CN110129320A - A kind of method obtaining gene editing sheep and its dedicated sgRNA and Oligo DNA - Google Patents
A kind of method obtaining gene editing sheep and its dedicated sgRNA and Oligo DNA Download PDFInfo
- Publication number
- CN110129320A CN110129320A CN201910187375.6A CN201910187375A CN110129320A CN 110129320 A CN110129320 A CN 110129320A CN 201910187375 A CN201910187375 A CN 201910187375A CN 110129320 A CN110129320 A CN 110129320A
- Authority
- CN
- China
- Prior art keywords
- sequence
- sgrna
- fecb
- sheep
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of method of specific mutations FecB gene acquisition gene editing sheep mediated with RNA and its dedicated sgRNA and Oligo DNA, the system of targeting modification sheep FecB gene that can be special includes two sgRNA and three Oligo DNA sequence dnas, wherein, two sgRNA are sgRNAFecB- 1 and sgRNAFecB- 2, it is the RNA or RNA with the sequence shown in the nucleotide of the sequence 3 and 4 of sequence table;The sequence 5,6 and 7 or the DNA with the sequence that three Oligo DNA sequence dnas are sequence table.SgRNA and Oligo DNA specificity provided by the invention it is higher and can accurate targeting modification sheep FecB gene, realize gene mutation;Cell and Individual identification after facilitating gene editing.Ewe litter size can effectively be increased simultaneously.
Description
Technical field
The invention belongs to animal genetic engineering fields, are related to CRISPR/Cas9 technology, and in particular to one kind is mediated with RNA
Specific mutations FecB gene obtain gene editing sheep method and its dedicated sgRNA and Oligo DNA.
Background technique
The reproductive performance of sheep has the quantitative character of highly important Ji value, the choosing to sheep litter size to sheep husbandry
The limitation not only by gender and age is selected, and sheep litter size is the very low quantitative character of a genetic force, genetic force only has
0.1 or so, therefore be difficult to improve litter size character with conventional breeding technique.FecB(fecudity booroola) be
The autosome that can increase number of eggs ovulated and litter size found in Bu Lula merino (Booroola Merino) sheep is prominent
Become gene, is first Major Genes for High Prolificacy identified in sheep.FecB gene is positioned to No. 6 chromosomes of sheep
The upper section corresponding to human chromosome 4q22-23, BMPR-IB gene are located at the section.In sheep body, BMPR-IB gene master
It to be expressed in reproductive organs, in situ hybridization research discovery gene specifically expressing in egg mother cell and granular cell.FecB base
Because A746G causes the gene protein the 249th glutamine (Q) to sport arginine (R), the lambing of sheep is dramatically increased
Performance.The ewe litter size for carrying a FecB gene mutation copy increases by 0.9~1.2, carries the mother of 2 mutant copies
Sheep litter size increases by 1.1~1.7, which, in additive effect, is that current molecular selection polyembryony is continuous
The major gene resistance of sheep strain.The most apparent physiological effect of FecB gene is the follicle number and number of eggs ovulated increased in ovary, but homozygous
Sub (BB) ewe and the graaffian follicle of heterozygote (B+) ewe and the follicular diameter of discharge are than noncarrier (++) ewe ovarian follicle
Diameter is small.Although FecB gene can increase number of eggs ovulated, mechanism of action is not fully understood, and research finds FecB gene
Carrier and noncarrier are completely the same in phenotype, and oestrous cycle length is consistent, the peak the LH interval from heat to ovulation
Time also indifference, but there were significant differences for FSH concentration, and the features such as FecB gene carrier's testosterone levels are relatively high.
In recent years, scientists have invented genome editor's new technology based on CRISPR/Cas9, not only greatly reduce
The difficulty that gene knockout, gene modification are carried out to animal, is even more pushed Animal Transgenic Technology to by traditional random integration
The genome orientation of high precision is deleted, is mutated or is inserted into, and the new era of transgenic animals production has been started.CRISPR/Cas9
System is the ribonucleoprotein complexes being made of nucleic acid and protein, it is to the identification of target spot dependent on nucleic acid to nucleic acid
Identification, completed by the complementary pairing of base.
Core component due to playing active function in CRISPR/Cas9 system is sgRNA and protein, can be led to
After crossing vitro synthesized RNA, microinjection fertilised non-human eggs form easy integration site, import specific DNA fragment and form mutation position
Point to obtain target practice animal, while introducing same sense mutation, manufactures new restriction enzyme site, is convenient for subsequent detection.Due to mRNA and
The unstability of protein, will not be in long-term existence organism, and will not generate on environment further influences, thus can be to avoid
Bio-safety problem caused by traditional transgenosis, the DNA fragmentation and receptor species itself of importing are homologous, will not equally cause biology
Safety problem.So especially in the preparation of genetically modified animal, CRISPR/Cas9 is situated between in current animals and plants rearing new variety
The targeting system led widely is used by researcher.
Summary of the invention
Technical problems to be solved: the object of the present invention is to provide a kind of specific mutations FecB genes mediated with RNA
The method of acquisition gene editing sheep and its dedicated sgRNA and Oligo DNA.
Technical solution: the present invention provides a kind of systems of targeting modification sheep FecB gene that can be special, including two
A sgRNA and three Oligo DNA sequence dna, wherein two sgRNA are sgRNAFecB- 1 and sgRNAFecB- 2, it is sequence table
Sequence 3 and 4 nucleotide shown in the RNA or RNA with the sequence;Three Oligo DNA sequence dnas are sequence table
Sequence 5,6 and 7 or the DNA with the sequence.
Further, sgRNA the and Oligo DNA is RNA and DNA shown in the sequence 3-7 of sequence table.
The present invention also protects the coding sgRNAFecB- the 1 and sgRNAFecB- 2 DNA molecular.
Further, the DNA molecular encodes the sgRNAFecB- 1 DNA molecule be sequence table sequence 2 from
DNA molecular shown in the 5 ' nucleotide of end the 885th to 904;Encode the sgRNAFecB- 2 DNA molecular is the sequence of sequence table
The DNA molecular shown in the nucleotide of 5 ' end the 857th to 876 of column 2.
The present invention also protects a kind of targeting sequence of targeting modification sheep FecB gene that can be special, is the sequence of sequence table
Nucleotide shown in column 3 or 4.
The present invention also protects the complete nucleic acid molecules of species specificity editor's sheep FecB gene, including the sgRNA
With Cas9 mRNA.
The present invention also protects the complete nucleic acid molecules of species specificity editor's sheep FecB gene, including the DNA points
Son.
The method that the present invention also protects species specificity editor's sheep FecB gene, by the targeting modification that can be special
SgRNA, Cas9 mRNA and Oligo DNA cotransfection ovine cells of sheep FecB gene, to edit sheep FecB gene.
Further, the mode of the cotransfection is co-injection, and the ovine cells are that sheep zygotes are unicellular.
The sheep FecB gene is the gene of protein shown in the sequence 1 of polynucleotide.
Further, the sheep FecB gene is DNA molecular or the sequence of sequence table shown in the sequence 2 of sequence table
The DNA molecular shown in the nucleotide of 5 ' end the 157th to 1665 of column 2.
The utility model has the advantages that
1. realizing that the cost of modification and transformation and technical requirements are still very high on big Animal genome at present, therefore obtain special
Different, efficient sgRNA becomes the key that ovine genome editor cultivates.
2. sgRNA and Oligo DNA specificity provided by the invention is higher and being capable of accurate targeting modification sheep FecB base
Cause realizes gene mutation;And due to removing sequence 1 from the Pvu II restriction enzyme site at the nucleotide of 5 ' ends the 875th, change
For 873 Nhe I restriction enzyme sites, cell and Individual identification after facilitating gene editing.
3. using the method for the present invention editor sheep, it can effectively increase ewe litter size.
Detailed description of the invention
Fig. 1 is the PCR product of 1-4 gene mutation site through Nhe I cleavage map, it is seen that two band of 170bp and 380bp;
5-8 is the PCR product of gene mutation site through Pvu II digestion, it is seen that mono- band of 550bp;9 be DL2000 DNA
marker。
Fig. 2 is FecB gene editing sheep qualification figure, wherein M is DNA marker, and WT is the yin for not carrying out gene editing
Property sheep control group, No. 468 sheep are FecB gene editing homozygotic individual;795,0206 is heterozygote individual;473 be heterozygosis
Son, while it has a SNP polymorphism, loses Pvu II restriction enzyme site.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention, in addition, it should also be understood that, reading
After the content that the present invention lectures, those skilled in the art can make various modifications or changes to the present invention, such equivalent forms
It also falls within the scope of the appended claims of the present application.Experimental method in following embodiments, unless otherwise specified,
It is conventional method, is detailed in " molecular cloning (third edition) ".Test material as used in the following examples, such as without special theory
It is bright, it is to be commercially available from routine biochemistry reagent shop.Quantitative test in following embodiment, is respectively provided with and repeats reality three times
It tests, results are averaged.
The amino acid and nucleotide sequence of relevant primer in embodiment are shown in Table 1 (each primer is single stranded DNA molecule).
The nucleotide sequence of 1 FecB gene-correlation primer of table
Primer | Primer sequence |
FecB-TF | 5’ cgtgctccttcaaatcccta 3’ |
FecB-TR | 5’ tgccgtgaacgcactaaca 3’ |
Embodiment 1
Prepare sgRNA and Cas9 mRNA
1, it designs sheep FecB gene target sequence and identifies the sgRNA of target sequence
The target sequence (target sequence is on the exons 1 of sheep FecB gene) that 2 sgRNA are directed to sheep FecB gene is designed,
See the sequence 3 and sequence 4 in sequence table.
2, sgRNA is preparedFECB
By designed sequence 3 and sequence 4, it is dealt into Huada gene company, synthesizes sgRNA, dissolution is stand-by;
3, Cas9 mRNA is prepared
Known Cas9 mRNA sequence is dealt into Huada gene company, synthesis mRNA is stand-by.
Cas9 mRNA sequence is as shown in the sequence 8 of sequence table.
Embodiment 2
The detection of sgRNA/Cas9 mRNA mutation efficiency
One, the acquisition of sheep zygotes
1, the maturation of egg mother cell
Sheep Ovary is acquired from slaughterhouse, with physiological saline sterilizing and washing 3-4 times, egg mother cell is extracted, washs 3-4 with mature liquid
It is secondary, the mature drop balanced is then instilled, is put into containing 5% CO238.6 DEG C of incubators in culture (following incubator culture is equal
For the same terms).
2, egg mother cell is in vitro fertilization
(1) egg mother cell of maturation in vitro 24-26h is taken out, is gently blown and beaten with 0.1% hyaluronidase to remove granular cell,
Again with by semen washing 3 times, it is then placed in the fertilization drop balanced.
(2) take the sperm (sperm come from Kazakh sheep) of freezing, water-bath is thawed, move into balanced by sperm, be put into
Then 20-25min in incubator draws the sperm on top, be centrifuged 4-5min with the revolving speed of 1500rpm, discard supernatant liquid, obtain
Sperm pellets.
(3) sperm for obtaining step (2) is added in the fertilization drop for completing step (1), makes the concentration (2-4) of sperm
×106A/ml, 38.6 DEG C of stationary incubation 12-18h, with the culture solution balanced pressure-vaccum fertilized eggs repeatedly, then by 50-70 pieces/
The density in hole moves into four well culture plates.
The preparation method of the culture solution balanced: in the incubator by culture solution, 3-4h is placed.Culture solution: SOF liquid+
3mg/ml BSA。
After fertilization 48h counts cleavage rates, and 8d counts blastocyst rate.
Two, the microinjection of single-cell zygotes
1, the sgRNA for preparing embodiment 1FECB-1、sgRNAFECB- 2 and Cas9 mRNA mixing.
2, test process: step 1 is injected into using the mixed liquor that the microinjection instrument of NIKON company obtains step 1 and is obtained
In the cytoplasm of the fertilized eggs in one cell stage arrived, it is placed in incubator and cultivates.Control treatment: using the aobvious of NIKON company
Nuclease-free Water is injected into the cytuloplasm in one cell stage that step 1 obtains by microinjection instrument, is set
It is cultivated in incubator.
3, target gene editorial efficiency detects in embryo
(1) embryo samples are collected
After cultivating 7d in step 2, embryo is taken, is washed 2 times with PBS buffer solution, is subsequently placed in 20ul Direct PCR Kit,
55 DEG C of cracking 30min, then 95 DEG C of inactivation 5min, take 2ul to carry out PCR as template.
(2) PCR amplification
Design synthesis identification primer:
FecB-F cgtgctccttcaaatcccta,
FecB-R tgccgtgaacgcactaaca;
PCR is carried out by template of the pyrolysis product of step (1).
(3) NheI digestion is identified
Respectively take 10ul PCR(about 200ng ~ 500ng respectively to each sample) product NheI digestion.
Endonuclease reaction system (total volume 20ul)
PCR product 10ul
10XBuffer 2ul
NheI(NEB) 1ul
H2O 7ul
37 °C of reaction 2h ~ 4h, 2% agarose gel electrophoresis of all samples is identified.
The result is shown in Figure 1 carries out PCR amplification to gene editing site and obtains amplified band, through the visible 380bp of Nhe I digestion
With the band of two entry of 170bp, Pvu II digestion does not obtain digestion as a result, an only band (550bp), then illustrate that the sample has
Correct Knockin realizes the replacement (the correct point mutation of FecB) of specific site.Nhe I digestion is the result shows that (see Table 2): continuous
It is 30.00-36.36% that FecB gene editing efficiency, which occurs, for sheep embryo, and gene editing develops without lethal, card sheep embryo
Bright DNA molecular is to sheep embryo nontoxicity.
2 sheep embryo FecB gene editing of table statistics
Embodiment 3
The production of gene editing sheep
1, experiment sheep selection: if it is well each without the adult sheep ram in the mutational site FecB and ewe to choose health, production performance
It is dry to be only used as embryonic donor sheep;Health, age are chosen between 3~5 years old, when producing the ewe of lamb per year as acceptor ewe
2, estrus synchronization and superfecundation: meat sheep used as donor is handled using CIDR+FSH+PMSG+LH method, and FSH accumulated dose is
12.2 ml, intramuscular injection of successively decreasing daily 2 times, are spaced 12 h.That places CIDR vaginal plug is set as 0 d on the 1st day, and the 9th
~11 d start intramuscular injection FSH, and point 7 injections, amounting to injection dosage is 12.2 ml, in FSH the 2nd muscle reciprocal
When injection, CIDR bolt and intramuscular injection PMSG are withdrawn from, 24~48 h after removing CIDR start to try feelings, immediately if any heat
Vein or intramuscular injection LH use cornua uteri semen deposition after 6~8 h vagina semen depositions or 10~18 h after heat
3, the acquisition of protokaryon embryo: artificial insemination is carried out, and passed through in second day to donor sheep control food, control water on the day of semen deposition
Operation method takes out cornua uteri and fimbriae tubae portion, injects egg liquid from cornua uteri end to fimbriae tubae portion, collects protokaryon phase embryo
Tire, and prepare to inject for cytoplasm.
4, the sgRNA for preparing embodiment 1FecB(10ng/ μ l), Cas9 mRNA(60ng/ μ l) and Oligo DNA(40
Ng/ μ l) mixing;
5, test process: step 4 is injected into using the mixed liquor that the micromanipulation system of Ai Bende company obtains step 5 and is obtained
The fertilized eggs in the protokaryon phase cytoplasm in, after of short duration culture prepare be used for Recipient embryo transfer.
6, embryo transfer and gestation detection: spongy embolus is placed to acceptor ewe and induces estrus synchronization, the placement same day is denoted as 0
D removes 6 h receptor sheep of the bolt arrangement of time before donor sheep removes CIDR bolt and removes spongy embolus, while intramuscular injection PMSG, 24~
48 h receptor sheep try feelings, and indicia, record the heat date, rush to donor and carry out receptor transplanting work embryo day.The protokaryon phase
Embryo transfer is transplanted using modus operandi, shaving, disinfection and de- iodine in receptor sheep back leg two sides Gorgon euryale nest portion, technical staff hook or
Cornua uteri taper end is pressed from both sides out, another technician opens the fimbriae tubae portion that finds, and will move embryo needle and be inserted into fallopian tubal 5~12 from umbrella opening
At mm, two cell stages are placed here, after suture, disinfection.Pregnancy check is carried out using B ultrasound instrument when 45~60 d.
7, the identification of FecB gene editing sheep: after pregnancy ewes lambing, lamb blood is extracted, extracts genome, is used
Preceding method is expanded with FecB F and FecB R primer, and carries out digestion identification with Nhe I and Pvu II.Digestion result
As shown in Figure 2.
Sequence table
Sequence table
<110>Xinjiang Academy of Land Reclamation &. Cultivation, Institute of Zoology, Academia Sinica
<120>a kind of specific mutations FecB gene mediated with RNA obtains the method for gene editing sheep and its dedicated
SgRNA and Oligo DNA
<130> 2019.1.31
<160>8
<170> PatentIn version 3.3
<210> 1
<211> 502
<212> PRT
<213>artificial synthesized
<400> 1
Met Leu Leu Arg Ser Ser Gly Lys Leu Ser Val Gly Thr Lys Lys Glu
1 5 10 15
Asp Gly Glu Ser Thr Ala Pro Thr Pro Arg Pro Lys Ile Leu Arg Cys
20 25 30
Lys Cys His His His Cys Pro Glu Asp Ser Val Asn Asn Ile Cys Ser
35 40 45
Thr Asp Gly Tyr Cys Phe Thr Met Ile Glu Glu Asp Asp Ser Gly Met
50 55 60
Pro Val Val Thr Ser Gly Cys Leu Gly Leu Glu Gly Ser Asp Phe Gln
65 70 75 80
Cys Arg Asp Thr Pro Ile Pro His Gln Arg Arg Ser Ile Glu Cys Cys
85 90 95
Thr Glu Arg Asn Glu Cys Asn Lys Asp Leu His Pro Thr Leu Pro Pro
100 105 110
Leu Lys Asn Arg Asp Phe Val Asp Gly Pro Ile His His Lys Ala Leu
115 120 125
Leu Ile Ser Val Thr Val Cys Ser Leu Leu Leu Val Leu Ile Ile Leu
130 135 140
Phe Cys Tyr Phe Arg Tyr Lys Arg Gln Glu Ala Arg Pro Arg Tyr Ser
145 150 155 160
Ile Gly Leu Glu Gln Asp Glu Thr Tyr Ile Pro Pro Gly Glu Ser Leu
165 170 175
Arg Asp Leu Ile Glu Gln Ser Gln Ser Ser Gly Ser Gly Ser Gly Leu
180 185 190
Pro Leu Leu Val Gln Arg Thr Ile Ala Lys Gln Ile Gln Met Val Lys
195 200 205
Gln Ile Gly Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp Arg
210 215 220
Gly Glu Lys Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu Ala Ser
225 230 235 240
Trp Phe Arg Glu Thr Glu Ile Tyr Gln Thr Val Leu Met Arg His Glu
245 250 255
Asn Ile Leu Gly Phe Ile Ala Ala Asp Ile Lys Gly Thr Gly Ser Trp
260 265 270
Thr Gln Leu Tyr Leu Ile Thr Asp Tyr His Glu Asn Gly Ser Leu Tyr
275 280 285
Asp Tyr Leu Lys Ser Thr Thr Leu Asp Thr Lys Ser Met Leu Lys Leu
290 295 300
Ala Tyr Ser Ala Val Ser Gly Leu Cys His Leu His Thr Glu Ile Phe
305 310 315 320
Ser Thr Gln Gly Lys Pro Ala Ile Ala His Arg Asp Leu Lys Ser Lys
325 330 335
Asn Ile Leu Val Lys Lys Asn Gly Thr Cys Cys Ile Ala Asp Leu Gly
340 345 350
Leu Ala Val Lys Phe Ile Ser Asp Thr Asn Glu Val Asp Ile Pro Pro
355 360 365
Asn Thr Arg Val Gly Thr Lys Arg Tyr Met Pro Pro Glu Val Leu Asp
370 375 380
Glu Ser Leu Asn Arg Asn His Phe Gln Ser Tyr Ile Met Ala Asp Met
385 390 395 400
Tyr Ser Phe Gly Leu Ile Leu Trp Glu Val Ala Arg Arg Cys Val Ser
405 410 415
Gly Gly Ile Val Glu Glu Tyr Gln Leu Pro Tyr His Asp Leu Val Pro
420 425 430
Ser Asp Pro Ser Tyr Glu Asp Met Arg Glu Ile Val Cys Ile Lys Lys
435 440 445
Leu Arg Pro Ser Phe Pro Asn Arg Trp Ser Ser Asp Glu Cys Leu Arg
450 455 460
Gln Met Gly Lys Leu Met Thr Glu Cys Trp Ala His Asn Pro Ala Ser
465 470 475 480
Arg Leu Thr Ala Leu Arg Val Lys Lys Thr Leu Ala Lys Met Ser Glu
485 490 495
Ser Gln Asp Ile Lys Leu
500
<210> 2
<211> 3255
<212> DNA
<213>artificial synthesized
<400> 2
atcaaggacg ttctacactt tggttatcag cagcctgttt atctggttca aacttctgct 60
gaatcacaag cattttccgt tgagctatga caagagagga tacaaaaagt taaacaagca 120
agcctgtcat acgtagaagc aaacttcctt gataacatgc ttttgcgaag ttcaggaaaa 180
ttaagtgtgg gcaccaagaa agaggatggt gagagtacag cccccacccc tcgtccaaag 240
atcttgcgat gtaaatgcca ccaccattgt ccagaagact cggtcaacaa tatttgcagc 300
acagatggat attgtttcac gatgatagaa gaagatgact ctgggatgcc tgtggtcact 360
tctggatgtc taggactaga aggctcagat tttcagtgtc gggacactcc cattcctcat 420
cagagaagat ccattgaatg ctgcacagaa cggaatgaat gtaataaaga tctgcacccc 480
acacttcctc cactgaaaaa cagagatttt gttgacggac ctatacacca caaagcttta 540
cttatatctg tgactgtgtg tagtttgctc ttggtcctca tcattttatt ctgttacttc 600
aggtataaaa gacaagaagc cagacctcgg tacagcattg ggttagaaca ggacgaaact 660
tacattcctc ctggagaatc cctgagagac ttaattgagc agtcgcagag ctcagggagc 720
ggatcaggcc tccctctgct ggtccagagg acaatagcaa agcaaattca gatggtgaaa 780
cagattggaa aaggtcgcta tggggaagtt tggatgggaa agtggcgtgg cgaaaaggta 840
gctgtgaaag tgttcttcac tacagaggag gccagctggt tccgagagac agaaatatat 900
cagacggtgt tgatgaggca tgaaaacatc ttgggcttca ttgctgcaga tatcaaaggg 960
acggggtcct ggacacaact gtacctaatc acagattatc atgaaaatgg ttccctctat 1020
gattacctga agtccaccac cctagacact aagtcgatgt tgaagctagc ctattccgca 1080
gtcagtggcc tctgtcactt acacactgaa atctttagca ctcaaggcaa accagcaatt 1140
gcccatcgag atctgaaaag taagaacatc ctggtgaaga aaaatggaac ttgctgtata 1200
gctgacctgg gcttggctgt taagtttatt agtgacacga atgaagttga cataccaccc 1260
aacactcgcg ttggcaccaa gcgctacatg cctccagaag tgttggatga gagcttgaac 1320
agaaatcact ttcagtctta catcatggcc gacatgtaca gttttggact catcctttgg 1380
gaggtcgcta ggagatgtgt gtcaggaggt atagtggaag aatatcagct cccctatcat 1440
gacctggtgc ccagtgaccc ctcttacgag gacatgagag agatcgtgtg tatcaagaag 1500
ctgcggccct ccttccccaa ccggtggagc agtgacgagt gtctcaggca gatggggaaa 1560
ctcatgacgg aatgctgggc tcacaatcct gcctcaagac tgacagccct acgggttaag 1620
aaaacccttg ccaaaatgtc agagtcccag gacattaagc tctgaggcaa gagtaagtgt 1680
ctctggacaa agccagtaga tatcctcctg tttgtgggca gagcaaaaga tgttccagca 1740
gcatccaccg tcccagcctc gaacatcctc ctgctcccca gagggtgtat tcttacatct 1800
cagggagcag cctggacaaa cagaagtttc cagaagcacg gattcctcat gtctgtctgt 1860
aggcgggaga aactgcctgg gtaatttgtt caagatatga tgcatgttgc tttctaagaa 1920
agcccggtat tttgggattg cctttttttt cctcaaaaga taattttgcc aaaataaaac 1980
aaaaatgtag atgtttcaag gtatatacta ttttagttta aagaatgaca actaaagttc 2040
ttcccagaaa ctctgctgga aggtaaatta aaatatgtat ttccattggt aaaatgttgt 2100
tgcactctac caaccaaaag acaatcgttg aagctggaga accgaatgga acccatctta 2160
aaagcccccg acgtgcccct gcctcctcag accactctgg ccagccctcc actggggcag 2220
ccgcagcaat gtgaacgcat ctggggaccg gcaccgcctg tgtgggacca cctctgggga 2280
ttcccaccca tgaccttctg cagcttcaga ggatgtggga caaatgaagg ttttacgaga 2340
ctctactaga agtaaatgtt aacactgttc ttcagaacca ctttgtattt ctgattctgt 2400
taggtttttt ctttcattaa acacaaacaa agcttttgtg tgtgtaggaa gttgaacccc 2460
tgcaggcttt tgatctctca aatgaaagga tcaatattaa gtaaagtggc tgtcagctgg 2520
gtcgaagaca aggcgcttta aaatagagat aatttgctct tgagctgtaa gaagatggtg 2580
tcaaaaaggt aggcggtgag gatggaggta cacgtggctt gtgtcttagg tatgcggaag 2640
agacctcctc ggccgcatga ggggaaaagt gtgcacaact tactgtgtac aaagagggtt 2700
tcttttagtt attatctgcc ttttctctgt ctgagtttag aggagaggaa acgtatcagg 2760
ttaattgaac taattttaat tttaaattag gtgactgtaa cctccaaatg gaacagcaga 2820
ggaatgctag tggagaccac aagatatggc tgtcgggact gattctacaa taggtacaga 2880
tggaggatgt aagtcttagg tgatagtgtc acgtcttagg agtgctgact cagtttattt 2940
ttattttcat gacgttcagc tcacttttta atttattatt gttttcttct ctgcagcgct 3000
tgcgcagaac atctctccac ctgttcagtt atgtaggcac acacacttct gagcagcagg 3060
agtcaaatca ttgacagggc cagtattcct tagcaacagg agcataataa agggtacaat 3120
tgtacacatc cctctcaacc ttattcattt acttcctgac tgtggctttc ttatgctgct 3180
tagaattctc tagtgtgtag caaagaattg ggaagcccct cttctttgcc cttgaaaaaa 3240
aaaaaaaaaa aaaaa 3255
<210> 3
<211> 23
<212> RNA
<213>artificial synthesized
<400> 3
ccgucugaua uauuucuguc ucu 23
<210> 4
<211> 23
<212> RNA
<213>artificial synthesized
<400> 4
ccagcuggcc uccucuguag uga 23
<210> 5
<211> 23
<212> DNA
<213>artificial synthesized
<400> 5
agagacagaa atatatcaga cgg 23
<210> 6
<211> 23
<212> DNA
<213>artificial synthesized
<400> 6
tcactacaga ggaggccagc tgg 23
<210> 7
<211> 160
<212> DNA
<213>artificial synthesized
<400> 7
tttggatggg aaagtggcgt ggcgaaaagg tagctgtgaa agtgttcttc actacagagg 60
aagctagctg gttccgagag acagaaatat accggacggt gttgatgagg catgaaaaca 120
tcttgggtga gtataagtct gtattagcga tgttcagggt 160
<210> 8
<211> 4224
<212> RNA
<213>artificial synthesized
<400> 8
auggacuaua aggaccacga cggagacuac aaggaucaug auauugauua caaagacgau 60
gacgauaaga uggccccaaa gaagaagcgg aaggucggua uccacggagu cccagcagcc 120
gacaagaagu acagcaucgg ccuggacauc ggcaccaacu cugugggcug ggccgugauc 180
accgacgagu acaaggugcc cagcaagaaa uucaaggugc ugggcaacac cgaccggcac 240
agcaucaaga agaaccugau cggagcccug cuguucgaca gcggcgaaac agccgaggcc 300
acccggcuga agagaaccgc cagaagaaga uacaccagac ggaagaaccg gaucugcuau 360
cugcaagaga ucuucagcaa cgagauggcc aagguggacg acagcuucuu ccacagacug 420
gaagaguccu uccuggugga agaggauaag aagcacgagc ggcaccccau cuucggcaac 480
aucguggacg agguggccua ccacgagaag uaccccacca ucuaccaccu gagaaagaaa 540
cugguggaca gcaccgacaa ggccgaccug cggcugaucu aucuggcccu ggcccacaug 600
aucaaguucc ggggccacuu ccugaucgag ggcgaccuga accccgacaa cagcgacgug 660
gacaagcugu ucauccagcu ggugcagacc uacaaccagc uguucgagga aaaccccauc 720
aacgccagcg gcguggacgc caaggccauc cugucugcca gacugagcaa gagcagacgg 780
cuggaaaauc ugaucgccca gcugcccggc gagaagaaga auggccuguu cggcaaccug 840
auugcccuga gccugggccu gacccccaac uucaagagca acuucgaccu ggccgaggau 900
gccaaacugc agcugagcaa ggacaccuac gacgacgacc uggacaaccu gcuggcccag 960
aucggcgacc aguacgccga ccuguuucug gccgccaaga accuguccga cgccauccug 1020
cugagcgaca uccugagagu gaacaccgag aucaccaagg ccccccugag cgccucuaug 1080
aucaagagau acgacgagca ccaccaggac cugacccugc uuaaggcucu cgugcggcag 1140
cagcugccug agaaguacaa agagauuuuc uucgaccaga gcaagaacgg cuacgccggc 1200
uacauugacg gcggagccag ccaggaagag uucuacaagu ucaucaagcc cauccuggaa 1260
aagauggacg gcaccgagga acugcucgug aagcugaaca gagaggaccu gcugcggaag 1320
cagcggaccu ucgacaacgg cagcaucccc caccagaucc accugggaga gcugcacgcc 1380
auucugcggc ggcaggaaga uuuuuaccca uuccugaagg acaaccggga aaagaucgag 1440
aagauccuga ccuuccgcau ccccuacuac gugggcccuc uggccagggg aaacagcaga 1500
uucgccugga ugaccagaaa gagcgaggaa accaucaccc ccuggaacuu cgaggaagug 1560
guggacaagg gcgcuuccgc ccagagcuuc aucgagcgga ugaccaacuu cgauaagaac 1620
cugcccaacg agaaggugcu gcccaagcac agccugcugu acgaguacuu caccguguau 1680
aacgagcuga ccaaagugaa auacgugacc gagggaauga gaaagcccgc cuuccugagc 1740
ggcgagcaga aaaaggccau cguggaccug cuguucaaga ccaaccggaa agugaccgug 1800
aagcagcuga aagaggacua cuucaagaaa aucgagugcu ucgacuccgu ggaaaucucc 1860
ggcguggaag aucgguucaa cgccucccug ggcacauacc acgaucugcu gaaaauuauc 1920
aaggacaagg acuuccugga caaugaggaa aacgaggaca uucuggaaga uaucgugcug 1980
acccugacac uguuugagga cagagagaug aucgaggaac ggcugaaaac cuaugcccac 2040
cuguucgacg acaaagugau gaagcagcug aagcggcgga gauacaccgg uuggggcagg 2100
cugagccgga agcugaucaa cggcauccgg gacaagcagu ccggcaagac aauccuggau 2160
uuccugaagu ccgacggcuu cgccaacaga aacuucaugc agcugaucca cgacgacagc 2220
cugaccuuua aagaggacau ccagaaagcc cagguguccg gccagggcga uagccugcac 2280
gagcacauug ccaaucuggc cggcagcccc gccauuaaga agggcauccu gcagacagug 2340
aagguggugg acgagcucgu gaaagugaug ggccggcaca agcccgagaa caucgugauc 2400
gaaauggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaaug 2460
aagcggaucg aagagggcau caaagagcug ggcagccaga uccugaaaga acaccccgug 2520
gaaaacaccc agcugcagaa cgagaagcug uaccuguacu accugcagaa ugggcgggau 2580
auguacgugg accaggaacu ggacaucaac cggcuguccg acuacgaugu ggaccauauc 2640
gugccucaga gcuuucugaa ggacgacucc aucgacaaca aggugcugac cagaagcgac 2700
aagaaccggg gcaagagcga caacgugccc uccgaagagg ucgugaagaa gaugaagaac 2760
uacuggcggc agcugcugaa cgccaagcug auuacccaga gaaaguucga caaucugacc 2820
aaggccgaga gaggcggccu gagcgaacug gauaaggccg gcuucaucaa gagacagcug 2880
guggaaaccc ggcagaucac aaagcacgug gcacagaucc uggacucccg gaugaacacu 2940
aaguacgacg agaaugacaa gcugauccgg gaagugaaag ugaucacccu gaaguccaag 3000
cugguguccg auuuccggaa ggauuuccag uuuuacaaag ugcgcgagau caacaacuac 3060
caccacgccc acgacgccua ccugaacgcc gucgugggaa ccgcccugau caaaaaguac 3120
ccuaagcucg agagcgaguu cguguacggc gacuacaagg uguacgacgu gcggaagaug 3180
aucgccaaga gcgagcagga aaucggcaag gcuaccgcca aguacuucuu cuacagcaac 3240
aucaugaacu uuuucaagac cgagauuacc cuggccaacg gcgagauccg gaagcggccu 3300
cugaucgaga caaacggcga aaccggggag aucguguggg auaagggccg ggauuuugcc 3360
accgugcgga aagugcugag caugccccaa gugaauaucg ugaaaaagac cgaggugcag 3420
acaggcggcu ucagcaaaga gucuauccug cccaagagga acagcgauaa gcugaucgcc 3480
agaaagaagg acugggaccc uaagaaguac ggcggcuucg acagccccac cguggccuau 3540
ucugugcugg ugguggccaa aguggaaaag ggcaagucca agaaacugaa gagugugaaa 3600
gagcugcugg ggaucaccau cauggaaaga agcagcuucg agaagaaucc caucgacuuu 3660
cuggaagcca agggcuacaa agaagugaaa aaggaccuga ucaucaagcu gccuaaguac 3720
ucccuguucg agcuggaaaa cggccggaag agaaugcugg ccucugccgg cgaacugcag 3780
aagggaaacg aacuggcccu gcccuccaaa uaugugaacu uccuguaccu ggccagccac 3840
uaugagaagc ugaagggcuc ccccgaggau aaugagcaga aacagcuguu uguggaacag 3900
cacaagcacu accuggacga gaucaucgag cagaucagcg aguucuccaa gagagugauc 3960
cuggccgacg cuaaucugga caaagugcug uccgccuaca acaagcaccg ggauaagccc 4020
aucagagagc aggccgagaa uaucauccac cuguuuaccc ugaccaaucu gggagccccu 4080
gccgccuuca aguacuuuga caccaccauc gaccggaaga gguacaccag caccaaagag 4140
gugcuggacg ccacccugau ccaccagagc aucaccggcc uguacgagac acggaucgac 4200
cugucucagc ugggaggcga cuaa 4224
SEQUENCE LISTING
<110>Xinjiang Academy of Land Reclamation &. Cultivation, Institute of Zoology, Academia Sinica
<120>a kind of method for obtaining gene editing sheep and its dedicated sgRNA and Oligo DNA
<130> 2019.1.16
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 502
<212> PRT
<213>artificial synthesized
<400> 1
Met Leu Leu Arg Ser Ser Gly Lys Leu Ser Val Gly Thr Lys Lys Glu
1 5 10 15
Asp Gly Glu Ser Thr Ala Pro Thr Pro Arg Pro Lys Ile Leu Arg Cys
20 25 30
Lys Cys His His His Cys Pro Glu Asp Ser Val Asn Asn Ile Cys Ser
35 40 45
Thr Asp Gly Tyr Cys Phe Thr Met Ile Glu Glu Asp Asp Ser Gly Met
50 55 60
Pro Val Val Thr Ser Gly Cys Leu Gly Leu Glu Gly Ser Asp Phe Gln
65 70 75 80
Cys Arg Asp Thr Pro Ile Pro His Gln Arg Arg Ser Ile Glu Cys Cys
85 90 95
Thr Glu Arg Asn Glu Cys Asn Lys Asp Leu His Pro Thr Leu Pro Pro
100 105 110
Leu Lys Asn Arg Asp Phe Val Asp Gly Pro Ile His His Lys Ala Leu
115 120 125
Leu Ile Ser Val Thr Val Cys Ser Leu Leu Leu Val Leu Ile Ile Leu
130 135 140
Phe Cys Tyr Phe Arg Tyr Lys Arg Gln Glu Ala Arg Pro Arg Tyr Ser
145 150 155 160
Ile Gly Leu Glu Gln Asp Glu Thr Tyr Ile Pro Pro Gly Glu Ser Leu
165 170 175
Arg Asp Leu Ile Glu Gln Ser Gln Ser Ser Gly Ser Gly Ser Gly Leu
180 185 190
Pro Leu Leu Val Gln Arg Thr Ile Ala Lys Gln Ile Gln Met Val Lys
195 200 205
Gln Ile Gly Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp Arg
210 215 220
Gly Glu Lys Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu Ala Ser
225 230 235 240
Trp Phe Arg Glu Thr Glu Ile Tyr Gln Thr Val Leu Met Arg His Glu
245 250 255
Asn Ile Leu Gly Phe Ile Ala Ala Asp Ile Lys Gly Thr Gly Ser Trp
260 265 270
Thr Gln Leu Tyr Leu Ile Thr Asp Tyr His Glu Asn Gly Ser Leu Tyr
275 280 285
Asp Tyr Leu Lys Ser Thr Thr Leu Asp Thr Lys Ser Met Leu Lys Leu
290 295 300
Ala Tyr Ser Ala Val Ser Gly Leu Cys His Leu His Thr Glu Ile Phe
305 310 315 320
Ser Thr Gln Gly Lys Pro Ala Ile Ala His Arg Asp Leu Lys Ser Lys
325 330 335
Asn Ile Leu Val Lys Lys Asn Gly Thr Cys Cys Ile Ala Asp Leu Gly
340 345 350
Leu Ala Val Lys Phe Ile Ser Asp Thr Asn Glu Val Asp Ile Pro Pro
355 360 365
Asn Thr Arg Val Gly Thr Lys Arg Tyr Met Pro Pro Glu Val Leu Asp
370 375 380
Glu Ser Leu Asn Arg Asn His Phe Gln Ser Tyr Ile Met Ala Asp Met
385 390 395 400
Tyr Ser Phe Gly Leu Ile Leu Trp Glu Val Ala Arg Arg Cys Val Ser
405 410 415
Gly Gly Ile Val Glu Glu Tyr Gln Leu Pro Tyr His Asp Leu Val Pro
420 425 430
Ser Asp Pro Ser Tyr Glu Asp Met Arg Glu Ile Val Cys Ile Lys Lys
435 440 445
Leu Arg Pro Ser Phe Pro Asn Arg Trp Ser Ser Asp Glu Cys Leu Arg
450 455 460
Gln Met Gly Lys Leu Met Thr Glu Cys Trp Ala His Asn Pro Ala Ser
465 470 475 480
Arg Leu Thr Ala Leu Arg Val Lys Lys Thr Leu Ala Lys Met Ser Glu
485 490 495
Ser Gln Asp Ile Lys Leu
500
<210> 2
<211> 3255
<212> DNA
<213>artificial synthesized
<400> 2
atcaaggacg ttctacactt tggttatcag cagcctgttt atctggttca aacttctgct 60
gaatcacaag cattttccgt tgagctatga caagagagga tacaaaaagt taaacaagca 120
agcctgtcat acgtagaagc aaacttcctt gataacatgc ttttgcgaag ttcaggaaaa 180
ttaagtgtgg gcaccaagaa agaggatggt gagagtacag cccccacccc tcgtccaaag 240
atcttgcgat gtaaatgcca ccaccattgt ccagaagact cggtcaacaa tatttgcagc 300
acagatggat attgtttcac gatgatagaa gaagatgact ctgggatgcc tgtggtcact 360
tctggatgtc taggactaga aggctcagat tttcagtgtc gggacactcc cattcctcat 420
cagagaagat ccattgaatg ctgcacagaa cggaatgaat gtaataaaga tctgcacccc 480
acacttcctc cactgaaaaa cagagatttt gttgacggac ctatacacca caaagcttta 540
cttatatctg tgactgtgtg tagtttgctc ttggtcctca tcattttatt ctgttacttc 600
aggtataaaa gacaagaagc cagacctcgg tacagcattg ggttagaaca ggacgaaact 660
tacattcctc ctggagaatc cctgagagac ttaattgagc agtcgcagag ctcagggagc 720
ggatcaggcc tccctctgct ggtccagagg acaatagcaa agcaaattca gatggtgaaa 780
cagattggaa aaggtcgcta tggggaagtt tggatgggaa agtggcgtgg cgaaaaggta 840
gctgtgaaag tgttcttcac tacagaggag gccagctggt tccgagagac agaaatatat 900
cagacggtgt tgatgaggca tgaaaacatc ttgggcttca ttgctgcaga tatcaaaggg 960
acggggtcct ggacacaact gtacctaatc acagattatc atgaaaatgg ttccctctat 1020
gattacctga agtccaccac cctagacact aagtcgatgt tgaagctagc ctattccgca 1080
gtcagtggcc tctgtcactt acacactgaa atctttagca ctcaaggcaa accagcaatt 1140
gcccatcgag atctgaaaag taagaacatc ctggtgaaga aaaatggaac ttgctgtata 1200
gctgacctgg gcttggctgt taagtttatt agtgacacga atgaagttga cataccaccc 1260
aacactcgcg ttggcaccaa gcgctacatg cctccagaag tgttggatga gagcttgaac 1320
agaaatcact ttcagtctta catcatggcc gacatgtaca gttttggact catcctttgg 1380
gaggtcgcta ggagatgtgt gtcaggaggt atagtggaag aatatcagct cccctatcat 1440
gacctggtgc ccagtgaccc ctcttacgag gacatgagag agatcgtgtg tatcaagaag 1500
ctgcggccct ccttccccaa ccggtggagc agtgacgagt gtctcaggca gatggggaaa 1560
ctcatgacgg aatgctgggc tcacaatcct gcctcaagac tgacagccct acgggttaag 1620
aaaacccttg ccaaaatgtc agagtcccag gacattaagc tctgaggcaa gagtaagtgt 1680
ctctggacaa agccagtaga tatcctcctg tttgtgggca gagcaaaaga tgttccagca 1740
gcatccaccg tcccagcctc gaacatcctc ctgctcccca gagggtgtat tcttacatct 1800
cagggagcag cctggacaaa cagaagtttc cagaagcacg gattcctcat gtctgtctgt 1860
aggcgggaga aactgcctgg gtaatttgtt caagatatga tgcatgttgc tttctaagaa 1920
agcccggtat tttgggattg cctttttttt cctcaaaaga taattttgcc aaaataaaac 1980
aaaaatgtag atgtttcaag gtatatacta ttttagttta aagaatgaca actaaagttc 2040
ttcccagaaa ctctgctgga aggtaaatta aaatatgtat ttccattggt aaaatgttgt 2100
tgcactctac caaccaaaag acaatcgttg aagctggaga accgaatgga acccatctta 2160
aaagcccccg acgtgcccct gcctcctcag accactctgg ccagccctcc actggggcag 2220
ccgcagcaat gtgaacgcat ctggggaccg gcaccgcctg tgtgggacca cctctgggga 2280
ttcccaccca tgaccttctg cagcttcaga ggatgtggga caaatgaagg ttttacgaga 2340
ctctactaga agtaaatgtt aacactgttc ttcagaacca ctttgtattt ctgattctgt 2400
taggtttttt ctttcattaa acacaaacaa agcttttgtg tgtgtaggaa gttgaacccc 2460
tgcaggcttt tgatctctca aatgaaagga tcaatattaa gtaaagtggc tgtcagctgg 2520
gtcgaagaca aggcgcttta aaatagagat aatttgctct tgagctgtaa gaagatggtg 2580
tcaaaaaggt aggcggtgag gatggaggta cacgtggctt gtgtcttagg tatgcggaag 2640
agacctcctc ggccgcatga ggggaaaagt gtgcacaact tactgtgtac aaagagggtt 2700
tcttttagtt attatctgcc ttttctctgt ctgagtttag aggagaggaa acgtatcagg 2760
ttaattgaac taattttaat tttaaattag gtgactgtaa cctccaaatg gaacagcaga 2820
ggaatgctag tggagaccac aagatatggc tgtcgggact gattctacaa taggtacaga 2880
tggaggatgt aagtcttagg tgatagtgtc acgtcttagg agtgctgact cagtttattt 2940
ttattttcat gacgttcagc tcacttttta atttattatt gttttcttct ctgcagcgct 3000
tgcgcagaac atctctccac ctgttcagtt atgtaggcac acacacttct gagcagcagg 3060
agtcaaatca ttgacagggc cagtattcct tagcaacagg agcataataa agggtacaat 3120
tgtacacatc cctctcaacc ttattcattt acttcctgac tgtggctttc ttatgctgct 3180
tagaattctc tagtgtgtag caaagaattg ggaagcccct cttctttgcc cttgaaaaaa 3240
aaaaaaaaaa aaaaa 3255
<210> 3
<211> 23
<212> RNA
<213>artificial synthesized
<400> 3
ccgucugaua uauuucuguc ucu 23
<210> 4
<211> 23
<212> RNA
<213>artificial synthesized
<400> 4
ccagcuggcc uccucuguag uga 23
<210> 5
<211> 23
<212> DNA
<213>artificial synthesized
<400> 5
agagacagaa atatatcaga cgg 23
<210> 6
<211> 23
<212> DNA
<213>artificial synthesized
<400> 6
tcactacaga ggaggccagc tgg 23
<210> 7
<211> 160
<212> DNA
<213>artificial synthesized
<400> 7
tttggatggg aaagtggcgt ggcgaaaagg tagctgtgaa agtgttcttc actacagagg 60
aagctagctg gttccgagag acagaaatat accggacggt gttgatgagg catgaaaaca 120
tcttgggtga gtataagtct gtattagcga tgttcagggt 160
<210> 8
<211> 4224
<212> RNA
<213>artificial synthesized
<400> 8
auggacuaua aggaccacga cggagacuac aaggaucaug auauugauua caaagacgau 60
gacgauaaga uggccccaaa gaagaagcgg aaggucggua uccacggagu cccagcagcc 120
gacaagaagu acagcaucgg ccuggacauc ggcaccaacu cugugggcug ggccgugauc 180
accgacgagu acaaggugcc cagcaagaaa uucaaggugc ugggcaacac cgaccggcac 240
agcaucaaga agaaccugau cggagcccug cuguucgaca gcggcgaaac agccgaggcc 300
acccggcuga agagaaccgc cagaagaaga uacaccagac ggaagaaccg gaucugcuau 360
cugcaagaga ucuucagcaa cgagauggcc aagguggacg acagcuucuu ccacagacug 420
gaagaguccu uccuggugga agaggauaag aagcacgagc ggcaccccau cuucggcaac 480
aucguggacg agguggccua ccacgagaag uaccccacca ucuaccaccu gagaaagaaa 540
cugguggaca gcaccgacaa ggccgaccug cggcugaucu aucuggcccu ggcccacaug 600
aucaaguucc ggggccacuu ccugaucgag ggcgaccuga accccgacaa cagcgacgug 660
gacaagcugu ucauccagcu ggugcagacc uacaaccagc uguucgagga aaaccccauc 720
aacgccagcg gcguggacgc caaggccauc cugucugcca gacugagcaa gagcagacgg 780
cuggaaaauc ugaucgccca gcugcccggc gagaagaaga auggccuguu cggcaaccug 840
auugcccuga gccugggccu gacccccaac uucaagagca acuucgaccu ggccgaggau 900
gccaaacugc agcugagcaa ggacaccuac gacgacgacc uggacaaccu gcuggcccag 960
aucggcgacc aguacgccga ccuguuucug gccgccaaga accuguccga cgccauccug 1020
cugagcgaca uccugagagu gaacaccgag aucaccaagg ccccccugag cgccucuaug 1080
aucaagagau acgacgagca ccaccaggac cugacccugc uuaaggcucu cgugcggcag 1140
cagcugccug agaaguacaa agagauuuuc uucgaccaga gcaagaacgg cuacgccggc 1200
uacauugacg gcggagccag ccaggaagag uucuacaagu ucaucaagcc cauccuggaa 1260
aagauggacg gcaccgagga acugcucgug aagcugaaca gagaggaccu gcugcggaag 1320
cagcggaccu ucgacaacgg cagcaucccc caccagaucc accugggaga gcugcacgcc 1380
auucugcggc ggcaggaaga uuuuuaccca uuccugaagg acaaccggga aaagaucgag 1440
aagauccuga ccuuccgcau ccccuacuac gugggcccuc uggccagggg aaacagcaga 1500
uucgccugga ugaccagaaa gagcgaggaa accaucaccc ccuggaacuu cgaggaagug 1560
guggacaagg gcgcuuccgc ccagagcuuc aucgagcgga ugaccaacuu cgauaagaac 1620
cugcccaacg agaaggugcu gcccaagcac agccugcugu acgaguacuu caccguguau 1680
aacgagcuga ccaaagugaa auacgugacc gagggaauga gaaagcccgc cuuccugagc 1740
ggcgagcaga aaaaggccau cguggaccug cuguucaaga ccaaccggaa agugaccgug 1800
aagcagcuga aagaggacua cuucaagaaa aucgagugcu ucgacuccgu ggaaaucucc 1860
ggcguggaag aucgguucaa cgccucccug ggcacauacc acgaucugcu gaaaauuauc 1920
aaggacaagg acuuccugga caaugaggaa aacgaggaca uucuggaaga uaucgugcug 1980
acccugacac uguuugagga cagagagaug aucgaggaac ggcugaaaac cuaugcccac 2040
cuguucgacg acaaagugau gaagcagcug aagcggcgga gauacaccgg uuggggcagg 2100
cugagccgga agcugaucaa cggcauccgg gacaagcagu ccggcaagac aauccuggau 2160
uuccugaagu ccgacggcuu cgccaacaga aacuucaugc agcugaucca cgacgacagc 2220
cugaccuuua aagaggacau ccagaaagcc cagguguccg gccagggcga uagccugcac 2280
gagcacauug ccaaucuggc cggcagcccc gccauuaaga agggcauccu gcagacagug 2340
aagguggugg acgagcucgu gaaagugaug ggccggcaca agcccgagaa caucgugauc 2400
gaaauggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaaug 2460
aagcggaucg aagagggcau caaagagcug ggcagccaga uccugaaaga acaccccgug 2520
gaaaacaccc agcugcagaa cgagaagcug uaccuguacu accugcagaa ugggcgggau 2580
auguacgugg accaggaacu ggacaucaac cggcuguccg acuacgaugu ggaccauauc 2640
gugccucaga gcuuucugaa ggacgacucc aucgacaaca aggugcugac cagaagcgac 2700
aagaaccggg gcaagagcga caacgugccc uccgaagagg ucgugaagaa gaugaagaac 2760
uacuggcggc agcugcugaa cgccaagcug auuacccaga gaaaguucga caaucugacc 2820
aaggccgaga gaggcggccu gagcgaacug gauaaggccg gcuucaucaa gagacagcug 2880
guggaaaccc ggcagaucac aaagcacgug gcacagaucc uggacucccg gaugaacacu 2940
aaguacgacg agaaugacaa gcugauccgg gaagugaaag ugaucacccu gaaguccaag 3000
cugguguccg auuuccggaa ggauuuccag uuuuacaaag ugcgcgagau caacaacuac 3060
caccacgccc acgacgccua ccugaacgcc gucgugggaa ccgcccugau caaaaaguac 3120
ccuaagcucg agagcgaguu cguguacggc gacuacaagg uguacgacgu gcggaagaug 3180
aucgccaaga gcgagcagga aaucggcaag gcuaccgcca aguacuucuu cuacagcaac 3240
aucaugaacu uuuucaagac cgagauuacc cuggccaacg gcgagauccg gaagcggccu 3300
cugaucgaga caaacggcga aaccggggag aucguguggg auaagggccg ggauuuugcc 3360
accgugcgga aagugcugag caugccccaa gugaauaucg ugaaaaagac cgaggugcag 3420
acaggcggcu ucagcaaaga gucuauccug cccaagagga acagcgauaa gcugaucgcc 3480
agaaagaagg acugggaccc uaagaaguac ggcggcuucg acagccccac cguggccuau 3540
ucugugcugg ugguggccaa aguggaaaag ggcaagucca agaaacugaa gagugugaaa 3600
gagcugcugg ggaucaccau cauggaaaga agcagcuucg agaagaaucc caucgacuuu 3660
cuggaagcca agggcuacaa agaagugaaa aaggaccuga ucaucaagcu gccuaaguac 3720
ucccuguucg agcuggaaaa cggccggaag agaaugcugg ccucugccgg cgaacugcag 3780
aagggaaacg aacuggcccu gcccuccaaa uaugugaacu uccuguaccu ggccagccac 3840
uaugagaagc ugaagggcuc ccccgaggau aaugagcaga aacagcuguu uguggaacag 3900
cacaagcacu accuggacga gaucaucgag cagaucagcg aguucuccaa gagagugauc 3960
cuggccgacg cuaaucugga caaagugcug uccgccuaca acaagcaccg ggauaagccc 4020
aucagagagc aggccgagaa uaucauccac cuguuuaccc ugaccaaucu gggagccccu 4080
gccgccuuca aguacuuuga caccaccauc gaccggaaga gguacaccag caccaaagag 4140
gugcuggacg ccacccugau ccaccagagc aucaccggcc uguacgagac acggaucgac 4200
cugucucagc ugggaggcga cuaa 4224
Claims (10)
1. the system of targeting modification sheep FecB gene that can be special, it is characterised in that: including two sgRNA and three
Oligo DNA sequence dna, wherein two sgRNA are sgRNAFecB- 1 and sgRNAFecB- 2, it is the sequence 3 and 4 of sequence table
RNA shown in the nucleotide or RNA with the sequence;Three Oligo DNA sequence dnas be sequence table sequence 5,6 and 7 or
DNA with the sequence.
2. the system of targeting modification sheep FecB gene that as described in claim 1 can be special, it is characterised in that: described
SgRNA and Oligo DNA is RNA and DNA shown in the sequence 3-7 of sequence table.
3. encoding sgRNA described in claim 1FecB- the 1 and sgRNAFecB- 2 DNA molecular.
4. DNA molecular as claimed in claim 3, it is characterised in that: sgRNA described in coding claim 1FecB- 1 DNA
Molecule is the DNA molecular shown in the nucleotide of 5 ' end the 885th to 904 of sequence 2 of sequence table;Encode institute in claim 1
State sgRNAFecB- 2 DNA molecular is the DNA molecular shown in the nucleotide of 5 ' end the 857th to 876 of sequence 2 of sequence table.
5. the targeting sequence for the targeting modification sheep FecB gene that one kind can be special, it is characterised in that: be the sequence 3 of sequence table
Or nucleotide shown in 4.
6. the complete nucleic acid molecules of species specificity editor's sheep FecB gene, it is characterised in that: including claim 1 or 3 institutes
SgRNA the and Cas9 mRNA stated.
7. the complete nucleic acid molecules of species specificity editor's sheep FecB gene, it is characterised in that: including claim 3 or 4 institutes
The DNA molecular stated.
8. the method for species specificity editor's sheep FecB gene, it is characterised in that: by can be special described in claim 1 and 6
SgRNA, Cas9 mRNA and Oligo DNA cotransfection ovine cells of different targeting modification sheep FecB gene, to edit silk floss
Sheep FecB gene.
9. the method for specificity editor sheep FecB gene as claimed in claim 8, it is characterised in that: the side of the cotransfection
Formula is co-injection, and the ovine cells are that sheep zygotes are unicellular.
10. the sheep FecB gene as described in claim 5-8, it is characterised in that: egg shown in the sequence 1 for polynucleotide
The gene of white matter.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910187375.6A CN110129320B (en) | 2019-03-13 | 2019-03-13 | Method for obtaining gene editing sheep and sgRNA and Oligo DNA special for same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910187375.6A CN110129320B (en) | 2019-03-13 | 2019-03-13 | Method for obtaining gene editing sheep and sgRNA and Oligo DNA special for same |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110129320A true CN110129320A (en) | 2019-08-16 |
CN110129320B CN110129320B (en) | 2020-04-17 |
Family
ID=67568810
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910187375.6A Active CN110129320B (en) | 2019-03-13 | 2019-03-13 | Method for obtaining gene editing sheep and sgRNA and Oligo DNA special for same |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110129320B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114262708A (en) * | 2021-12-21 | 2022-04-01 | 西北农林科技大学 | Kit and method for producing FecB gene g.A746G site-directed mutagenesis sheep |
CN114262708B (en) * | 2021-12-21 | 2024-07-02 | 西北农林科技大学 | Kit and method for producing FecB gene g.A746G site-directed mutagenesis sheep |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105039339A (en) * | 2015-06-05 | 2015-11-11 | 新疆畜牧科学院生物技术研究所 | Method for knockout of sheep FecB gene through RNA-mediated specificity and special sgRNA of method |
CN108048487A (en) * | 2017-12-19 | 2018-05-18 | 江西农业大学 | A kind of BMPR-IB genetic methods edited in pig category fetal fibroblast |
-
2019
- 2019-03-13 CN CN201910187375.6A patent/CN110129320B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105039339A (en) * | 2015-06-05 | 2015-11-11 | 新疆畜牧科学院生物技术研究所 | Method for knockout of sheep FecB gene through RNA-mediated specificity and special sgRNA of method |
CN108048487A (en) * | 2017-12-19 | 2018-05-18 | 江西农业大学 | A kind of BMPR-IB genetic methods edited in pig category fetal fibroblast |
Non-Patent Citations (2)
Title |
---|
MULSANT P等: "AF298885.1", 《GENBANK》 * |
SHIWEI ZHOU等: "Generation of gene-edited sheep with a defined Booroola fecundity gene (FecBB) mutation in bone morphogenetic protein receptor type 1B (BMPR1B) via clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (Cas) 9", 《REPRODUCTION, FERTILITY AND DEVELOPMENT》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114262708A (en) * | 2021-12-21 | 2022-04-01 | 西北农林科技大学 | Kit and method for producing FecB gene g.A746G site-directed mutagenesis sheep |
CN114262708B (en) * | 2021-12-21 | 2024-07-02 | 西北农林科技大学 | Kit and method for producing FecB gene g.A746G site-directed mutagenesis sheep |
Also Published As
Publication number | Publication date |
---|---|
CN110129320B (en) | 2020-04-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107043787B (en) | A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 | |
CN105039339B (en) | A kind of method of specific knockdown sheep FecB genes with RNA mediations and its special sgRNA | |
CN105132427B (en) | A kind of dual-gene method for obtaining gene editing sheep of specific knockdown mediated with RNA and its dedicated sgRNA | |
CN105950626B (en) | The method of different hair color sheep is obtained based on CRISPR/Cas9 and targets the sgRNA of ASIP genes | |
CN108660161A (en) | Method of the preparation based on CRISPR/Cas9 technologies without mosaic gene knock-out animal | |
CN107217099B (en) | A kind of SNP marker and its application can be used for snakehead genetic sex and the identification of supermale fish | |
CN108546766B (en) | SNP molecular marker related to pig litter traits, identification and combined application thereof | |
CN106119284A (en) | A kind of product for building immunodeficient animals model and application thereof | |
CN109706184A (en) | The method for building up of self-closing disease model dog | |
CN114657264B (en) | Clarias fuscus sex-specific molecular marker primer and application thereof | |
CN113088521A (en) | Construction method of Ahnak2 gene knockout animal model based on CRISPR/Cas9 technology | |
CN110066805A (en) | The method of gene knockout breeding adgrf3b Gene Deletion zebra fish | |
CN113234756A (en) | Construction method of LAMA3 gene knockout animal model based on CRISPR/Cas9 technology | |
Womack | Genetic engineering in agriculture: animal genetics and development | |
CN115720874A (en) | Creating method and application of inonotus spiny germplasm for cultured economic fishes | |
KR101390536B1 (en) | Mass producing method for high meat quality korean native cattle by in vitro fertilization technique | |
CN105132426B (en) | A kind of specific knockdown FGF5 genes with RNA mediations obtain the method for gene editing sheep and its special sgRNA | |
CN110129320A (en) | A kind of method obtaining gene editing sheep and its dedicated sgRNA and Oligo DNA | |
CN103952424B (en) | Method for producing double-muscular trait somatic cell cloned pig with MSTN (myostatin) bilateral gene knockout | |
CN109486957A (en) | Pig multiple groups integrate accurate breeding method | |
Fair et al. | Developments in the use of embryo technologies in dairy cows | |
CN116240276B (en) | Catfish male-specific molecular marker, primer, kit, application and male or pseudo male identification and production method of total female fish | |
Delhotal | Characterization of NHLRC2 gene-edited mice: a model for bovine developmental duplications | |
AU2021273641B2 (en) | Nucleic acid, kit, and method for breeding short-tailed sheep through homology-directed repair (hdr)-mediated gene editing, and use thereof | |
CN117305303A (en) | Method for cultivating high-fertility fine wool sheep |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |