CN110117589B - Saliva preserving fluid and preparation method and application thereof - Google Patents

Abstract

The invention relates to a saliva preservation solution and a preparation method and application thereof, wherein the saliva preservation solution comprises the following components: EDTA1-10mmol/L, ethylene glycol-bis- (2-aminoethylether) tetraacetic acid 1-10mmol/L, benzyl penicillin sodium salt 30-70 μ g/mL, streptomycin sulfate 30-70 μ g/mL, Tris-HCl 30-70mmol/L, 4- (2-hydroxyethyl) -1-piperazine ethanesulfonic acid 1-25mmol/L, N-Tris (hydroxymethyl) methylglycine 30-70mmol/L, protease K5-30 μ g/mL, sucrose 1-50mmol/L, and the solvent is sterile water. According to the saliva preservation solution, the components are reasonably matched within a specific concentration range, so that a DNA sample preserved in the saliva preservation solution at normal temperature for a long time can keep the integrity of the DNA sample, and the saliva preservation solution can be directly used for PCR amplification without DNA extraction; can be used for NGS experiments, can adapt to complex multiplex PCR experiments and can meet the requirement of long-fragment amplification.

Description

Saliva preserving fluid and preparation method and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a saliva preserving fluid and a preparation method and application thereof.

Background

With the development of biotechnology, DNA samples are increasingly widely used in the fields of molecular biology, medical identification, detection, treatment, and the like. DNA generally used for PCR amplification or detection is extracted from anticoagulated blood, but a blood sample as a DNA source is limited to a certain extent and mainly embodied in two aspects, on one hand, blood is easy to form agglutination after being preserved for a long time, and inconvenience is caused to extraction; on the other hand, blood collection also causes certain trauma to human body and can be completed only by professional skills.

Compared with the traditional mode of extracting blood and collecting DNA, the saliva DNA sample collection is a method for obtaining DNA without harm and pain to human bodies, discomfort and fear of the collected persons are not easy to cause, the method does not cause any discomfort to the collected persons and is easy to accept, so that the sampling range of gene research can be enlarged to the maximum extent, and the method is particularly suitable for large-scale crowd investigation of molecular epidemiology.

With the popularization of the second generation sequencing technology in clinical detection, the method can conveniently and rapidly obtain human DNA and can be stably stored for a long time. Saliva samples are ideal for DNA acquisition, but improper storage of the fluid can result in DNA degradation or contain certain components that affect downstream gene detection. At present, some preserving fluids used for preserving saliva contain magnesium chloride, which is easy to cause DNA degradation, and have influence on downstream long-fragment amplification after long-term preservation. Some contain sucrose, but lack bacteriostatic substances, although the cell osmotic pressure can be well maintained, the growth of microorganisms such as bacteria is easy to cause, and the long-term storage of saliva is not facilitated.

CN105368812A discloses a saliva preservation solution, a preparation method and a use thereof, wherein the saliva preservation solution comprises the following components and contents: 0.1-2mol/L of lithium chloride, 1-50mmol/L of Tris-HCl, 0.1-2mol/L of urea, 0.1-2% (w/v) of SDS, 1-10mmol/L of EDTA, and 10-90% (v/v) of ethanol, wherein the pH range of the system is 7-10, and the components of urea, ethanol and the like can perform deformation treatment on organic matters such as mucin, globulin and the like in saliva, but can also cause cell lysis at the same time, and are not favorable for the integrity storage of DNA.

CN105039306A discloses a saliva protective agent, its preparation and application, wherein each 1000mL of the saliva protective agent contains: 10-50mmol of trihydroxymethyl aminomethane; 0.5-20mmol of ethylene diamine tetraacetic acid and/or sodium ethylene diamine tetracetate; ammonium sulfate 200-; 1-50mmol of glucose, and the saliva is stored in the saliva protective agent of the invention, almost no change occurs in the first 60 days, the DNA is still intact, and no obvious degradation occurs; this was still true after 6 months, and after 12 months, DNA integrity remained as such. The components contain glucose, and the viscosity of the saliva preservation solution can be well maintained and the cell osmotic pressure can be well maintained, but the propagation of microorganisms such as bacteria is easily caused.

CN102440234A discloses a human bodyThe saliva preservation stationary liquid and the preparation and the application thereof comprise the following components: sucrose, Tris-HCl, MgCl₂Guanidine isothiocyanate and water. The saliva fixing liquid has good preservation effect, the preservation effect of the saliva fixing liquid is obviously better than that of saliva preserved by using a single component, the cost is lower, the preparation is convenient, and the saliva fixing liquid contains a protein denaturant, namely guanidine isothiocyanate, which can inhibit the activity of nuclease and can also crack cells at the same time, so that DNA is in a free state and is not beneficial to the integrity preservation of the DNA.

Therefore, it is necessary to develop a saliva preservation solution which can preserve DNA intact for a long period of time, inhibit bacterial growth, and can adapt to complicated multiplex PCR experiments, and meet the requirement of long-fragment amplification.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a saliva preserving fluid and a preparation method and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the invention provides a saliva preservation solution, which comprises the following components: the reagent comprises, by weight, 1-10mmol/L of EDTA, 1-10mmol/L of ethylene glycol-bis- (2-aminoethylether) tetraacetic acid, 30-70 mu g/mL of benzylpenicillin sodium salt, 30-70 mu g/mL of streptomycin sulfate, 30-70mmol/L of Tris-HCl, 1-25mmol/L, N-Tris (hydroxymethyl) methylglycine of 4- (2-hydroxyethyl) -1-piperazine ethanesulfonic acid, 5-30 mu g/mL of protease and 1-50mmol/L of sucrose, and a solvent is sterile water.

EDTA and ethylene glycol-bis- (2-aminoethylether) tetraacetic acid in the saliva preservation solution can be synergistically used as a stabilizing agent of DNA, so that the influence of metal ions on the DNA is effectively prevented, and the effect of maintaining the integrity of the DNA for a long time by using the two reagents in a matched manner is far better than that of a single reagent; the benzyl penicillin sodium salt destroys cell walls of bacteria and plays a role in sterilization in the propagation period of the bacterial cells, streptomycin sulfate acts on ribosomes in bacteria to inhibit synthesis of bacterial proteins and destroy the integrity of bacterial cell membranes, and the two antibiotics jointly inhibit breeding of microorganisms from different antibacterial mechanisms respectively and play a long-time antibacterial effect.

4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid and N-tris (hydroxymethyl) methylglycine in the specific concentration range can synergistically inhibit the activity of nuclease and maintain the osmotic pressure of cells, and the compound mainly contributes to the maintenance of the integrity and high quality of DNA after long-term storage and the application to long-fragment amplification, and N-tris (hydroxymethyl) methylglycine also has a broad-spectrum bacteriostatic action; proteinase K can degrade nuclease and maintain the integrity of DNA to the maximum extent; Tris-HCl can maintain the stability of the pH value of the preservation solution; the sucrose can maintain the osmotic pressure of cells, increase the viscosity of the preservation solution and protect DNA from being easily broken.

The components in the saliva preservation solution are reasonably matched within a specific concentration range, so that a DNA sample preserved in the saliva preservation solution at normal temperature for a long time can keep the integrity of the DNA sample, and the saliva preservation solution can be directly used for PCR amplification without DNA extraction; can be used for NGS experiments, can adapt to complex multiplex PCR experiments and can meet the requirement of long-fragment amplification.

The concentration of EDTA may be 1mmol/L, 2mmol/L, 3mmol/L, 4mmol/L, 5mmol/L, 6mmol/L, 7mmol/L, 8mmol/L, 9mmol/L or 10mmol/L, etc.

The concentration of the ethylene glycol-bis- (2-aminoethylether) tetraacetic acid can be 1mmol/L, 2mmol/L, 3mmol/L, 4mmol/L, 5mmol/L, 6mmol/L, 7mmol/L, 8mmol/L, 9mmol/L or 10mmol/L, etc.

The concentration of the benzylpenicillin sodium salt may be 30. mu.g/mL, 35. mu.g/mL, 40. mu.g/mL, 45. mu.g/mL, 50. mu.g/mL, 55. mu.g/mL, 60. mu.g/mL, 70. mu.g/mL or the like.

The concentration of the streptomycin sulfate may be 30. mu.g/mL, 35. mu.g/mL, 40. mu.g/mL, 45. mu.g/mL, 50. mu.g/mL, 55. mu.g/mL, 60. mu.g/mL, 70. mu.g/mL, or the like.

The concentration of Tris-HCl may be 30. mu.g/mL, 35. mu.g/mL, 40. mu.g/mL, 45. mu.g/mL, 50. mu.g/mL, 55. mu.g/mL, 60. mu.g/mL, 70. mu.g/mL, or the like.

The concentration of the 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid may be 1mmol/L, 2mmol/L, 5mmol/L, 7mmol/L, 10mmol/L, 12mmol/L, 15mmol/L, 18mmol/L, 20mmol/L or 25mmol/L, etc.

The concentration of N-tris (hydroxymethyl) methylglycine may be 30. mu.g/mL, 35. mu.g/mL, 40. mu.g/mL, 45. mu.g/mL, 50. mu.g/mL, 55. mu.g/mL, 60. mu.g/mL, 70. mu.g/mL, or the like.

The concentration of proteinase K may be 5. mu.g/mL, 8. mu.g/mL, 10. mu.g/mL, 12. mu.g/mL, 15. mu.g/mL, 18. mu.g/mL, 20. mu.g/mL, 25. mu.g/mL, 30. mu.g/mL, or the like.

The concentration of the sucrose may be 1mmol/L, 2mmol/L, 5mmol/L, 8mmol/L, 10mmol/L, 15mmol/L, 20mmol/L, 30mmol/L, 40mmol/L or 50mmol/L, etc.

Preferably, the saliva preservation solution comprises the following components: 3-8mmol/L of EDTA, 3-8mmol/L of ethylene glycol-bis- (2-aminoethylether) tetraacetic acid, 40-60 mu g/mL of benzylpenicillin sodium salt, 40-60 mu g/mL of streptomycin sulfate, 40-60mmol/L of Tris-HCl, 5-15mmol/L, N-Tris (hydroxymethyl) methylglycine of 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid, 5-15 mu g/mL of protease K and 5-15mmol/L of sucrose, and the solvent is sterile water.

Preferably, the saliva preservation solution comprises the following components: EDTA5mmol/L, ethylene glycol-bis- (2-aminoethylether) tetraacetic acid 5mmol/L, benzyl penicillin sodium salt 50. mu.g/mL, streptomycin sulfate 50. mu.g/mL, Tris-HCl 50mmol/L, 4- (2-hydroxyethyl) -1-piperazine ethanesulfonic acid 10mmol/L, N-Tris (hydroxymethyl) methylglycine 50mmol/L, proteinase K10. mu.g/mL, sucrose 10mmol/L, and the solvent is sterile water.

Preferably, the saliva preservation solution further comprises a humectant P-40.

Preferably, the humectant P-40 has a volume fraction in the saliva preserving fluid of 0.05% to 0.5%.

The humectant P-40 may have a volume fraction of 0.05%, 0.07%, 0.08%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%, 0.5%, or the like.

The wetting agent P-40 is a very mild nonionic surfactant, can increase the permeability of cell membranes, has weak damage effect on nuclear membranes, can promote cells such as proteinase K and the like to help degrade nuclease, and has positive influence on maintaining the integrity of DNA.

Preferably, the saliva preservation solution further comprises Triton X-100.

Preferably, the volume fraction of the Triton X-100 in the saliva preservation solution is 0.01% -0.5%.

The volume fraction of Triton X-100 may be 0.01%, 0.02%, 0.05%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%, 0.5%, or the like.

Triton X-100 is also a surfactant, and its action is similar to that of P-40 described above.

Preferably, the saliva preservation solution further comprises 1-12mmol/L of sodium hydroxide.

The concentration of the sodium hydroxide may be 1mmol/L, 2mmol/L, 4mmol/L, 5mmol/L, 6mmol/L, 8mmol/L, 9mmol/L, 10mmol/L, 11mmol/L or 12mmol/L, etc.

In another aspect, the present invention provides a method for preparing a saliva preserving fluid as described above, comprising the steps of:

preparing stock solutions of all components in the saliva preservation solution, respectively measuring all the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value, and sterilizing to obtain the saliva preservation solution.

The method for preparing the saliva preservation solution is simple to operate and low in cost.

Preferably, the pH is adjusted to 7-10, such as 7, 7.5, 8, 8.5, 9, 9.5 or 10, preferably 7.5-8.5.

Preferably, the sterilization is performed by adopting a microporous filter membrane filtration mode.

As a preferred technical scheme of the invention, the preparation method comprises the following steps:

preparing stock solutions of all components in the saliva preservation solution, respectively measuring all the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 7-10, and sterilizing by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

In a further aspect, the invention provides a use of the saliva preservation solution in preserving a saliva DNA sample.

Compared with the prior art, the invention has the following beneficial effects:

according to the saliva preservation solution, the components are reasonably matched within a specific concentration range, so that a DNA sample preserved in the saliva preservation solution at normal temperature for a long time can keep the integrity of the DNA sample, and the saliva preservation solution can be directly used for PCR amplification without DNA extraction; can be used for NGS experiments, can adapt to complex multiplex PCR experiments and can meet the requirement of long-fragment amplification.

Drawings

FIG. 1 is a photograph of a gel image of DNA after 2 months of mixing sample 1 with the products of examples 1 to 5 and comparative examples 1 to 6;

FIG. 2 is an image of a DNA gel amplified with 16SrRNA after sample 1 is left for 2 months in admixture with the products of examples 1-5 and comparative examples 1-6;

FIG. 3 is a photograph of a DNA gel directly amplified with a direct-amplifying enzyme after 2 months of mixing sample 1 with the products of examples 1 to 5 and comparative examples 1 to 6;

FIG. 4 is an image of a DNA gel amplified with the CYP2D6 primer after sample 1 has been mixed with the products of examples 1-5 and comparative examples 1-6 and left for 2 months.

Detailed Description

The technical solution of the present invention is further explained by the following embodiments. It should be understood by those skilled in the art that the examples are only for the understanding of the present invention and should not be construed as the specific limitations of the present invention.

Example 1

The embodiment provides a saliva preservation solution, which comprises the following components: EDTA5mmol/L, ethylene glycol-bis- (2-aminoethylether) tetraacetic acid 5mmol/L, benzyl penicillin sodium salt 50. mu.g/mL, streptomycin sulfate 50. mu.g/mL, Tris-HCl 50mmol/L, 4- (2-hydroxyethyl) -1-piperazine ethanesulfonic acid 10mmol/L, N-Tris (hydroxymethyl) methylglycine 50mmol/L, proteinase K10. mu.g/mL, sucrose 10mmol/L, and the solvent is sterile water.

The preparation method comprises the following steps: preparing stock solutions of the components in the saliva preservation solution, respectively measuring the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 8.5, and sterilizing by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

Example 2

The embodiment provides a saliva preservation solution, which comprises the following components: 3mmol/L of EDTA, 8mmol/L of ethylene glycol-bis- (2-aminoethylether) tetraacetic acid, 40 mu g/mL of benzylpenicillin sodium salt, 60 mu g/mL of streptomycin sulfate, 40mmol/L of Tris-HCl, 5mmol/L, N of 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid, 60mmol/L of Tris (hydroxymethyl) methylglycine, 5 mu g/mL of proteinase K and 5mmol/L of sucrose, and the solvent is sterile water.

The preparation method comprises the following steps: preparing stock solutions of the components in the saliva preservation solution, respectively measuring the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 7.5, and sterilizing by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

Example 3

The embodiment provides a saliva preservation solution, which comprises the following components: 8mmol/L of EDTA, 3mmol/L of ethylene glycol-bis- (2-aminoethylether) tetraacetic acid, 60 mu g/mL of benzylpenicillin sodium salt, 40 mu g/mL of streptomycin sulfate, 60mmol/L of Tris-HCl, 15mmol/L, N of 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid, 40mmol/L of tri (hydroxymethyl) methylglycine, 15 mu g/mL of protease K and 15mmol/L of sucrose, and the solvent is sterile water.

The preparation method comprises the following steps: preparing stock solutions of the components in the saliva preservation solution, respectively measuring the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 7, and performing sterilization by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

Example 4

The embodiment provides a saliva preservation solution, which comprises the following components: EDTA 1mmol/L, ethylene glycol-bis- (2-aminoethylether) tetraacetic acid 10mmol/L, benzyl penicillin sodium salt 30. mu.g/mL, streptomycin sulfate 70. mu.g/mL, Tris-HCl30mmol/L, 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid 1mmol/L, N-Tris (hydroxymethyl) methylglycine 70mmol/L, proteinase K5. mu.g/mL, sucrose 1mmol/L, wetting agent P-400.05%, Triton X-1000.05%, sodium hydroxide 5mmol/L, and the solvent is sterile water.

The preparation method comprises the following steps: preparing stock solutions of the components in the saliva preservation solution, respectively measuring the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 10, and performing sterilization by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

Example 5

The embodiment provides a saliva preservation solution, which comprises the following components: 10mmol/L of EDTA, 1mmol/L of ethylene glycol-bis- (2-aminoethylether) tetraacetic acid, 70 mu g/mL of benzylpenicillin sodium salt, 30 mu g/mL of streptomycin sulfate, 70mmol/L of Tris-HCl, 25mmol/L, N-Tris (hydroxymethyl) methylglycine of 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid, 30 mu g/mL of proteinase K, 50mmol/L of sucrose, wetting agent P-400.05%, Triton X-1000.05% and 5mmol/L of sodium hydroxide, and the solvent is sterile water.

The preparation method comprises the following steps: preparing stock solutions of the components in the saliva preservation solution, respectively measuring the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 8, and performing sterilization by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

Comparative example 1

This comparative example provides a saliva preservation solution whose composition differs from that of example 1 only in that "EDTA 5mmol/L, ethylene glycol-bis- (2-aminoethylether) tetraacetic acid 5 mmol/L" was replaced with "EDTA 10 mmol/L", and the others were kept unchanged. The preparation method is the same as that of example 1.

Comparative example 2

This comparative example provides a saliva preservation solution, the composition of which differs from example 1 only in that "benzylpenicillin sodium salt 50. mu.g/mL, streptomycin sulfate 50. mu.g/mL" is replaced with "benzylpenicillin sodium salt 100. mu.g/mL", and the others are left unchanged. The preparation method is the same as that of example 1.

Comparative example 3

This comparative example provides a saliva preservation solution whose composition differs from that of example 1 only in that "4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid 10mmol/L, N-tris (hydroxymethyl) methylglycine 50 mmol/L" was replaced with "4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid 60 mmol/L", and the others were kept unchanged. The preparation method is the same as that of example 1.

Comparative example 4

This comparative example provides a saliva preservation solution whose composition differs from that of example 1 only in that "4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid 10mmol/L, N-tris (hydroxymethyl) methylglycine 50 mmol/L" was replaced with "N-tris (hydroxymethyl) methylglycine 60 mmol/L", and the others were kept unchanged. The preparation method is the same as that of example 1.

Comparative example 5

This comparative example provides a saliva preservative solution whose composition differs from that of example 1 only in that it does not contain sucrose, and the others remain unchanged. The preparation method is the same as that of example 1.

Comparative example 6

This comparative example provides a saliva preservative solution whose composition differs from that of example 1 only in that "4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid 10mmol/L, N-tris (hydroxymethyl) methylglycine 50 mmol/L" was replaced with "4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid 30mmol/L, N-tris (hydroxymethyl) methylglycine 20 mmol/L", and the others were kept unchanged. The preparation method is the same as that of example 1.

Example 6

The present example was carried out the following evaluation test for the saliva preservation solution prepared in the above examples and comparative examples:

(1) collecting a saliva DNA sample by the specific method:

30min before collecting saliva samples, subjects rinsed their mouths with clear water and kept their mouths clean, after cleaning their mouths without eating, drinking, smoking, chewing gum, etc., and before starting to collect saliva, subjects relaxed their cheeks and gently massage them with fingers for 15-30 seconds to produce saliva. Spit the saliva gently into the saliva collection tube to avoid excessive foam as much as possible. 2mL of saliva was collected, i.e., the stratified interface between saliva and upper foam in the collection tube, at the 2mL scale line of the collection tube, and then mixed with 2mL of the saliva stock solutions prepared in examples 1-5 and comparative examples 1-6 in equal volumes and vortexed. Saliva samples were collected from 2 subjects for future use.

(2) The method comprises the following steps of (1) placing a saliva sample stored in a preservation solution at room temperature for different times, and then carrying out stability detection, wherein the specific method comprises the following steps:

after the saliva preservation solution and the mixture of the saliva of the subject are respectively placed for 0 day, 7 days, 14 days, 21 days, 1 month, 2 months, 4 months and 5 months at room temperature, 200 mu L of the saliva sample is taken, and genomic DNA of the saliva sample is extracted by using a kit nucleic acid extraction or purification reagent (model: S10040, Boaomuwa) and the total volume of the DNA is 50 mu L. One part was subjected to DNA sample gel electrophoresis: mu.L of DNA was loaded on 0.8% agarose gel, labeled with DL15000Marker, electrophoresed, stained with SYBR GreenI, and photographed under UV transillumination using a gel imaging system, as shown in FIG. 1 (FIG. 1 is a gel image of DNA obtained after 2 months of mixing of sample 1 with the products of examples 1-5 and comparative examples 1-6). The other part is subjected to concentration and purity detection: mu.L of DNA was sampled and tested for concentration (in. mu.g/mL) and purity using NanoDrop one, and the results are shown in tables 1 and 2 (Table 1 summarizes the results for sample 1; Table 2 summarizes the results for sample 2). Wherein A260/A280 of examples 1-5 and comparative examples 1-6 were between 1.7 and 2.0, indicating that the purity of the extracted DNA was better.

TABLE 1

Sample 1	Day 0	7 days	14 days	21 days	1 month	2 months old	4 months old	For 5 months
									Example 1	181.70	180.48	176.40	178.20	180.60	176.40	175.60	176.40
Example 2	176.50	121.20	131.40	125.30	132.40	119.40	116.70	118.90
									Example 3	167.80	119.60	122.30	124.60	127.90	118.40	112.70	110.60
Example 4	173.20	96.10	96.10	89.00	77.30	74.50	71.75	67.30
									Example 5	178.30	101.20	97.19	90.10	75.20	74.50	61.75	65.30
Comparative example 1	178.70	101.20	74.50	39.10	33.14	42.28	41.90	39.10
									Comparative example 2	176.40	71.75	77.30	47.25	39.10	31.50	27.20	25.57
Comparative example 3	175.30	65.76	74.50	44.00	39.10	31.10	25.68	21.89
									Comparative example 4	175.20	64.30	71.75	42.28	39.10	31.10	25.57	20.80
Comparative example 5	178.60	61.33	65.76	41.90	36.57	27.20	21.89	20.72
									Comparative example 6	172.47	58.70	64.30	39.10	34.56	25.68	20.80	19.20

TABLE 2

Sample 2	Day 0	7 days	14 days	21 days	1 month	2 months old	4 months old	For 5 months
									Example 1	172.70	172.48	168.40	174.20	179.60	175.40	170.60	172.40
Example 2	169.50	118.20	129.40	117.30	128.40	118.40	113.70	108.90
									Example 3	157.80	114.60	117.30	119.60	120.90	110.40	108.70	105.60
Example 4	172.20	89.10	90.10	84.00	68.30	70.50	65.75	64.30
									Example 5	168.30	99.20	90.19	86.10	65.20	65.50	53.75	61.30
Comparative example 1	171.70	92.20	71.50	35.10	25.14	39.28	31.90	37.10
									Comparative example 2	168.40	67.75	72.30	44.25	36.10	22.50	19.20	19.57
Comparative example 3	170.30	59.76	67.50	34.00	37.10	28.10	17.68	17.89
									Comparative example 4	168.20	55.30	66.75	41.28	31.10	24.10	22.57	13.80
Comparative example 5	177.60	60.33	60.76	35.90	27.57	17.20	20.89	12.72
									Comparative example 6	167.47	50.70	54.30	35.10	33.56	20.68	11.80	15.20

As can be seen from the data in tables 1 and 2: in the two samples of examples 1 to 5, the degree of change in the DNA concentration after storage for 0 day, 7 days, 14 days, 21 days, 1 month, 2 months, 4 months, and 5 months was small, indicating that the degree of degradation of DNA was small. As a result of comparison of the data of examples 1 to 5 and comparative examples 1 to 6, it was found that the DNA concentrations of the saliva samples of examples 2 to 5 and comparative examples 1 to 6 were reduced to different degrees after 7 days, with almost no difference in the DNA concentration of the saliva sample at the time of storage for 0 days. The comparative results of 14 days, 21 days, 1 month, 2 months, 4 months, 5 months also tended to be consistent with the results of 7 days. Therefore, the preservation solutions of examples 1 to 5 can still maintain high stability after being preserved for different periods of time, while the preservation solutions of examples 1 to 3 have better effects, and the DNA samples are significantly degraded after the preservation solutions of comparative examples 1 to 6 preserve the DNA samples for a period of time.

From the results of FIG. 1, it can be seen that: after sample 1 was mixed with the products of examples 1 to 5 and comparative examples 1 to 6, respectively, and left for 2 months, the band brightness of comparative examples 1 to 6 was significantly weaker than those of examples 1 to 5 in terms of the band brightness of gel electrophoresis. This result is also consistent with the data in table 1.

(3) And (3) carrying out PCR amplification on the saliva DNA sample (sample 1) which is stored in the storage solution in the step (2) for 2 months and extracted by using the kit, wherein the specific method comprises the following steps:

amplifying the 16SrRNA of the microorganism, wherein amplification primers are as follows:

16SrRNA-F：5’-AGAGTTTGATCCTGGCTCA-3’

16SrRNA-R：5’-GGTTACCTTGTTACGACTT-3’

the PCR reaction system is as follows:

gDNA(50ng)	XμL
		2×Vazyme LAmp Master Mix	10μL
16SrRNA-F	0.8μL
		16SrRNA-R	0.8μL
ddH20	(8.4-X)μL

wherein 2 × Vazyme LAmp Master Mix was purchased from Nanjing Novowed Biotechnology Inc., Cat.P 312-03.

The PCR amplification procedure was as follows: 3min at 95 ℃; circulating for 35 times at 94 deg.C for 30s, 55 deg.C for 30s, and 72 deg.C for 2 min; 10min at 72 ℃; cooling at 4 ℃. The results are shown in FIG. 2 (FIG. 2 is a photograph of a DNA gel amplified with 16S rRNA after 2 months of mixing and standing sample 1 with the products of examples 1 to 5 and comparative examples 1 to 6).

From the results of FIG. 2, it can be seen that: examples 1-5, none of which had amplified products, showed no contamination of the DNA samples of examples 1-5 with microorganisms; the comparative examples 1 to 6 have bands of about 1500bp, and the band brightness is different, which shows that the DNA samples in the comparative examples 1 to 6 have different degrees of microbial contamination.

(4) Saliva DNA samples (sample 1) stored in the storage solution for 2 months were subjected to PCR amplification without extraction, and the following amplification primers were used:

direct amplification primer-F: AGTTGACCTTCATACGTTCTGTG

Direct amplification primer-R: TAAATCATCAAGTGCTCACAAGG

The PCR reaction system is as follows:

gDNA(50ng)	XμL
		2×Multi PCR Reaction buffer	12.5μL
Phoenix Taq	0.5μL
		direct amplification primer-F	1μL
Direct amplification primer-R	1μL
		ddH20	(10-X)μL

Wherein Multi PCR Reaction buffer and Phoenix Taq are purchased from Tiangen Biotechnology technology (Beijing) Ltd, under the product number KG 204-T1.

The PCR amplification procedure was as follows: 3min at 95 ℃; circulating for 35 times at 94 deg.C for 30s, 60 deg.C for 30s, and 72 deg.C for 2 min; 10min at 72 ℃; cooling at 4 ℃. The results are shown in FIG. 3 (FIG. 3 is a photograph of a DNA gel in which sample 1 was mixed with the products of examples 1 to 5 and comparative examples 1 to 6 and directly amplified with a direct-amplifying enzyme after standing for 2 months).

As can be seen from the data in fig. 3: the amplified band brightness of the samples 1-5 is obviously higher than that of the samples 1-6, which shows that the saliva preservation solution of the samples 1-5 is more favorable for the amplification of the direct-amplifying enzyme.

(5) And (3) performing NGS library building and sequencing on the saliva DNA sample which is stored in the storage solution in the step (2) for 2 months and extracted by using the kit, wherein the specific method comprises the following steps:

whole blood DNA is used as a control, and a library is built by an individualized drug gene detection kit, wherein the library comprises an amplicon library, and the amplicon library is mixed and purified for nucleic acid sequencing. High throughput sequencing was performed using the Ion torrent platform. The detection method and steps can refer to the chinese patent application CN201810600578.9, which is not described herein. The results of the tests are shown in Table 3 (where the control group is the reference data given in the aforementioned patent, the results of the sequencing by pooling of whole blood samples).

TABLE 3

	Control group	Example 1	Comparative example 1	Comparative example 2
					Clean_Rate	78.80％	80.80％	76.50％	73.20％
Map_Rate	98.32％	97.32％	99.12％	99.12％
					Target_Rate	86.31％	89.31％	85.22％	85.22％
Valid _ Rate (effective Rate)	53.43％	60.43％	49.30％	50.23％
					Coverage (Coverage)	100.00％	100.00％	100.00％	100.00％
Amplicon _ min _ depth (lowest depth of Amplicon)	57	70	56	40
					Amplicon _ max _ depth (maximum depth of Amplicon)	17212	20035	19835	17835
Amplicon _ average _ depth (AD) (average depth of Amplicon)	4844	5230	4954	4762
					Amplicon_number(>1/10*AD)	91	91	91	91
Amplicon_number(>1/5*AD)	88	86	84	80
					Amplicon_number(>1/2*AD)	77	80	75	75
Amplicon_number(>2*AD)	6	5	6	6

As can be seen from the data in Table 3: the effective rate of the sample of example 1 is 60.43%, which is higher than 53.43% of the control group, and 49.30% of the sample of comparative example 1 and 50.23% of the sample of proportion 2. The samples in example 1 had amplicons of a minimum depth of 70, which was higher than in comparative examples 1 and 2. From the data efficiency, the efficiency of the sample in example 1 is higher than that of comparative examples 1 and 2, which shows that the saliva sample preserved in example 1 has higher DNA quality and is more beneficial to high-throughput sequencing.

(6) And (3) carrying out long fragment amplification on the saliva DNA sample which is stored in the storage solution in the step (2) for 2 months and extracted by using the kit, wherein the specific method comprises the following steps:

the amplification primers were as follows:

CYP2D6-F：5’-GCAGGCTTCAGGAGCTTGGAGTG-3’

CYP2D6-R：5’-TAGGTAGCCCTGGCATATAGCT-3’

the PCR reaction system is as follows:

gDNA(50ng)	XμL
		2×Vazyme LAmp Master Mix	10μL
CYP2D6-F	0.8μL
		CYP2D6-R	0.8μL
ddH20	(8.4-X)μL

the PCR amplification procedure was as follows: 3min at 95 ℃; circulating for 5 times at 95 deg.C for 30s and 74 deg.C for 5 min; circulating for 5 times at 95 deg.C for 30s and 72 deg.C for 5 min; circulating for 23 times at 95 deg.C for 30s, 65 deg.C for 30s, and 72 deg.C for 5 min; 10min at 72 ℃; maintaining at 16 ℃. The results are shown in FIG. 4 (FIG. 4 is an image of a DNA gel amplified with the CYP2D6 primer after 2 months of standing the sample 1 mixed with the products of examples 1-5 and comparative examples 1-6).

From the data in FIG. 4, it can be seen that: examples 1-5 had amplified bands, whereas comparative examples 1-6 had no amplified bands. It is likely that the DNAs of comparative examples 1 to 6 were fragmented and insufficient in integrity, resulting in failure to perform long-fragment amplification, while the DNAs of examples 1 to 5 were good in integrity and capable of performing long-fragment amplification. And the amplified bands of the examples 1-3 have higher brightness than those of the examples 4-5, which shows that the saliva preservation solution of the examples 1-3 is more favorable for maintaining the integrity of DNA.

The applicant states that the saliva preservation solution and the preparation method and application thereof are illustrated by the above examples, but the invention is not limited to the above examples, i.e. the invention is not limited to the above examples. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are within the protective scope of the present invention.

It should be noted that the various technical features described in the above embodiments can be combined in any suitable manner without contradiction, and the invention is not described in any way for the possible combinations in order to avoid unnecessary repetition.

SEQUENCE LISTING

<110> Donggao Muohua Gene science and technology Co., Ltd

<120> saliva preservation solution and preparation method and application thereof

<130>2019

<160>6

<170>PatentIn version 3.3

<210>1

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>1

agagtttgat cctggctca 19

<210>2

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>2

ggttaccttg ttacgactt 19

<210>3

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>3

agttgacctt catacgttct gtg 23

<210>4

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>4

taaatcatca agtgctcaca agg 23

<210>5

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>5

gcaggcttca ggagcttgga gtg 23

<210>6

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>6

taggtagccc tggcatatag ct 22

Claims (13)

1. A saliva preservation solution is characterized by comprising the following components: 3-8mmol/L of EDTA, 3-8mmol/L of ethylene glycol-bis- (2-aminoethylether) tetraacetic acid, 40-60 mu g/mL of benzylpenicillin sodium salt, 40-60 mu g/mL of streptomycin sulfate, 40-60mmol/L of Tris-HCl, 5-15mmol/L, N-Tris (hydroxymethyl) methylglycine of 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid, 5-15 mu g/mL of protease K and 5-15mmol/L of sucrose, and the solvent is sterile water.

2. The saliva preserving fluid according to claim 1, wherein the saliva preserving fluid comprises the following components: EDTA5mmol/L, ethylene glycol-bis- (2-aminoethylether) tetraacetic acid 5mmol/L, benzyl penicillin sodium salt 50. mu.g/mL, streptomycin sulfate 50. mu.g/mL, Tris-HCl 50mmol/L, 4- (2-hydroxyethyl) -1-piperazine ethanesulfonic acid 10mmol/L, N-Tris (hydroxymethyl) methylglycine 50mmol/L, proteinase K10. mu.g/mL, sucrose 10mmol/L, and the solvent is sterile water.

3. The saliva preserving fluid of claim 1, further comprising a humectant P-40.

4. The saliva preserving fluid according to claim 3, wherein the humectant P-40 is present in the saliva preserving fluid in a volume fraction of 0.05% to 0.5%.

5. The saliva preserving fluid of claim 1, further comprising Triton X-100.

6. The saliva preserving fluid of claim 5, wherein the volume fraction of Triton X-100 in the saliva preserving fluid is between 0.01% and 0.5%.

7. The saliva preserving fluid of claim 1, further comprising sodium hydroxide 1 to 12 mmol/L.

8. The method for producing a saliva preserving fluid as claimed in any of claims 1 to 7, characterized in that the method comprises the steps of:

preparing stock solutions of all components in the saliva preservation solution, respectively measuring all the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value, and sterilizing to obtain the saliva preservation solution.

9. The method for producing a saliva preserving fluid as claimed in claim 8, wherein the pH is adjusted to 7 to 10.

10. The method for producing a saliva preserving fluid as claimed in claim 8, wherein the pH is adjusted to 7.5 to 8.5.

11. The method for preparing a saliva preserving fluid as claimed in claim 8, wherein the sterilization is performed by filtration through a microporous membrane.

12. The method for preparing a saliva preserving fluid as claimed in claim 8, wherein the method comprises the steps of:

preparing stock solutions of all components in the saliva preservation solution, respectively measuring all the stock solutions according to the final concentration requirement, mixing and dissolving, fixing the volume with sterile water, adjusting the pH value to 7-10, and sterilizing by adopting a microporous filter membrane filtration mode to obtain the saliva preservation solution.

13. Use of a saliva preserving fluid as claimed in any one of claims 1 to 7 for preserving saliva DNA samples.

Images