CN110117818A - Detect the CRISPR high flux biochip of single gene mutation - Google Patents

Abstract

The invention discloses a kind of CRISPR high flux biochips for detecting single gene mutation, utilize the non-specificity to single stranded DNA cutting generated after CRISPR-Cas12a protein-specific cutting double-stranded DNA, pass through the variation of the fluorescence power produced by after Cas12a albumen Non-specific cleavage of single-stranded fluorescence probe, the CRISPR high flux biochip of building detection single gene mutation.The present invention modifies chip base using hydrophobin, chip base by hydrophobin modification is compared with common substrate, sprawl hydrophilic protein Cas12a uniformly in chip surface, also avoid albumen and the waste of crRNA, guarantee that target gene still has preferable testing result at low concentrations, and realize the detection of 1 copy of target gene, have compared with the detection of common single-gene disorder high-efficient, it is at low cost, period is short, the characteristics of high specificity, and detection material settling out, operation difficulty is low, visual result is reliable, extremely it is expected to investment practical application.

Description

Detect the CRISPR high flux biochip of single gene mutation

Technical field

The invention belongs to field of biotechnology, specifically, the present invention relates to a kind of CRISPR for detecting single gene mutation High flux biochip and construction method.

Background technique

Monogenic disease (monogenic disease) refer mainly to by a pair of alleles be mutated caused by disease, be divided by Two kinds of situations caused by dominant gene and recessive gene mutation.In clinical diagnosis, there are many disease by monogenic mutation And cause.Since single-gene disorder has its unique characterizing gene mutational site, can develop for specific list The nucleic acid molecules of genopathy detect.Diagnostic nucleic acid (NADs nucleic acid diagnostics) is to use molecular biology Theory and technology, by directly detecting the existence of different plant species specific nucleic acid, from nucleic acid self structure, duplication, transcription Or the function of translation process analysis nucleic acid, thus the method for targetedly making diagnosis.Similar also monokaryon glycosides Sour polymorphism (SNPs, single nucleotide polymorphisms) detection, SNPs are widely present in human genome In, occurrence frequency is about that the development of 1% or higher, SNPs detection technique is particularly important for gene samples detection.

But above-mentioned single gene mutation disease detection the technical issues of there is only non-artificial operations, and can only examine every time A few even a kind of single-gene disorder is surveyed, in addition detection technique cost is excessively high, these technologies are in single gene mutation disease It is not widely used in detection.

Due to DNA molecular high stability, current NADs method is detected to DNA molecular mostly, also there is part Method is detected for RNA molecule.The step of carrying out nucleic acid molecules detection substantially two steps: the first step is the expansion of target dna Increase, second step is the detection of target dna.There are two types of forms for the variation of SNP nucleotide: one is conversion, another kind is transversion. With the continuous development of biotechnology, there is a kind of high-throughput, higher SNP detection method of the degree of automation, such as directly survey Sequence, DNA chip etc..Currently, Ang Fei company, the U.S. is detected using molecule hybridization and fluorescence in situ, the height of SNPs detection has been made Throughput biological chip, but chip design cost is high, and some SNP cannot be detected.

Biochip is according to the principle specifically to interact between biomolecule, by biochemical analysis process integration in chip list Face, to realize the high throughput quickly detection to DNA, RNA, polypeptide, protein and other biological ingredient.It can be used as various inspections The operating platform of survey method can carry out the experimental analysis of a large amount of differential responses conditions and output data simultaneously, realize to not With while target, the detection of high speed.

Hydrophobin is small point that a kind of high filamentous fungi has special physico-chemical property in one kind that the specific period generates Son amount (12KD or so) protein, protein structure is more special, both contains hydrophilic-structure, also contains hydrophobic structure, whole to tie It is shown as on structure amphiphilic.The amphiphilic of hydrophobin keeps its image surface activating agent the same, and major function is independently to be mounted in Any hydrophilic/hydrophobic surface forms one layer of amphiphilic film to change surface nature.Hydrophobin be known surface-active most One of high protein has the characteristics such as high temperature resistant, acid and alkali-resistance, can try out the knot of the protein molecular arrangement in adjustment practical operation Structure has very high theoretical value and application value to realize higher reaction efficiency in actual production.

CRISPR-Cas12a albumen is that a kind of enzyme of RNA guidance is gathered around as the component of bacterial adaptation immune system Have that T is enriched with it is preceding between region sequence adjacent to motif (PAM), the guidance RNA (crRNA) that can be catalyzed themselves is mature and generate one The irregular double-stranded DNA breakpoint in the end PAM.Cas12a albumen is after specificity cutting, moreover it is possible to which the non-specificity that differentiation is not added is cut It is single-stranded to cut DNA, using this peculiar property, whether we can complete cutting function by fluorescence probe detection system.

Summary of the invention

The purpose of the present invention is to provide a kind of CRISPR high flux biochips for detecting single gene mutation, overcome existing The problems such as insufficient such as small throughput, Gao Chengben, technological deficiency of technology biochip.

The technical solution of the present invention is as follows:

The CRISPR high flux biochip of single gene mutation is detected, construction method includes the following steps:

(1) chemical synthesis contains the coli expression carrier of Cas12a protein sequence, containing the PAM (area PAM Zhi Qianjian sequence The neighbouring motif of column is that Cas12a exercises identification sequence necessary to cutting function, and the PAM sequence of FnCas12a is the special of TTN) Property substrate, the PCR upstream primer containing PAM sequence, downstream primer, fluorescence probe, and correspond to FnCas12a and corresponding single (crRNA, i.e. guide RNA refer to guidance FnCas12a protein-specific combination target DNA's to the crRNA of gene mutation disease RNA, crRNA are about 43bp), determine expression of the Cas12a albumen in Escherichia coli recombinant plasmid；

(2) compound of Cas12a and crRNA (plasmid including synthesis and by design contains PAM to specific substrate The obtained long 140bp of upstream primer PCR amplification or so segment) --- double-stranded DNA carries out the structure of the system of specific cutting Build, including to double-stranded DNA cutting experiment ratio optimization, to the cutting of pcr amplified fragment；

(3) compound of Cas12a and crRNA carries out single stranded DNA (single stranded DNA and fluorescence probe including synthesis) non- The building of the system of specificity cutting, including the cutting to common single stranded DNA, the cutting to fluorescence probe single stranded DNA；

(4) chip base is subjected to hydrophobin modification；

(5) high-throughput chip base, fixation, compound including hydrophobin to FnCas12a-crRNA compound are constructed Specificity cutting to specific substrate and to the Non-specific cleavage of fluorescence probe.

Step (4) hydrophobin refers to some amphiphilic albumen, can be received at two-phase interface by self being assembled to form The Amphiphilic proteins film of meter level thickness.Step (4) hydrophobin refers to HGF I, HFB I.

The Cas12a albumen is preferably FnCas12a albumen.

The construction method for detecting the CRISPR high flux biochip of single gene mutation, includes the following steps:

(1) chemical synthesis contains the coli expression carrier of Cas12a protein sequence, specific substrate, contains PAM sequence The PCR upstream primer of column, downstream primer, fluorescence probe, and corresponding to Cas12a and corresponding single gene mutation disease CrRNA determines expression of the FnCas12a albumen in Escherichia coli recombinant plasmid；

(2) compound of Cas12a and crRNA is to specific substrate --- and double-stranded DNA carries out the system of specific cutting Building, including to double-stranded DNA cutting experiment ratio optimization, to the cutting of pcr amplified fragment；

(3) compound of Cas12a and crRNA carries out the building of the system of Non-specific cleavage to single stranded DNA, including right Cutting, the cutting to fluorescence probe single stranded DNA of common single stranded DNA；

(4) chip base is subjected to hydrophobin modification；

(5) high-throughput chip base, fixation, compound pair including hydrophobin to Cas12a-crRNA compound are constructed The specificity cutting of specific substrate and the Non-specific cleavage to fluorescence probe.

Step (4) hydrophobin refers to some amphiphilic albumen, can be received at two-phase interface by self being assembled to form The Amphiphilic proteins film of meter level thickness.Step (4) hydrophobin refers to HGF I, HFB I.

The Cas12a albumen is preferably FnCas12a albumen.

Detect the application of the CRISPR high flux biochip of single gene mutation.

The invention has the advantages that: the present invention to modify chip base using hydrophobin, modifies by hydrophobin Chip base compared with common substrate, sprawl hydrophilic protein Cas12a uniformly in chip surface, it is thus also avoided that albumen With the waste of crRNA, guarantee that target gene still has preferable testing result at low concentrations, and realizes 1 of target gene The detection of copy has the characteristics that high-efficient, at low cost, the period is short, high specificity compared with the detection of common single-gene disorder, and Detection material settling out, operation difficulty are low, and visual result is reliable, are extremely expected to investment practical application.

Detailed description of the invention

Fig. 1 shows the Cas12a of 2 kinds of separate sources --- the Western Blot of FnCas12a, LbCas12a scheme；

Fig. 2 shows the agarose gel electrophoresis figure of specific substrate；Wherein:

Fig. 2A shows the agarose gel electrophoresis figure of two kinds of plasmids pDsRed-Monomer-N1, pAcGFP1-N1；

Fig. 2 B shows the agarose gel electrophoresis figure of activating transcription factor GATA4 expression vector；

Fig. 2 C shows the agarose gel electrophoresis figure of the PCR fragment of plasmid pAcGFP1-N1；

Fig. 3 shows the characteristic of FnCas12a cleavage specificity double-stranded DNA；Wherein:

Fig. 3 A is the protein ladder electrophoresis result figure that FnCas12a specificity cuts plasmid；

Fig. 3 B is the plasmid gradient electrophoresis result figure that FnCas12a specificity cuts plasmid；

Fig. 3 C is the optimization sample ratio gradient electrophoresis result figure that FnCas12a specificity cuts plasmid；

Fig. 3 D is the optimal sample ratio electrophoresis result figure that FnCas12a specificity cuts plasmid；

Fig. 3 E is the optimal sample ratio electrophoresis result figure that FnCas12a specificity cuts two kinds of plasmids；

Fig. 3 F is the electrophoresis result figure for the PCR fragment that FnCas12a specificity cuts plasmid；

Fig. 4 shows that FnCas12a cuts the characteristic of non-specific single stranded DNA；Wherein:

Fig. 4 A shows that FnCas12a cuts non-specific single stranded DNA --- the characteristic of EGFP；

Fig. 4 B shows that FnCas12a cuts the single stranded DNA gradient electrophoresis result figure of non-specific single stranded DNA；

Fig. 5 shows the fluorescence values of FnCas12a Non-specific cleavage fluorescence probe；Wherein:

Fig. 5 A shows the probe gradient fluorescence values of FnCas12a Non-specific cleavage fluorescence probe；

Fig. 5 B shows the probe lowest detection line fluorescence values of FnCas12a cutting fluorescence probe；

Fig. 5 C shows the Effect of Materials fluorescence values of FnCas12a Non-specific cleavage fluorescence probe；

Fig. 6 shows the flow diagram of the CRISPR cleavage reaction of hydrophobin modification chip；

Fig. 7 shows the fluorescence inspection of CRISPR cleavage reaction on hydrophobin modification and the chip modified without hydrophobin Survey result figure.

Specific embodiment

Below in conjunction with the attached drawing in the specific embodiment of the invention, the technical solution in the present invention is carried out further It is bright.

Term:

Term " guide RNA " refers to the RNA of guidance Cas protein-specific combination target DNA sequence dna.

Term " crRNA " refers to CRISPR RNA, is short guidance Cas12a to the RNA for being integrated to target DNA sequence dna.

Term " CRISPR " refers to cluster, regular intervals short palindrome repetitive sequence (clustered regularly Interspaced short palindromic repeats), which is the immune system of many prokaryotes.

Term " Cas albumen " refers to CRISPR-associated albumen, it is the GAP-associated protein GAP in CRISPR system.

Term " Cas12a " (being once called as " Cpf1 ") refers to the restriction endonuclease that crRNA is relied on, it is V-type in CRISPR genealogical classification The enzyme of (type V).

Term " PAM " between before referring to region sequence be Cas12a adjacent to motif (protospacer-adjacent motif) Cutting institute is necessary, and the PAM of FnCas12a is TTN sequence, and the PAM of LbCas12a is TTTN sequence.

Material:

RNase inhibitor is purchased from Solarbio company；Primer (oligonucleotides), Single-stranded DNA fragments DNMT, guide RNA packet Include pAcGFP1-N1-1, pDsRed-Monomer-N1-1, DNMT-1, FnCas12a protein expression vector, LbCas12a albumen table GENEWIZ company is purchased from up to carrier；Fluorescence probe (FAM-TTATT-BHQ1) is purchased from the limited public affairs of Beijing SBS Genetech gene technology Department；

PAcGFP1-N1, pDsRed-Monomer-N1 are commercially available.

Escherichia coli (E.coli) DH5 α, BL21, are commercially available.

Embodiment 1:FnCas12a specificity cuts the gradient experiment of the optimization sample ratio of pAcGFP1-N1 plasmid

One, the conversion of Escherichia coli (E.coli) BL21 of FnCas12a protein expression vector is pure with FnCas12a albumen Change, the specific steps are as follows:

The conversion of Escherichia coli (E.coli) BL21 of FnCas12a protein expression vector carries out as follows:

1, it takes a pipe competent cell E.coli BL21 to be slowly dissolved on ice, the FnCas12a albumen to be converted is added Expression vector plasmid (10 μ L), light mixed rear ice bath 30min；

2, after 42 DEG C of heat shock 90s, rapid ice bath 5min；

3,900 μ L, the LB culture medium of 37 DEG C of warm bath, 37 DEG C of shaking table culture 1h are added；

4,3000rpm, 3min centrifugation gently mix after abandoning the bacterium solution of 500ul with liquid-transfering gun in aseptic operating platform, take 200 Microlitre it is coated on the LB selection plate containing kanamycins (100 μ g/mL), 37 DEG C of inversion culture 12-16h；

5, picking monoclonal carries out subsequent plasmid extraction and confirmatory experiment.

In above-mentioned steps, the plasmid vector positive colony verifying carries out as follows:

1, the transformant of FnCas12a protein expression vector is picked from the plate, accesses in 5mL LB liquid medium and (contains 100 μ g/mL kanamycins), 37 DEG C of shaking table culture 12-16h；

2,5mL bacterium solution is taken, extracts plasmid with small amount plasmid extraction kit；

3,1 μ L plasmid extracting solution is taken to carry out Nanodrop detection, the plasmid concentration and purity of Detection and Extraction；

4, the plasmid extracted is put into -20 DEG C of preservations.

In above-mentioned steps, FnCas12a protein purification carries out as follows:

1, the suitable monoclonal of apparent surrounding bacterium colony on picking plate accesses in 5mL LB liquid medium and (contains 100 μ G/mL kanamycins), 37 DEG C of shaking table culture 6h；

2, (contain 100 μ g/mL kanamycins) in the bacterium solution access access 1L LB Liquid Culture bottle for being about 0.5 by OD value, 37 DEG C shaking table culture 6h；

3, shaking table temperature is adjusted to 16 DEG C, cool down 30min, 500 μ l IPTG induction is added in every bottle of culture medium, 16 DEG C are shaken Bed culture 16h；

4,4000rpm, bacterium 15min is received in centrifugation at 4 DEG C, with washing miscellaneous buffer [50mM Tris-HCl (pH8.0), 1.5M NaCl, 5%glycerol] thallus is resuspended, it breaks bacterium device and breaks bacterium；

5,18000rpm is centrifuged 40min at 4 DEG C, collects supernatant, carries out affinity chromatography, runs glue verifying；With 50mM Tris- HCl (pH8.0), 1mM DTT, 5%glycerol change liquid, are diluted to salinity in 80mM or less；

6, protein chromatographic purification is carried out, SDS-PAGE electrophoresis runs glue, and Fig. 1 shows FnCas12a, LbCas12a Western Blot figure.

Two, the conversion of Escherichia coli (E.coli) the DH5 α of pAcGFP1-N1, pDsRed-Monomer-N1 plasmid, specifically Steps are as follows:

1, it takes 2 pipe competent cell E.coli DH5 α to be slowly dissolved on ice, is separately added into the pAcGFP1- to be converted N1, pDsRed-Monomer-N1 plasmid (each 10 μ L), light mixed rear ice bath 30min；

2, after 42 DEG C of heat shock 90s, rapid ice bath 5min；

3,900 μ L, the LB culture medium of 37 DEG C of warm bath, 37 DEG C of shaking table culture 1h are added；

4,3000rpm, 3min centrifugation are gently mixed after abandoning the bacterium solution of 500ul with liquid-transfering gun, are respectively taken in aseptic operating platform 12-16h is cultivated in 200 microlitres of LB selection plates being coated on containing kanamycins (100 μ g/mL), 37 DEG C of inversions；

5, picking monoclonal carries out subsequent plasmid extraction and confirmatory experiment.

In above-mentioned steps, the plasmid vector positive colony verifying carries out as follows:

1, the transformant of pAcGFP1-N1, pDsRed-Monomer-N1 are picked from the plate respectively, access 5mL LB liquid (contain 100 μ g/mL kanamycins) in culture medium, 37 DEG C of shaking table culture 12-16h；

2,5mL bacterium solution is taken respectively, extracts plasmid with small amount plasmid extraction kit；

3,1 μ L plasmid extracting solution is taken to carry out Nanodrop detection, the plasmid concentration and purity of Detection and Extraction respectively；

4, the plasmid extracted is put into -20 DEG C of preservations.Fig. 2A show two kinds of plasmid pDsRed-Monomer-N1, The agarose gel electrophoresis figure of pAcGFP1-N1.

Three, the protein ladder of FnCas12a specificity cutting pAcGFP1-N1 plasmid optimizes experiment, the specific steps are as follows:

1, in four kinds of 20uL reaction systems, be separately added into step 1 purifying FnCas12a (62.5nM, 125nM, 187.5nM, 250nM), guide RNA --- pAcGFP1-N1-1 (0.5uM), pAcGFP1-N1 plasmid 1uL, RNase inhibitor 3 polishing of 0.5uL, buffer NEB buffer.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, polyacrylamide gel electrophoresis is carried out, Fig. 3 A shows the protein ladder of FnCas12a specificity cutting plasmid Electrophoresis result figure.As a result illustrate, can specific substrate cut related with the content of FnCas12a albumen completely.

Four, the plasmid gradient optimizing experiment of FnCas12a specificity cutting pAcGFP1-N1, the specific steps are as follows:

1, in six kinds of 20uL reaction systems, the FnCas12a (125nM) of step 1 purifying, guide are separately added into

RNA --- pAcGFP1-N1-1 (0.5uM), pAcGFP1-N1 plasmid (250ng, 300ng, 350ng, 400ng, 450ng, 500ng), RNase inhibitor 0.5uL, 3 polishing of buffer NEB buffer.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, polyacrylamide gel electrophoresis is carried out, Fig. 3 B shows the plasmid gradient electricity of FnCas12a specificity cutting plasmid Swimming result figure.As a result illustrate, the dosage of specific substrate will have certain suitable ratio with the dosage of material.

Five, the sample ratio gradient optimizing experiment of FnCas12a specificity cutting pAcGFP1-N1 plasmid, specific steps are such as Under:

1, in three groups of 20uL reaction systems, be separately added into step 1 purifying FnCas12a (0.5uM, 1.25uM, 2.5uM, 5uM, 12.5uM, 25uM), wherein first group of guide RNA --- pAcGFP1-N1-1 (500nM), second group of guide RNA --- PAcGFP1-N1-1 (250nM), third group guide RNA --- pAcGFP1-N1-1 (50nM), pAcGFP1-N1 plasmid (1uL), 3 polishing of RNase inhibitor 0.5uL, buffer NEB buffer.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, polyacrylamide gel electrophoresis is carried out, Fig. 3 C shows the sample ratio ladder of FnCas12a specificity cutting plasmid Degree optimization electrophoresis result figure.As a result illustrate, what is played a decisive role to specific substrate cutting result is guide RNA and substrate Ratio.Six, the sample most ratio of greater inequality experiment of FnCas12a specificity cutting pAcGFP1-N1 plasmid, the specific steps are as follows:

1, in 20uL reaction system, the FnCas12a (0.25uM) of step 1 purifying, guide is added

RNA --- pAcGFP1-N1-1 (0.25uM), pAcGFP1-N1 plasmid (1uL), RNase inhibitor 0.5uL, buffering 3 polishing of liquid NEB buffer.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, carry out polyacrylamide gel electrophoresis, Fig. 3 D, 3E show FnCas12a specificity cutting pAcGFP1-N1, The sample of pDsRed-Monomer-N1 plasmid most ratio of greater inequality electrophoresis result figure (10:10:1).

Embodiment 2:FnCas12a specificity cuts the PCR fragment of pAcGFP1-N1, pDsRed-Monomer-N1 plasmid Experimental design and building, include the following steps:

One, with 1 step 1 of embodiment.

Two, with 1 step 2 of embodiment.

Three, pAcGFP1-N1, pDsRed-Monomer-N1 plasmid fragments are obtained using PCR, the specific steps are as follows:

Design upstream primer GFP-F/RED-F and downstream primer GFP-R/RED-R, with the pAcGFP1-N1 of purifying, PDsRed-Monomer-N1 plasmid is template amplification pAcGFP1-N1, pDsRed-Monomer-N1 plasmid fragments, and PCR is completed Afterwards, it is directly used in FnCas12a cleavage reaction.Fig. 2 C shows the agarose gel electrophoresis of the PCR fragment of plasmid pAcGFP1-N1 Figure；

GFP-F:GTGGCGATAAGTCGTGTCTTACCGGGT

GFP-R:GTCAAACCGCTATCCACGCCCATTGATG

RED-F:GTACAAGGCCAAGAAGCCCGTGCAG

RED-R:GTCTCTTGATCGATCTTTGCAAAAGCCTAGGC

Four, FnCas12a specificity cuts pAcGFP1-N1, pDsRed-Monomer-N1 plasmid fragments, and specific steps are such as Under:

1, in two kinds of 30uL reaction systems, it is separately added into the FnCas12a (250nM) of purifying, guide RNA --- PAcGFP1-N1-1 (250nM), pDsRed-Monomer-N1-1 (250nM), pAcGFP1-N1 plasmid fragments (10uL), PDsRed-Monomer-N1 plasmid fragments (10uL), RNase inhibitor 0.5uL, buffer NEB buffer3 polishing.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, carry out polyacrylamide gel electrophoresis, Fig. 3 F show FnCas12a specificity cutting pAcGFP1-N1, PDsRed-Monomer-N1 plasmid fragments electrophoresis result figure.As a result illustrate, FnCas12a can specific cutting DNA segment.

The experimental design of the short sequence electrophoresis of embodiment 3:FnCas12a Non-specific cleavage single stranded DNA --- DNMT and structure It builds, includes the following steps:

One, with 1 step 1 of embodiment.

Two, with 1 step 2 of embodiment.

Three, the Property Verification of FnCas12a Non-specific cleavage single stranded DNA, the specific steps are as follows:

1, in 30uL reaction system, by the FnCas12a (1uM) that purifying is added shown in Fig. 4 A table, guide RNA --- PAcGFP1-N1-1 (0.5uM), DNMT-1 (0.5uM), the DNA fragmentation (1uL) of pAcGFP1-N1 plasmid (1uL), DNMT are single-stranded DNA --- EGFP (10uM), RNase inhibitor 0.5uL, 3 polishing of buffer NEB buffer.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, the non-denaturing polyacrylamide gel that configuration concentration is 12%, carries out polyacrylamide gel electrophoresis, and Fig. 4 A is aobvious Show FnCas12a Non-specific cleavage single stranded DNA --- the non denatured electrophoresis result figure of the short sequence of DNMT.As a result illustrate, FnCas12a can only Non-specific cleavage single stranded DNA, be unable to Non-specific cleavage double-stranded DNA.

Four, the optimum experimental of FnCas12a Non-specific cleavage single stranded DNA, the specific steps are as follows:

1, in four kinds of 30uL reaction systems, by the FnCas12a (0.5uM) for being separately added into purifying shown in Fig. 4 B table, guide The DNA fragmentation (0.5uM) of RNA --- DNMT-1 (0.5uM), DNMT, single stranded DNA --- EGFP (1uM, 2uM, 5uM, 6.25uM), 3 polishing of RNase inhibitor 0.5uL, buffer NEB buffer.

2,15min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, the denaturing polyacrylamide gel that configuration concentration is 20%, carries out polyacrylamide gel electrophoresis, and Fig. 4 B is shown FnCas12a Non-specific cleavage single stranded DNA --- the short sequence denaturing electrophoretic result figure of DNMT.As a result illustrate, FnCas12a The amount of Non-specific cleavage single stranded DNA is related with the amount of FnCas12a, guide RNA and specific substrate.

The experimental design and building of the fluorescence detection of embodiment 4:FnCas12a Non-specific cleavage fluorescence probe, including such as Lower step:

One, with 1 step 1 of embodiment.

Two, with 1 step 2 of embodiment.

Three, the probe gradient fluorescence values test experience building of FnCas12a Non-specific cleavage fluorescence probe, including such as Lower step:

1, in 8 groups of 100uL reaction systems, the FnCas12a (250nM) of purifying, guide are separately added into

RNA --- pAcGFP1-N1-1 (250nM), pAcGFP1-N1 plasmid (4uL), (its composition sequence is fluorescence probe TTATT, and 5, mark fluorescent group FAM is held, 3, end marks quencher BHQ1, i.e. FAM-TTATT-BHQ1) (0.5uM, 1uM, 1.5uM, 2uM, 2.5uM, 3uM, 3.5uM, 4uM), RNase inhibitor 2uL, 3 polishing of buffer NEB buffer, every group Respectively in triplicate.

2,60min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, with microplate reader detection (exciting light 492nm emits light 515nm), Fig. 5 A shows that FnCas12a non-specificity is cut The probe gradient fluorescence values for cutting fluorescence probe, as a result illustrate, the amount of fluorescence values and fluorescence probe is directly proportional.

Four, FnCas12a cuts the probe lowest detection line fluorescence values experimental construction of fluorescence probe, includes the following steps:

1, in 8 groups of 100uL reaction systems, it is separately added into the FnCas12a (250nM) of purifying, guide RNA --- PAcGFP1-N1-1 (250nM), pAcGFP1-N1 plasmid (4uL), fluorescence probe (FAM-TTATT-BHQ1) (10uM, 1uM, 0.1uM, 0.01uM, 0.001uM, 0.0001uM, 0.00001uM, 0.000001uM), RNase inhibitor 2uL, buffer NEB 3 polishing of buffer, every group of difference is in triplicate.

2,60min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, show that FnCas12a cutting fluorescence is visited with microplate reader detection (exciting light 492nm, transmitting light 515nm), Fig. 5 B The probe lowest detection line fluorescence values of needle, as a result illustrate, concentration and probe concentration is too low to will affect fluorescence detection sensitivity, and probe is most Low detection is limited up to 60pM.

Five, the experimental construction that the Effect of Materials of FnCas12a Non-specific cleavage fluorescence probe is probed into, includes the following steps:

1, in eight groups of 100uL reaction systems, by the FnCas12a (250nM) that purifying is added shown in Fig. 5 C table, guide RNA --- pAcGFP1-N1-1 (250nM), pAcGFP1-N1 plasmid (4uL), fluorescence probe (FAM-TTATT-BHQ1) (4uM), 3 polishing of RNase inhibitor 2uL, buffer NEB buffer.

2,60min is reacted in 37 DEG C of reactions, then 98 DEG C of 2min terminate reaction.

3, (exciting light 492nm emits light 515nm) is detected with microplate reader, Fig. 5 C shows that FnCas12a non-specificity is cut The fluorescence values for cutting the Effect of Materials of fluorescence probe, as a result illustrate, inspection of the FnCas12a albumen to fluorescence values in blank assay It is bigger than the influence of guide RNA to survey error.

Embodiment 5: the building and application of the CRISPR cleavage reaction of the chip of hydrophobin modification include the following steps:

One, with 1 step 1 of embodiment.

Two, with 1 step 2 of embodiment.

Three, the experimental design of chip base and progress hydrophobin modification, include the following steps:

1, experiment flow dries in ventilation as shown in fig. 6, by chip base progress hydrophobin modification.

2, FnCas12a albumen and guide RNA are added on air-dried hydrophobin and are incubated for, specificity is then added Substrate (pAcGFP1-N1 plasmid, pDsRed-Monomer-N1 plasmid) and fluorescence probe (FAM-TTATT-BHQ1), 37 DEG C of reactions 15min。

Four, the building and application of the CRISPR cleavage reaction of the chip of hydrophobin modification, includes the following steps:

1, three groups of parallel laboratory tests are set, while three groups of parallel laboratory tests without hydrophobin modification, every group of parallel laboratory test are set In, five 5ul reaction systems are set altogether, and pAcGFP1-N1, pDsRed-Monomer-N1 experimental group are separately added into purifying FnCas12a (250nM), guide RNA --- pAcGFP1-N1-1 (250nM), pDsRed-Monomer-N1-1 (250nM), PAcGFP1-N1 plasmid (0.75uL), pDsRed-Monomer-N1 plasmid (0.75uL), fluorescence probe (FAM-TTATT-BHQ1) (1uM), RNase inhibitor 0.25uL, 3 polishing of buffer NEB buffer；PAcGFP1-N1, pDsRed-Monomer-N1 couple Two kinds of crRNA are exchanged according to group, other experiment conditions are constant；FnCas12a albumen is not added in negative control group, other experiment conditions It is constant.

2, it is observed under confocal microscope as a result, Fig. 7 shows hydrophobin modification and modifies without hydrophobin Chip on CRISPR cleavage reaction fluoroscopic examination result figure, as a result illustrate, hydrophobin and FnCas12a albumen pole have can There can be the effect of protein interaction, and the cutting power of FnCas12a albumen can be reinforced.

Detect the foundation of the CRISPR high flux biochip method of single gene mutation disease:

Using the cutting characteristic of FnCas12a and the Modifying Capability of hydrophobin, we have invented specific detection single-genes The CRISPR high flux biochip of mutation diseases, the chip have the characteristics that high-efficient, at low cost, the period is short, high specificity, And detection material settling out, operation difficulty are low, visual result is reliable.

Entire reaction system can be roughly divided into three steps, first is that the cleavage reaction of Cas12a albumen, second is that hydrophobin The chip base fluorescence reaction that HFB I is modified, third is that the high-throughput detection of HFB I fixed Cas12a.For Cas12a albumen The cleavage reaction stage, wherein 3 materials are the key that experiment, respectively Cas12a, crRNA and fluorescence probe.In addition to embodiment In the FnCas12a albumen used, other Cas12a albumen are equally applicable to this method.

For the chip base fluorescence reaction of hydrophobin modification, the present invention has selected I hydrophobin of HFB to chip base It carries out modification and chip is carried out to Cas albumen to fix, after interaction occurs with FnCas12a albumen, Cas12a albumen traveling can be enhanced The ability of cutting, and the short ssDNA for selecting FAM and BHQ1 to mark, other can detect the mark mode of single-stranded cutting theoretically all It is applicable, as long as the fluorescence probe generates detectable difference after being cut.

We are not only innovative to realize fixation of the hydrophobin HFB I to CRISPR Cas albumen, also achieves to list The high-throughput detection of genopathy.Under the premise of guaranteeing Cas protein biological activity, we utilize protein interaction and high throughput Detection improves the efficiency of disease detection, the proposition of party's science of law will hold out broad prospects in terms of gene mutation disease detection and Using.

The gene order being related in 1 present invention of table

The title of the FnCas12a albumen and LbCas12a albumen that are related in 2 present invention of table and No. GI

Although the preferred embodiment of the present invention is described above in conjunction with attached drawing, the invention is not limited to upper The specific embodiment stated, the above mentioned embodiment is only schematical, be not it is restrictive, this field it is common Technical staff under the inspiration of the present invention, without breaking away from the scope protected by the purposes and claims of the present invention, may be used also By make it is many in the form of, within these are all belonged to the scope of protection of the present invention.

<110>University Of Tianjin

<120>the CRISPR high flux biochip of single gene mutation is detected

<130>

<160> 12

<170>

<210> 1

<211> 4726

<212> DNA

<213>artificial sequence

<400> 1

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 600

ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg 660

gatccaccgg tcatggtgag caagggcgcc gagctgttca ccggcatcgt gcccatcctg 720

atcgagctga atggcgatgt gaatggccac aagttcagcg tgagcggcga gggcgagggc 780

gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcctgtg 840

ccctggccca ccctggtgac caccctgagc tacggcgtgc agtgcttctc acgctacccc 900

gatcacatga agcagcacga cttcttcaag agcgccatgc ctgagggcta catccaggag 960

cgcaccatct tcttcgagga tgacggcaac tacaagtcgc gcgccgaggt gaagttcgag 1020

ggcgataccc tggtgaatcg catcgagctg accggcaccg atttcaagga ggatggcaac 1080

atcctgggca ataagatgga gtacaactac aacgcccaca atgtgtacat catgaccgac 1140

aaggccaaga atggcatcaa ggtgaacttc aagatccgcc acaacatcga ggatggcagc 1200

gtgcagctgg ccgaccacta ccagcagaat acccccatcg gcgatggccc tgtgctgctg 1260

cccgataacc actacctgtc cacccagagc gccctgtcca aggaccccaa cgagaagcgc 1320

gatcacatga tctacttcgg cttcgtgacc gccgccgcca tcacccacgg catggatgag 1380

ctgtacaagt gagcggccgc gactctagat cataatcagc cataccacat ttgtagaggt 1440

tttacttgct ttaaaaaacc tcccacacct ccccctgaac ctgaaacata aaatgaatgc 1500

aattgttgtt gttaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat 1560

cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact 1620

catcaatgta tcttaaggcg taaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa 1680

atttttgtta aatcagctca ttttttaacc aataggccga aatcggcaaa atcccttata 1740

aatcaaaaga atagaccgag atagggttga gtgttgttcc agtttggaac aagagtccac 1800

tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc 1860

cactacgtga accatcaccc taatcaagtt ttttggggtc gaggtgccgt aaagcactaa 1920

atcggaaccc taaagggagc ccccgattta gagcttgacg gggaaagccg gcgaacgtgg 1980

cgagaaagga agggaagaaa gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg 2040

tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc gccgctacag ggcgcgtcag 2100

gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 2160

caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 2220

ggaagagtcc tgaggcggaa agaaccagct gtggaatgtg tgtcagttag ggtgtggaaa 2280

gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac 2340

caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 2400

ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag 2460

ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc2520

cgcctcggcc tctgagctat tccagaagta gtgaggaggc ttttttggag gcctaggctt 2580

ttgcaaagat cgatcaagag acaggatgag gatcgtttcg catgattgaa caagatggat 2640

tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 2700

agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 2760

tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaagacgag gcagcgcggc 2820

tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 2880

cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 2940

ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 3000

atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 3060

ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 3120

cagccgaact gttcgccagg ctcaaggcga gcatgcccga cggcgaggat ctcgtcgtga 3180

cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 3240

tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 3300

atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 3360

ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgagcgg 3420

gactctgggg ttcgaaatga ccgaccaagc gacgcccaac ctgccatcac gagatttcga 3480

ttccaccgcc gccttctatg aaaggttggg cttcggaatc gttttccggg acgccggctg 3540

gatgatcctc cagcgcgggg atctcatgct ggagttcttc gcccacccta gggggaggct 3600

aactgaaaca cggaaggaga caataccgga aggaacccgc gctatgacgg caataaaaag 3660

acagaataaa acgcacggtg ttgggtcgtt tgttcataaa cgcggggttc ggtcccaggg 3720

ctggcactct gtcgataccc caccgagacc ccattggggc caatacgccc gcgtttcttc 3780

cttttcccca ccccaccccc caagttcggg tgaaggccca gggctcgcag ccaacgtcgg 3840

ggcggcaggc cctgccatag cctcaggtta ctcatatata ctttagattg atttaaaact 3900

tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat 3960

cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc 4020

ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct 4080

accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg 4140

cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca 4200

cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc 4260

tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga 4320

taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac 4380

gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga 4440

agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag 4500

ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg 4560

acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag 4620

caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc 4680

tgcgttatcc cctgattctg tggataaccg tattaccgcc atgcat 4726

<210> 2

<211> 4691

<212> DNA

<213>artificial sequence

<400> 2

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 600

ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg 660

gatccaccgg tcgccaccat ggacaacacc gaggacgtca tcaaggagtt catgcagttc 720

aaggtgcgca tggagggctc cgtgaacggc cactacttcg agatcgaggg cgagggcgag 780

ggcaagccct acgagggcac ccagaccgcc aagctgcagg tgaccaaggg cggccccctg 840

cccttcgcct gggacatcct gtccccccag ttccagtacg gctccaaggc ctacgtgaag 900

caccccgccg acatccccga ctacatgaag ctgtccttcc ccgagggctt cacctgggag 960

cgctccatga acttcgagga cggcggcgtg gtggaggtgc agcaggactc ctccctgcag 1020

gacggcacct tcatctacaa ggtgaagttc aagggcgtga acttccccgc cgacggcccc 1080

gtaatgcaga agaagactgc cggctgggag ccctccaccg agaagctgta cccccaggac 1140

ggcgtgctga agggcgagat ctcccacgcc ctgaagctga aggacggcgg ccactacacc 1200

tgcgacttca agaccgtgta caaggccaag aagcccgtgc agctgcccgg caaccactac 1260

gtggactcca agctggacat caccaaccac aacgaggact acaccgtggt ggagcagtac 1320

gagcacgccg aggcccgcca ctccggctcc cagtagagcg gccgcgactc tagatcataa 1380

tcagccatac cacatttgta gaggttttac ttgctttaaa aaacctccca cacctccccc 1440

tgaacctgaa acataaaatg aatgcaattg ttgttgttaa cttgtttatt gcagcttata 1500

atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc 1560

attctagttg tggtttgtcc aaactcatca atgtatctta aggcgtaaat tgtaagcgtt 1620

aatattttgt taaaattcgc gttaaatttt tgttaaatca gctcattttt taaccaatag 1680

gccgaaatcg gcaaaatccc ttataaatca aaagaataga ccgagatagg gttgagtgtt 1740

gttccagttt ggaacaagag tccactatta aagaacgtgg actccaacgt caaagggcga 1800

aaaaccgtct atcagggcga tggcccacta cgtgaaccat caccctaatc aagttttttg 1860

gggtcgaggt gccgtaaagc actaaatcgg aaccctaaag ggagcccccg atttagagct 1920

tgacggggaa agccggcgaa cgtggcgaga aaggaaggga agaaagcgaa aggagcgggc 1980

gctagggcgc tggcaagtgt agcggtcacg ctgcgcgtaa ccaccacacc cgccgcgctt 2040

aatgcgccgc tacagggcgc gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 2100

atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 2160

taaatgcttc aataatattg aaaaaggaag agtcctgagg cggaaagaac cagctgtgga 2220

atgtgtgtca gttagggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa 2280

gcatgcatct caattagtca gcaaccaggt gtggaaagtc cccaggctcc ccagcaggca 2340

gaagtatgca aagcatgcat ctcaattagt cagcaaccat agtcccgccc ctaactccgc 2400

ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc tgactaattt 2460

tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag aagtagtgag 2520

gaggcttttt tggaggccta ggcttttgca aagatcgatc aagagacagg atgaggatcg 2580

tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg 2640

ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg 2700

ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat 2760

gaactgcaag acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca 2820

gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg 2880

gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat 2940

gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa 3000

catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg 3060

gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgagcatg 3120

cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg 3180

gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat 3240

caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac 3300

cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc 3360

cttcttgacg agttcttctg agcgggactc tggggttcga aatgaccgac caagcgacgc 3420

ccaacctgcc atcacgagat ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg 3480

gaatcgtttt ccgggacgcc ggctggatga tcctccagcg cggggatctc atgctggagt 3540

tcttcgccca ccctaggggg aggctaactg aaacacggaa ggagacaata ccggaaggaa 3600

cccgcgctat gacggcaata aaaagacaga ataaaacgca cggtgttggg tcgtttgttc 3660

ataaacgcgg ggttcggtcc cagggctggc actctgtcga taccccaccg agaccccatt 3720

ggggccaata cgcccgcgtt tcttcctttt ccccacccca ccccccaagt tcgggtgaag 3780

gcccagggct cgcagccaac gtcggggcgg caggccctgc catagcctca ggttactcat 3840

atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc 3900

tttttgataa tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag 3960

accccgtaga aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct 4020

gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac 4080

caactctttt tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc 4140

tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg 4200

ctctgctaat cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt 4260

tggactcaag acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt 4320

gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc 4380

tatgagaaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca 4440

gggtcggaac aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata 4500

gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg 4560

ggcggagcct atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct 4620

ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat aaccgtatta 4680

ccgccatgca t 4691

<210> 3

<211> 43

<212> DNA

<213>artificial sequence

<400> 3

cgtcaatggg tggagtattt acggatctac aacagtagaa att 43

<210> 4

<211> 43

<212> DNA

<213>artificial sequence

<400> 4

agttccgcgt tacataactt acggatctac aacagtagaa att 43

<210> 5

<211> 42

<212> DNA

<213>artificial sequence

<400> 5

gagtaacaga catggaccat cagatctaca acagtagaaa tt 42

<210> 6

<211> 324

<212> DNA

<213> Homo sapiens (Human)

<400> 6

ggtcgcgagt gcgttaattg cggggcaatg tctaccccac tgtggcgtcg tgacggtacc 60

ggtcattatc tgtgtaacgc ctgcggtctg taccataaaa tgaacggcat caaccgtccg 120

ctgattaaac cgcaacgtcg tctgtctgca agtcgtcgcg ttggtctgag ttgcgcaaat 180

tgtcaaacca ccaccaccac cctgtggcgt cgtaacgcag aaggcgaacc agtttgtaac 240

gcttgcggcc tgtatatgaa actgcacggc gttccacgtc cactggcaat gcgtaaagaa 300

ggcatccaga cccgcaaacg caaa 324

<210> 7

<211> 50

<212> DNA

<213> Homo sapiens (Human)

<400> 7

gtcacgccac ttgacaggcg agtaacagac atggaccatc aggaaacatt 50

<210> 8

<211> 55

<212> DNA

<213>artificial sequence

<400> 8

gccggggtgg tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagc 55

<210> 9

<211> 27

<212> DNA

<213>artificial sequence

<400> 9

gtggcgataa gtcgtgtctt accgggt 27

<210> 10

<211> 28

<212> DNA

<213>artificial sequence

<400> 10

gtcaaaccgc tatccacgcc cattgatg 28

<210> 11

<211> 25

<212> DNA

<213>artificial sequence

<400> 11

gtacaaggcc aagaagcccg tgcag 25

<210> 12

<211> 32

<212> DNA

<213>artificial sequence

<400> 12

gtctcttgat cgatctttgc aaaagcctag gc 32

Claims (9)

1. detecting the CRISPR high flux biochip of single gene mutation, which is characterized in that construction method includes the following steps:

(1) chemical synthesis contains the coli expression carrier of Cas12a protein sequence, specific substrate, containing PAM sequence PCR upstream primer, downstream primer, fluorescence probe, and corresponding to the crRNA of Cas12a and corresponding single gene mutation disease, really Determine expression of the FnCas12a albumen in Escherichia coli recombinant plasmid；

(2) compound of Cas12a and crRNA is to specific substrate --- and double-stranded DNA carries out the structure of the system of specific cutting Build, including to double-stranded DNA cutting experiment ratio optimization, to the cutting of pcr amplified fragment；

(3) compound of Cas12a and crRNA carries out the building of the system of Non-specific cleavage to single stranded DNA, including to common The cutting of single stranded DNA, the cutting to fluorescence probe single stranded DNA；

(4) chip base is subjected to hydrophobin modification；

(5) high-throughput chip base is constructed, including hydrophobin to the fixation of Cas12a-crRNA compound, compound to special Property substrate specificity cutting and to the Non-specific cleavage of fluorescence probe.

2. detecting the CRISPR high flux biochip of single gene mutation according to claim 1, which is characterized in that the step Suddenly (4) hydrophobin refers to some amphiphilic albumen, can pass through the both sexes for self being assembled to form nanometer grade thickness at two-phase interface Protein film.

3. detecting the CRISPR high flux biochip of single gene mutation according to claim 2, which is characterized in that the step Suddenly (4) hydrophobin refers to HGF I, HFB I.

4. detecting the CRISPR high flux biochip of single gene mutation according to claim 1, which is characterized in that described Cas12a albumen is preferably FnCas12a albumen.

5. detecting the construction method of the CRISPR high flux biochip of single gene mutation, which comprises the steps of: (1) chemical synthesis contains on the coli expression carrier, specific substrate, the PCR containing PAM sequence of Cas12a protein sequence Primer, downstream primer, fluorescence probe are swum, and corresponding to the crRNA of Cas12a and corresponding single gene mutation disease, is determined Expression of the FnCas12a albumen in Escherichia coli recombinant plasmid；

(2) compound of Cas12a and crRNA is to specific substrate --- and double-stranded DNA carries out the structure of the system of specific cutting Build, including to double-stranded DNA cutting experiment ratio optimization, to the cutting of pcr amplified fragment；

(3) compound of Cas12a and crRNA carries out the building of the system of Non-specific cleavage to single stranded DNA, including to common The cutting of single stranded DNA, the cutting to fluorescence probe single stranded DNA；

(4) chip base is subjected to hydrophobin modification；

(5) high-throughput chip base is constructed, including hydrophobin to the fixation of Cas12a-crRNA compound, compound to special Property substrate specificity cutting and to the Non-specific cleavage of fluorescence probe.

6. detecting the construction method of the CRISPR high flux biochip of single gene mutation, feature according to claim 5 It is, step (4) hydrophobin refers to some amphiphilic albumen, can be at two-phase interface by self being assembled to form nanoscale The Amphiphilic proteins film of thickness.

7. detecting the construction method of the CRISPR high flux biochip of single gene mutation, feature according to claim 6 It is, step (4) hydrophobin refers to HGF I, HFB I.

8. detecting the construction method of the CRISPR high flux biochip of single gene mutation, feature according to claim 5 It is, the Cas12a albumen is preferably FnCas12a albumen.

9. detecting the application of the CRISPR high flux biochip of single gene mutation described in claim 1.