 7a shows the clearance rate of DPPH free radicals of the pigment component, fig. 7b shows the reducing power of the pigment component, fig. 7c shows the total anti-oxidation power of the pigment component, and fig. 7d shows the ferrous ion chelating capacity of the pigment component) shows that, compared with other pigment components, the clearance rate of the free radicals of the bacteriocin (R4) is the highest, reaches 17.68%, and is higher than that of a positive control to combine into the beta-carotene; the clearance rate of free radicals of the monoanhydro-bilirubin (R3) and Mix is basically equal to that of the beta-carotene of the control group, and the other two components are lower than that of the positive control group; the reducing power of the pigments R1-R4 is higher than that of the positive control group beta-carotene, and the component with the strongest reducing power is R4 which is 0.18; the total antioxidant capacity of the pigment R4 can reach 22.89%, and the total antioxidant capacity of the rest components is not different but lower than that of the R4 component. Pigments R3 and Mix have relatively high ferrous ion chelation capacities, with values of 11.81% and 11.35%, respectively, which are higher than the positive control BHA and BHT groups.
TABLE 1 Halorubrum HRM-150 pigment composition
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Tianjin science and technology university
<120> Halorubrum sp, HRM-150 and method for producing carotenoid by fermenting the same
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1345
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gattcgacgt tcgtggaacg cctcatccgg acctcactcg ggtgctttga cgggcggtgt 60
gtgcaaggag cagggacgta ttcaccgcgc gcttgtgaca cgcgattact accgaatcca 120
gcttcatgtg ggcgagttgc agcccacaat ccgaactacg atcgagtttc tgagattacc 180
gtctcctttc ggagttggaa ccctttgtct cgaccattgt agcccgcgtg ttgcccagca 240
cattcggggc atactgacct accgttgccc gttccttcct ccgtgttagc cacggcggtc 300
cccctactgt ccccagctac ctcgcggtac tgctggcaag taagggtgcg ggtctcgctc 360
gttgcctgac ttaacaggac gcctcacggt acgagctgac ggcggccatg cacctcctct 420
ctgaaactcg gacaaggtca tcaacctggt cgtcattatt acagtcgatg ctggtgagat 480
gtccggcgtt gagtccaatt aaaccgcagg ctcctccggt tgtagtgctc ccccgccaat 540
tcctttaagt ttcatccttg cggacgtact tcccaggcgg tctgcttagc ggcttcccta 600
cggcacagca cccactcgta gtgggagcca cacctagcag acattgttta cggccaggac 660
tacccgggta tctaatccgg ttcgagaccc tggctttcgt ccctcactgt cggatccgtc 720
ctcgcgacgt gctttcgcca tcggcggtcc gtccaggatt acgggatttc actcctaccc 780
cggacgtacc cgtcgcgcct tccggtccca agccacgcag tttctaccgg gcgcccacct 840
gttgggcagg tggatttccc gatggacttg cgcggccagc tacggacgct ttaggcccaa 900
taagatcggc catcacttgg gctgccggta ttaccgcggc ggctggcacc ggtcttgccc 960
agcccttatt ctggtaccac cttacggtac cgaaaagcac aggcgctatg cctgtgcact 1020
tgggatcccc ctatcgcact gtcgtgcagt gtaaaggttt cgcgcctgct gcgccccgta 1080
gggcccggaa tcttgtctca gattccgtct ctgggttctc actctcatga cccataccga 1140
ttattggcac ggtgggccgt taccccaccg tctacctaat cggccgcagc cacatccttc 1200
ggcgccggag cgtttggcat accactcatt ccagtggtgg tatggtatac actattagcc 1260
tcagtttccc gagggtattg tgttccgaag ggtagtttgg ccacgtgtta ctgagctatt 1320
cgccacgagt ctgaactcgt gcgac 1345
Claims (3)
1. The method for producing the carotenoid by the Halorubrumsp.HRM-150 strain, wherein the preservation number of the Halorubrumsp.HRM-150 strain is CGMCC No.17350, comprises the following steps:
1) inoculating Halorubrumsp.HRM-150 strain to a fermentation culture medium for continuous fermentation culture; the fermentation medium contains 1% by mass of a nitrogen source and 1% by mass of a carbon source, and the salinity is 150-250; the conditions of the fermentation culture are as follows: starting the rotation speed of 200rpm, increasing the rotation speed to 400rpm in the logarithmic phase of growth, supplementing a carbon source when the fermentation lasts for 50-54 h, and ending the fermentation within 80-84 h; the nitrogen source is yeast extract and acid hydrolyzed casein; the carbon source is soluble starch; the supplement is to supplement a carbon source with the fermentation medium of which the mass fraction is 1%;
2) collecting thalli, and adding distilled water to obtain cell lysate;
3) mixing cell lysate, trichloromethane and methanol in a volume ratio of 1:1:2, shaking, standing for more than 4 hours, collecting a lower organic phase, performing rotary evaporation concentration on the organic phase, and removing residual solvent by using nitrogen.
2. The method according to claim 1, wherein the conditions for collecting the bacterial cells in step 2) are as follows: centrifuging at 8000rpm at 4 deg.C for 10min, and collecting precipitate.
3. The method as claimed in claim 1, wherein the temperature of the water bath for the rotary evaporation concentration in the step 3) is 30-35 ℃ and the rotating speed is 100 rpm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910463640.9A CN110144315B (en) | 2019-05-30 | 2019-05-30 | Halorubrum sp.HRM-150 and method for producing carotenoid by fermenting same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910463640.9A CN110144315B (en) | 2019-05-30 | 2019-05-30 | Halorubrum sp.HRM-150 and method for producing carotenoid by fermenting same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110144315A CN110144315A (en) | 2019-08-20 |
| CN110144315B true CN110144315B (en) | 2020-09-01 |
Family
ID=67593487
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910463640.9A Active CN110144315B (en) | 2019-05-30 | 2019-05-30 | Halorubrum sp.HRM-150 and method for producing carotenoid by fermenting same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110144315B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112167131B (en) * | 2020-09-30 | 2023-03-10 | 天津科技大学 | Halobacterium rubrum and rhodobacter salina strain and application of strengthened artemia thereof in aquatic seedling raising or aquaculture |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2712919A1 (en) * | 2012-09-27 | 2014-04-02 | Technische Universität Wien | Production of recycling materials using halophilic microorganisms |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110165681A1 (en) * | 2009-02-26 | 2011-07-07 | Massachusetts Institute Of Technology | Light-Activated Proton Pumps and Applications Thereof |
-
2019
- 2019-05-30 CN CN201910463640.9A patent/CN110144315B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2712919A1 (en) * | 2012-09-27 | 2014-04-02 | Technische Universität Wien | Production of recycling materials using halophilic microorganisms |
Non-Patent Citations (1)
| Title |
|---|
| 1株产C50类胡萝卜素极端嗜盐古菌的筛选鉴定及特性分析;刘良森等;《海洋湖沼通报》;20141231(第2期);摘要，第141页第2段至最后1段,2.5节生长最适盐度和pH，2.4节色素提取及其主要成分分析，图3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110144315A (en) | 2019-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109971681B (en) | Fusarium laojiao and application thereof | |
| CN102888351B (en) | Prodigiosin high-producing strain and production method thereof | |
| CN106554931B (en) | Carboxylic acid bacterium bailii and application thereof | |
| CN104651291A (en) | Recombinant strain for producing phenol and application of strain | |
| CN104762247A (en) | A genetic engineering strain for increasing the yield of ascomycin and a constructing method | |
| CN110144315B (en) | Halorubrum sp.HRM-150 and method for producing carotenoid by fermenting same | |
| CN114686407A (en) | Preparation method of lactobacillus acidophilus powder for improving culturable cell content | |
| CN107647010B (en) | Method for performing mixed fermentation on green brick tea by multiple bacteria | |
| CN112251385B (en) | Bacillus licheniformis SCU-E and application thereof | |
| CN103361278B (en) | A kind of Roche Ah too bacterium and adopt this bacterial classification to produce the method for Sclerotium gum fermented liquid | |
| CN113817650B (en) | Pyrazine-producing high-temperature actinomycetes, separation screening and application | |
| CN112646740B (en) | Formate single-cell protein strain MA5 and application thereof | |
| CN112725205B (en) | Saccharomyces strain and screening method and application thereof | |
| US20230250389A1 (en) | Leuconostoc citreum and use thereof in precipitating starch emulsion | |
| CN111808763B (en) | Palmatolyis obovatus yeast for producing carotenoid and application thereof | |
| JP5551354B2 (en) | Method for producing sugar alcohol | |
| CN111518712B (en) | Enterobacter strain and application thereof in synthesis of 2,3-butanediol | |
| CN107058148B (en) | Lactobacillus plantarum strain and application thereof | |
| CN107475306B (en) | Method for preparing lycopene and lycopene product | |
| CN105219666B (en) | Symbiotic bacteria system and method for producing butanol under micro-aerobic conditions | |
| CN115322910B (en) | Russell yeast and mutagenesis screening method and application thereof | |
| CN105733951B (en) | Chlorella capable of producing grease and application thereof | |
| CN114015594B (en) | Bacillus tokyo and application thereof | |
| CN113249248B (en) | Gordonia melanodendri, application and pigment production method | |
| CN111100901B (en) | Method for producing 1, 3-propylene glycol by glycerol fermentation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder |
Address after: No.9, 13th Street, economic and Technological Development Zone, Binhai New Area, Tianjin Patentee after: Tianjin University of Science and Technology Address before: No.1038 Dagu South Road, Hexi District, Tianjin 300450 Patentee before: Tianjin University of Science and Technology |
|
| CP02 | Change in the address of a patent holder |