CN110093433A - The SNP marker and its application of Streptococcusagalactiae - Google Patents
The SNP marker and its application of Streptococcusagalactiae Download PDFInfo
- Publication number
- CN110093433A CN110093433A CN201910327304.1A CN201910327304A CN110093433A CN 110093433 A CN110093433 A CN 110093433A CN 201910327304 A CN201910327304 A CN 201910327304A CN 110093433 A CN110093433 A CN 110093433A
- Authority
- CN
- China
- Prior art keywords
- snp marker
- streptococcusagalactiae
- base
- snp
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000193985 Streptococcus agalactiae Species 0.000 title claims abstract description 90
- 239000003550 marker Substances 0.000 title claims abstract description 88
- 229940030998 streptococcus agalactiae Drugs 0.000 title claims abstract description 86
- 239000002773 nucleotide Substances 0.000 claims abstract description 43
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 43
- 230000001580 bacterial effect Effects 0.000 claims description 28
- 238000000034 method Methods 0.000 claims description 14
- 229940031567 attenuated vaccine Drugs 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000001514 detection method Methods 0.000 claims description 6
- 238000012163 sequencing technique Methods 0.000 claims description 6
- 241000194036 Lactococcus Species 0.000 claims description 3
- 150000007523 nucleic acids Chemical class 0.000 claims 7
- 102000039446 nucleic acids Human genes 0.000 claims 7
- 108020004707 nucleic acids Proteins 0.000 claims 7
- 239000002253 acid Substances 0.000 claims 5
- 241001478240 Coccus Species 0.000 claims 1
- 239000002585 base Substances 0.000 description 58
- 108020004414 DNA Proteins 0.000 description 29
- 239000012634 fragment Substances 0.000 description 13
- 229960005486 vaccine Drugs 0.000 description 8
- 241000894006 Bacteria Species 0.000 description 7
- 230000009182 swimming Effects 0.000 description 7
- 230000003321 amplification Effects 0.000 description 6
- 238000003199 nucleic acid amplification method Methods 0.000 description 6
- 241000276701 Oreochromis mossambicus Species 0.000 description 5
- 238000012216 screening Methods 0.000 description 5
- 239000003513 alkali Substances 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 3
- 230000004069 differentiation Effects 0.000 description 3
- 238000002372 labelling Methods 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- FRXSZNDVFUDTIR-UHFFFAOYSA-N 6-methoxy-1,2,3,4-tetrahydroquinoline Chemical compound N1CCCC2=CC(OC)=CC=C21 FRXSZNDVFUDTIR-UHFFFAOYSA-N 0.000 description 2
- 241000194035 Lactococcus lactis Species 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 235000014897 Streptococcus lactis Nutrition 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000005119 centrifugation Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 238000012268 genome sequencing Methods 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 241000251468 Actinopterygii Species 0.000 description 1
- 108020000946 Bacterial DNA Proteins 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 241000192125 Firmicutes Species 0.000 description 1
- 102100030569 Nuclear receptor corepressor 2 Human genes 0.000 description 1
- 101710153660 Nuclear receptor corepressor 2 Proteins 0.000 description 1
- 241000194017 Streptococcus Species 0.000 description 1
- 241000276707 Tilapia Species 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000009360 aquaculture Methods 0.000 description 1
- 244000144974 aquaculture Species 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000004087 circulation Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 230000010354 integration Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 230000000869 mutational effect Effects 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 238000004064 recycling Methods 0.000 description 1
- 238000009781 safety test method Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 239000008223 sterile water Substances 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the SNP markers and its application of one group of Streptococcusagalactiae.Wherein, the first SNP marker is nucleotide sequence the 93rd base A or G shown in SEQ ID NO:1；Second SNP marker is nucleotide sequence the 102nd base T or C shown in SEQ ID NO:2；Third SNP marker is nucleotide sequence the 234th base T or G shown in SEQ ID NO:3；4th SNP marker is nucleotide sequence the 82nd base A or C shown in SEQ ID NO:4；5th SNP marker is the 235th bases G of nucleotide sequence or C or T shown in SEQ ID NO:5；6th SNP marker is nucleotide sequence the 63rd base C or T shown in SEQ ID NO:6.SNP marker of the invention can be used for the identification of Streptococcusagalactiae strain level, can be used as the label for identifying TFJ0901 plants of Streptococcusagalactiae yes or no of molecule to be measured.
Description
Technical field
The present invention relates to molecular biology field, in particular it relates to one group of Streptococcusagalactiae SNP marker and its answer
With.
Background technique
Streptococcusagalactiae is a kind of gram-positive bacteria, can endanger a variety of hosts.In recent years, Tilapia mossambica aquaculture is deep by nothing
The influence of streptococcus lactis disease.Higher morbidity and mortality are caused, bring huge economic damage to China's Tilapia mossambica industry
It loses.Before this, we separate from Tilapia mossambica has identified one plant of Streptococcusagalactiae Natural Avirulent Strain TFJ0901, analyzes simultaneously
Potentiality of the low virulent strain TFJ0901 as live vaccine.Safety testing shows to show that TFJ0901 plants can develop into potency test
Live vaccine, to protect Tilapia mossambica from the infection of Streptococcusagalactiae.
In view of value of the low virulent strain TFJ0901 on vaccine development, in order to be protected to its intellectual property, Yi Ji
In the application process of later attenuated vaccine, prevent vaccine strain TFJ0901 to the dry of the pathogenic dientification of bacteria in streptococcus morbidity fish body
It disturbs, now there is an urgent need to a kind of differentiations to identify the molecular labeling without galactococcus low virulent strain TFJ0901 Yu other Streptococcusagalactiae bacterial strains
And method.It there is no at present for identifying the molecular labeling without galactococcus low virulent strain TFJ0901 Yu other Streptococcusagalactiae bacterial strains,
And SNP marker has many advantages, such as that inheritance stability, mutation rate are low, is convenient for automatic detection, it is existing at present much to come using SNP marker
The report of the vaccine strain and street strain of identifying certain viruses is distinguished, thus, attenuated vaccine strain is excavated in full-length genome level
TFJ0901 special SNP marker has feasibility and necessity.And currently without for identifying without galactococcus low virulent strain
The SNP marker of TFJ0901 and other Streptococcusagalactiae bacterial strains, present invention firstly discloses be used for Streptococcusagalactiae low virulent strain
The SNP marker of the identification of TFJ0901 specificity can be used for TFJ0901 plants of live vaccine in later process of clinical application
The differentiation of popular pathogen is identified, significant for the prevention and control of Streptococcusagalactiae disease.Streptococcusagalactiae low virulent strain TFJ0901 is protected
It is stored in the China typical culture collection center for being deposited in Wuhan, China university, deposit number are as follows: CCTCC NO:M 2016792, and
And to the bacterial strain and its attenuated vaccine patent protection, number of patent application are as follows: 201810280207.7.SNP marker, which has, to be lost
Pass stablize, mutation rate is low, is convenient for the advantages that automatic detection, existing at present much to distinguish identification vaccine strain using SNP marker
With the report of street strain, thus, excavating that the special SNP marker of attenuated vaccine strain TFJ0901 has in full-length genome level can
Row and necessity.
Summary of the invention
To solve the above-mentioned problems, the present invention provides one group of Streptococcusagalactiae SNP markers, can based on these SNP markers
To detect whether Streptococcusagalactiae to be checked is low virulent strain TFJ0901.Streptococcusagalactiae low virulent strain TFJ0901, which is stored in, to be deposited in
The China typical culture collection center of Wuhan University, state, deposit number are as follows: CCTCC NO:M 2016792, and to the bacterial strain and
Its attenuated vaccine patent protection, number of patent application are as follows: 201810280207.7.
Wherein, it should be noted that SNP (single nucleotide polymorphism, SNP), i.e. mononucleotide
Polymorphism is the molecule that the human genome research center scholar Lander by Massachusetts Institute Technology in 1996 is proposed
Genetic marker is primarily referred to as DNA sequence polymorphism caused by a single nucleotide variation in genomic level.SNP performance
Polymorphism out relates only to the variation of single base, and performance is that have conversion, transversion, insertion and missing etc..
According to an aspect of the present invention, the present invention provides one group of Streptococcusagalactiae bacterial strain SNP markers.According to the present invention
Embodiment, this group of SNP label includes: the first SNP marker is nucleotide sequence the 93rd base A or G shown in SEQ ID NO:1；
Second SNP marker is nucleotide sequence the 102nd base T or C shown in SEQ ID NO:2；Third SNP marker is SEQ ID NO:3
Shown nucleotide sequence the 234th base T or G；4th SNP marker be SEQ ID NO:4 shown in the 82nd base A of nucleotide sequence or
C；5th SNP marker is the 235th bases G of nucleotide sequence or C shown in SEQ ID NO:5, T；6th SNP marker is SEQ ID
The base of nucleotide sequence the 63rd shown in NO:6 C or T.
According to an embodiment of the invention, first SNP marker is located at the box of nucleotide sequence shown in SEQ ID NO:1
Mark:
Second SNP marker is located at the box mark of nucleotide sequence shown in SEQ ID NO:2:
The third SNP marker is located at the box mark of nucleotide sequence shown in SEQ ID NO:3:
4th SNP marker is located at the box mark of nucleotide sequence shown in SEQ ID NO:4:
5th SNP marker is located at the box mark of nucleotide sequence shown in SEQ ID NO:5:
6th SNP marker is located at the box mark of nucleotide sequence shown in SEQ ID NO:6:
According to an embodiment of the invention, when first SNP marker be base A, when second SNP marker be base T,
When the third SNP marker be base T, when the 4th SNP marker be base A, when the 5th SNP marker be bases G,
And when the 6th SNP is labeled as base C, no lactococcus strain is determined as TFJ0901 plants.Inventor determines as a result, this
One group of SNP marker of invention can effectively distinguish identification Streptococcusagalactiae bacterial strain yes or no low virulent strain TFJ0901 to be measured.
According to another aspect of the present invention, the present invention also provides one group of SNP markers of the invention above-mentioned, in agalasisa chain
Purposes in the identification of meningitidis strains level.It can be by carrying out the base class of above-mentioned one group of SNP marker to Streptococcusagalactiae to be measured
The detection of type, so that it is determined that described TFJ0901 plants of Streptococcusagalactiae bacterial strain yes or no to be measured.
In accordance with a further aspect of the present invention, the present invention also provides a kind of differentiation identify Streptococcusagalactiae TFJ0901 plant and
The method of other Streptococcusagalactiae bacterial strains.According to an embodiment of the invention, this method carries out front to Streptococcusagalactiae to be detected
The detection of one group of SNP marker determines described TFJ0901 plants of Streptococcusagalactiae bacterial strain yes or no to be measured.Specifically, may be used
By can be used in detecting the primer above-mentioned of the invention for identifying relevant SNP marker to Streptococcusagalactiae strain level
It is right, extracting genome DNA, PCR amplification, sequencing are carried out to Streptococcusagalactiae to be detected, determine agalasisa hammer to be checked to detect
The base type of the above-mentioned SNP marker of bacterium, and then Streptococcusagalactiae to be detected can effectively be determined based on the base type of acquisition
Yes or no Natural Avirulent Strain TFJ0901.Specifically, when first SNP marker is base A, when second SNP marker is
Base T, when the third SNP marker is base T, when the 4th SNP marker is base A, when the 5th SNP marker is alkali
Base G, and when the 6th SNP marker is base C, no lactococcus strain is determined as TFJ0901 plants.Before being used to detect as a result,
The primer pair for the of the invention one group SNP label stated, can be special effective for Streptococcusagalactiae attenuated vaccine strain TFJ0901
The identification of property, to realize that low virulent strain TFJ0901 intellectual property protection and safety when clinical application in vaccine development are commented
Estimate.
Present invention SNP marker relevant to the identification of Streptococcusagalactiae bacterial strain and its application have the advantages that
1. one group of SNP marker specificity provided by the invention is high, it can be used as and distinguish Streptococcusagalactiae attenuated vaccine strain
The molecular labeling of TFJ0901 and other bacterial strains.
2. the method for detection SNP provided by the invention, specific amplification is good, can accurate and specific amplification SNP marker
The nucleotide fragments at place, to test the precise Identification of Streptococcusagalactiae strain level.
Detailed description of the invention
Fig. 1 is nucleotide fragments amplification where 6 SNP sites.Using the DNA of the Streptococcusagalactiae of clinical sample as template,
The amplification that the nucleotide fragments of SNP site are carried out with specificity, amplified production is detected with agarose gel electrophoresis.Swimming lane M,
DL1000marker；Swimming lane 1, SEQ the ID NO:1, fragment length 254bp expanded；Swimming lane 2, the SEQ ID expanded
NO:2, fragment length 427bp；Swimming lane 3, SEQ the ID NO:3, fragment length 759bp expanded；Swimming lane 4, expands
SEQ ID NO:4, fragment length 399bp；Swimming lane 5, SEQ the ID NO:5, fragment length 764bp expanded；Swimming lane 6 expands
Increase obtained SEQ ID NO:6, fragment length 786bp.
Specific embodiment
The embodiment of the present invention is described below in detail.The embodiments described below with reference to the accompanying drawings are exemplary, only
It is used to explain the present invention, and is not considered as limiting the invention.
1 Streptococcusagalactiae low virulent strain TFJ0901 genome sequencing of embodiment and its specificity SNP screening
1. sample gene group DNA is extracted
By the bacterium solution of the Streptococcusagalactiae TFJ0901 of culture after thalline were collected by centrifugation, according to TIANamp Genomic DNA
The method that kit (Tiangen, Beijing, China) kit provides extracts the genomic DNA of bacterium, carries out concentration and purity
Measurement, and the verifying identification of kind.
2. genome sequencing
The qualified genomic DNA of verifying is interrupted at random, and screening mean size is 20kb double-stranded DNA segment, then
SMRTbell library is constructed, (single molecular real time is sequenced based on PacBio unimolecule in real time
Sequencing, SMRT) method be sequenced on PacBio Sequel platform, the initial data of acquisition is assessed
Afterwards, it is assembled using the splicing that Smrtlin4.1 is sequenced, obtains the whole genome sequence of bacterium, the TFJ0901's of assembling is complete
Genomic data has been filed in GenBank database, and acquisition number is CP034315.1 (table 1).Wherein original series upload to
Sequence Read Archive (SRA), acquisition number are PRJNA475097.
The screening of 3.TFJ0901 specificity snp analysis
The full-length genome data of 21 plants of Streptococcusagalactiaes are randomly choosed from GenBank database, selected bacterial strain covering is not
With serotype and host's (table 1), using MUMmer (version3.23) by the whole genome sequence of these bacterial strains one by one with nothing
The whole genome sequence of streptococcus lactis TFJ0901 is compared, and obtains all SNP sites, then integrates these SNP sites, looks into
Look for these SNP sites corresponding base type on each bacterial strain.No galactococcus is filtered out from the SNP site after integration again
The distinctive SNP mutation site TFJ0901.It is peculiar to obtain 6 Streptococcusagalactiae TFJ0901 for screening from 2079300 SNP sites
SNP site (table 1), 6 SNP sites are located at 6 different nucleotide sequences (SEQ ID NO:1-SEQ ID NO:6)
In.1st special SNP site is located at the 93rd base of nucleotide sequence shown in SEQ ID NO:1, and TFJ0901 plants of Streptococcusagalactiae
It is A in the site base, base of other Streptococcusagalactiae bacterial strains in the site is G；2nd special SNP site is located at SEQ
The 102nd base of nucleotide sequence shown in ID NO:2, TFJ0901 plants of Streptococcusagalactiae are T, other agalasisa chains in the site base
Base of the meningitidis strains in the site is C；3rd special SNP site is located at nucleotide sequence the 234th shown in SEQ ID NO:3
Base, TFJ0901 plants of Streptococcusagalactiae are T in the site base, and base of other Streptococcusagalactiae bacterial strains in the site is G；
4th special SNP site is located at the 82nd base of nucleotide sequence shown in SEQ ID NO:4, and TFJ0901 plants of Streptococcusagalactiae at this
Site base is A, and base of other Streptococcusagalactiae bacterial strains in the site is C；5th special SNP site is located at SEQ ID
The base of nucleotide sequence the 235th shown in NO:5, TFJ0901 plants of Streptococcusagalactiae are G, other Streptococcusagalactiaes in the site base
Base of the bacterial strain in the site is C or T；6th special SNP site is located at the 63rd alkali of nucleotide sequence shown in SEQ ID NO:6
Base, TFJ0901 plants of Streptococcusagalactiae are C in the site base, and base of other Streptococcusagalactiae bacterial strains in the site is T.It answers
With Annovar software to detecting that 6 sites SNP carry out functional annotation, it is found that this 6 sites are located at 6 different volumes
It in code gene, and is all nonsynonymous mutation (table 1) in TFJ0901.By in the TFJ0901 genome of above-mentioned screening special 6
Genome sequence of the gene order respectively with the Streptococcusagalactiaes announced all in NCBI where a SNP site is compared
It is right, it is found that the base type of this 6 SNP sites and other all Streptococcusagalactiae bacterial strains are all different in TFJ0901 genome,
Further prove specificity of the Streptococcusagalactiae low virulent strain TFJ0901 in 6 SNP site bases.
Table 1 is compared with Streptococcusagalactiae information and the TFJ0901 plants of different mutational site information of special genome
Note: sequence where the special SNP site of a..Position of the site b.SNP in SEQ sequence.C. the alkali of special SNP site
Base type.D. special SNP site is in the position of the genome of corresponding bacterial strain.E. "-" indicates that serotype is unknown.
2 SNP marker of embodiment is used for the parting verifying of clinical Streptococcusagalactiae street strain
1. extracting the genomic DNA of the Streptococcusagalactiae to be measured being clinically separated
Clinic Streptococcusagalactiae to be measured is totally separated to the ill tilapia of southern china Tilapia mossambica culture zone (table 2),
By the Streptococcusagalactiae bacterium solution of culture after thalline were collected by centrifugation, according to Bacterial DNA Kit (Omega Bio-Tek) reagent
The method that box provides extracts the genomic DNA of bacterium.
2. expanding the nucleotide fragments containing SNP site
Using the aforementioned genomic DNA for extracting each Streptococcusagalactiae to be measured obtained as template, it is utilized respectively primer pair P1/
P2:TGAAGAAGCGGAAGTTTTA (SEQ ID NO:7) and CAATGGTATCGTTGATATGC (SEQ ID NO:8), primer
To P3/P4:AGTATCCCACACCATAGCAAA (SEQ ID NO:9) and TTTTTCACTTCGTCATTTTCC (SEQ ID NO:
10) primer pair P5/P6:AAAAACACAGTAAATCCGACAT (SEQ ID NO:11) and ATTGAAGATAGAGGTCCCACAT
(SEQ ID NO:12), primer pair P7/P8:GTATTTATGGTATTTTTCGTGG (SEQ ID NO:13) and
GGTTATCGTCATTATCTACAGC (SEQ ID NO:14), primer pair P9/P10:GCCTTCTCTGCCAATGTAATA (SEQ
ID NO:15) and ACCAAATAAAGTGTCGCCTAC (SEQ ID NO:16), primer pair P11/P12:
ACCACTCTTCTGTGATTTCTCG (SEQ ID NO:17) and ATTTTTGGACTTATTGGGCTAC (SEQ ID NO:18) expands
Increase the nucleotide fragments out where SNP to be measured.Each primer pair prepares PCR system respectively, and PCR amplification is according to Premix Taq
(TaKaRa TaqTMVersion2.0plus dye) test box prepares reaction system, and the amplification system of the PCR amplification is with 25 μ L
It is calculated as: primer each 1 μ L, Premix shown in the SEQ ID NO:7-18 of 2 μ L, the 10pmol/ μ l of template DNA of 2.5-25ng/ μ L
Taq12.5 μ L, 8.5 μ L of sterile water；The reaction condition of the PCR amplification are as follows: 94 DEG C, 8min；94 DEG C, 30s, 55 DEG C, 30s, 72
DEG C, 1min, 30 circulations；72 DEG C, 10min.
3. sequencing identification SNP site genotype
PCR product obtained in abovementioned steps is first detected through 1.5% agarose gel electrophoresis, as shown in Figure 1, expanding
The purpose band specificity of increasing is good, only generates a band, the target fragment SEQ ID NO:1-SEQ ID NO:6 difference of amplification
For band shown in 1-6, size is respectively 254bp, 427bp, 759bp, 399bp, 764bp, 786bp.Gel extraction purpose
After band, directly send the target fragment of recycling to sequencing, respectively identify SEQ ID NO:1-6 sequence in 93bp, 102bp,
Base type at 234bp, 82bp, 235bp, 63bp.In this 6 sites SNP, all clinical agalasisa hammers are surveyed in discovery
Bacteria strain is the same in the base of same SNP site, is G in the base of the first SNP site, in the base of the second SNP site
It is G in the base of third SNP site for C, is C in the base of the 4th SNP site, be G in the base of the 5th SNP site, the
The base of six SNP sites is C, and Streptococcusagalactiae low virulent strain TFJ0901 is respectively as follows: the in the base type of this 6 SNP sites
The base of one SNP site is A, and the base of the second SNP site is T, and the base of third SNP site is T, the alkali of the 4th SNP site
Base is A, and the base of the 5th SNP site is G, and the base of the 6th SNP site is C.Show TFJ0901 plants of Streptococcusagalactiae with it is other
Base type of the bacterial strain in this 6 SNP sites is different, can by the determination of the base type of this 6 SNP sites,
Realize the specificity identification to TFJ0901 plants.
The information of 2 Streptococcusagalactiae clinical separation strain of table
Sequence table
<110>Zhongshan University
<120>SNP marker and its application of Streptococcusagalactiae
<141> 2019-04-22
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 254
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 1
tgaagaagcg gaagttttag aacatactgt atcaacaact tttgttgatc aattagaaaa 60
gttgttagac tttccacaat tttgtccaca cgatgggact attcctaaaa agggagagtt 120
tttagtagaa attaaccaaa tgacattgga ccaaattagt cagcttggca catatgttat 180
cagtcgtgtt catgatgatt ttcagctact gaaataccta gaacaacacc gtttgcatat 240
caacgatacc attg 254
<210> 2
<211> 427
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 2
agtatcccac accatagcaa agtcatctgc attttcatga taagaataac caggaaatac 60
tttatctgtt tgataagtcg aatgaacatc aaaaataaag atgccatttt cttctaaggc 120
cttatagact tcgataaaaa catcaccaac ctcgacttca tcttgcatat aacaaataga 180
gtctgaatag cacgtgatga gatcatattt accaacatta gataaatcta acatatttcc 240
ttcaataaac tggatacttt ggtgagcaga agttgcacgt tttttggcaa gtttcagcat 300
atcgccacta agatcaagtc ctgtaacagc ataaccagct tgtgcaaatc gaacagactg 360
aattcccgta ccacatgcta attccaaaag ttttttctta ccttttggaa aatgacgaag 420
tgaaaaa 427
<210> 3
<211> 759
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 3
aaaaacacag taaatccgac attcaaaagc attatgacat cggaaatgat ttctataaac 60
tttggcttga tgataccatg acttattcat gcgcctattt taaacatgaa aatgacagtc 120
tagagcaagc tcaactaaac aaagtacacc atattcttaa taaattaaat gctcatccgg 180
gagggaaatt actagatatc ggttgtggct gggggacact tatcattact gcttctaaag 240
aatatggctt aaatgcgaca ggtatcacct taagtgaaga gcaggcttcc ttcattacta 300
agcgtatcaa ggaagaagga ttggaaaata aagtaacagt cctcattaaa gattatcgtg 360
acattcatga aacatacgat tatatcacta gtgttggtat gtttgaacat gtaggaaaag 420
aaaatttatc tcaatacttc caaactattt ctaaaagact caacattaat ggtctagctc 480
ttattcatgg tattactgga caagtgggtg gtaatcatgg tagtggaact aattcttgga 540
ttaataagta tatcttccca ggaggatata tccctcgttt aactgaaaat ttaaatcata 600
tagctagtgc tggacttcaa attgctgact tagaaccgct tcgtcgtcac tatcaaaaga 660
ctctcgaatt atggacaaaa aatttccata atgcccttcc tgaagttcag aaaactcatg 720
ataagcgttt tatcaatatg tgggacctct atcttcaat 759
<210> 4
<211> 399
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 4
gtatttatgg tatttttcgt gggaataatg ttcgctctgt ttttgaccat attagaagtg 60
gtcgtgagtg gggcttaggt aaactgttga gtcactattc tttaggattc tatgatacag 120
acgatgatac tcgtacagtc aatggggatt attacgatca aattttaact tacttgaggc 180
gttcgggtag cgaccagacg atatatatga gttgtgatat gctttgtaat attgacttaa 240
gtcaagtaat ccacttgcat aatgcaaatg gtgcgcaagc caccgtggtt tataaaaaaa 300
tgccgagatc agctattgca gaggctaatc aagtcttgac cattgatgaa tctgatcatg 360
tagtgagtct aggtaaagct gtagataatg acgataacc 399
<210> 5
<211> 764
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 5
gccttctctg ccaatgtaat actctcacta aaataatctt ctcatttagt attaattgat 60
attatttttt tatttttctt atttttttta aaaaaagact tgactttttt tgcaaacggt 120
tgcataatat aggtgtaatt aaaatattct ctaggaggag aaccaaaatg gaaaaaaata 180
cttggaaaaa attacttgtt agtactgctg ctctttcagt agttgcagga ggaggaattg 240
ctgctactca ctctaactca gttgatgctg cttcaaaaac aactatcaaa ctttgggtcc 300
caacagattc aaaagcgtct tataaagcaa ttgttaaaaa attcgagaag gaaaacaaag 360
gcgttactgt aaaaatgatt gagtctaatg actctaaagc tcaagaaaac gttaaaaaag 420
acccaagcaa ggcagccgat gtattctcac ttccacatga ccaacttggt caattagtag 480
aatctggtgt tatccaagaa attccagagc aatactcaaa agaaattgct aaaaacgaca 540
ctaaacaatc acttactggt gcacaatata aagggaaaac ttatgcattc ccatttggta 600
ttgaatctca agttctttat tataataaaa caaagttaac tgctgacgac gttaaatcat 660
acgaaacaat tacaagcaaa gggaaattcg gtcaacagct taaagcagct aactcatatg 720
taacaggccc tcttttcctt tctgtaggcg acactttatt tggt 764
<210> 6
<211> 786
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 6
accactcttc tgtgatttct cgaccagtac attcttcaat tggtttttta atataattac 60
ctcccacatt tgaatagagt ccataaatcc aaacaattgt ttcattttcc ttttgctctt 120
tgaaatgcgg ttggcgatgg atagcaaaac tcatcatcca attagaatct gtaactgtaa 180
caatgcctcc ggtatttact ttaccatcat ggaggtcacg atgtgttaaa cgctctatat 240
aaggttcaat agctggatct tttattgttg cagtagcaga aacaaaccat gactcttttg 300
gaatatcttt gtagaagact ttaggatgtc caaattcatc agattgagca gctaagtttt 360
cccaaagatt ccaagaacct cccaaatcgg tattaggttt agctacagta tcatgactac 420
catagttcgt actttcagtg atagaaccat tcgttacaaa aacaaaatca tttggagtaa 480
gatcaattgt ttttgcttca ccaccaactg tgagatgaat agcttttgca agcttctgac 540
tgttcttaaa gtctacggag atattagtta ccttgctatc aaattgaaca tctacattat 600
gagactctaa ataactgatg attggtttca ccatagaatc atattgatta tatttattaa 660
attttaatga agtgaaatca ggcagaccac caatatgatg gataaagcgc atagcatatc 720
gacgcatttc aatcgctgaa tgccatttct caaaggcaaa catagtagcc caataagtcc 780
aaaaat 786
<210> 7
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tgaagaagcg gaagtttta 19
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
caatggtatc gttgatatgc 20
<210> 9
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
agtatcccac accatagcaa a 21
<210> 10
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tttttcactt cgtcattttc c 21
<210> 11
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
aaaaacacag taaatccgac at 22
<210> 12
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
attgaagata gaggtcccac at 22
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
gtatttatgg tatttttcgt gg 22
<210> 14
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
ggttatcgtc attatctaca gc 22
<210> 15
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gccttctctg ccaatgtaat a 21
<210> 16
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
accaaataaa gtgtcgccta c 21
<210> 17
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
accactcttc tgtgatttct cg 22
<210> 18
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
atttttggac ttattgggct ac 22
Claims (6)
1. the SNP marker of one group of Streptococcusagalactiae strain level identification, characterized by comprising:
First SNP marker, first SNP marker are base A or G, and the SNP marker is located at the 93rd of nucleic acid, the core
Acid has nucleotide sequence shown in SEQ ID NO:1；
Second SNP marker, second SNP marker are base T or C, and the SNP marker is located at the 102nd of nucleic acid, the core
Acid has nucleotide sequence shown in SEQ ID NO:2；
Third SNP marker, the third SNP marker are base T or G, and the SNP marker is located at the 234th of nucleic acid, the core
Acid has nucleotide sequence shown in SEQ ID NO:3；
4th SNP marker, the 4th SNP marker are base A or C, and the SNP marker is located at the 82nd of nucleic acid, the core
Acid has nucleotide sequence shown in SEQ ID NO:4；
5th SNP marker, the 5th SNP marker are bases G or C or T, and the SNP marker is located at the 235th of nucleic acid, institute
Nucleic acid is stated with nucleotide sequence shown in SEQ ID NO:5；
6th SNP marker, the 6th SNP marker are base C or T, and the SNP marker is located at the 63rd of nucleic acid, the core
Acid has nucleotide sequence shown in SEQ ID NO:6.
2. the SNP marker of one group of Streptococcusagalactiae strain level identification as described in claim 1, which is characterized in that work as institute
Stating the first SNP marker is base A, when second SNP marker is base T, when the third SNP marker is base T, when described
4th SNP marker be base A, when the 5th SNP marker be bases G, and when the 6th SNP marker be base C when, agalasisa
Meningitidis strains are determined as TFJ0901 plants.
3. the described in any item one group of SNP marker of claim 1-2, in Streptococcusagalactiae attenuated vaccine strain TFJ0901 specificity
Purposes in identification.
4. a kind of method for distinguishing Streptococcusagalactiae TFJ0901 plants with other Streptococcusagalactiae bacterial strains, which is characterized in that by right
Streptococcusagalactiae to be measured carries out the detection of one group of SNP marker described in claim 1-3, determines that Streptococcusagalactiae bacterial strain to be measured is
Or be not TFJ0901 plants, further comprise:
1) genomic DNA of Streptococcusagalactiae to be measured is extracted；
2) it is utilized respectively primer pair P1/P2, P3/P4, P5/P6, P7/P8, P9/P10 and P11/P12, by the agalasisa chain to be measured
The genomic DNA of coccus carries out PCR amplification, to obtain pcr amplification product；
3) pcr amplification product is sequenced, to obtain sequencing result；
4) it is based on the sequencing result, determines the base of each in one group of SNP marker of the Streptococcusagalactiae to be measured
Type；And the base type of each in one group of SNP marker based on the Streptococcusagalactiae to be measured, determine it is described to
Survey TFJ0901 plants of the yes or no of Streptococcusagalactiae bacterial strain.
5. a kind of method for distinguishing Streptococcusagalactiae TFJ0901 plants with other Streptococcusagalactiae bacterial strains as claimed in claim 4,
It is characterized by: the primer pair sequence in step 2) is respectively as follows:
The primer pair P1/P2 has nucleotide sequence shown in SEQ ID NO:7-8, for detecting the first SNP mark
Note；
The primer pair P3/P4 has nucleotide sequence shown in SEQ ID NO:9-10, for detecting the 2nd SNP mark
Note；
The primer pair P5/P6 has nucleotide sequence shown in SEQ ID NO:11-12, for detecting the 3rd SNP mark
Note；
The primer pair P7/P8 has nucleotide sequence shown in SEQ ID NO:13-14, for detecting the 4th SNP mark
Note；
The primer pair P9/P10 has nucleotide sequence shown in SEQ ID NO:15-16, for detecting the 5th SNP
Label；
The primer pair P11/P12 has nucleotide sequence shown in SEQ ID NO:17-18, for detecting the 6th SNP
Label.
6. a kind of method for distinguishing Streptococcusagalactiae TFJ0901 plants with other Streptococcusagalactiae bacterial strains as claimed in claim 4,
It is characterized in that, in step 4) Streptococcusagalactiae to be measured determination method: when first SNP marker is base A, work as institute
State the second SNP marker be base T when, when the third SNP marker be base T when, when the 4th SNP marker be base A when,
When the 5th SNP marker is bases G, and when the 6th SNP marker is base C, no lactococcus strain to be measured determines
It is TFJ0901 plants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910327304.1A CN110093433A (en) | 2019-04-22 | 2019-04-22 | The SNP marker and its application of Streptococcusagalactiae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910327304.1A CN110093433A (en) | 2019-04-22 | 2019-04-22 | The SNP marker and its application of Streptococcusagalactiae |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110093433A true CN110093433A (en) | 2019-08-06 |
Family
ID=67445429
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910327304.1A Pending CN110093433A (en) | 2019-04-22 | 2019-04-22 | The SNP marker and its application of Streptococcusagalactiae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110093433A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116334256A (en) * | 2022-10-09 | 2023-06-27 | 中国食品发酵工业研究院有限公司 | Identification method of streptococcus thermophilus CICC6038 strain, and primer, kit and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152368A (en) * | 2014-03-11 | 2014-11-19 | 广西壮族自治区水产科学研究院 | Tilapia mossambica source streptococcus agalactiae low virulent strain and application thereof |
| CN105154435A (en) * | 2015-05-14 | 2015-12-16 | 广西壮族自治区水产科学研究院 | Streptococcus agalactiae attenuated strain YM001 genome sequence feature and use thereof |
| WO2016034879A1 (en) * | 2014-09-03 | 2016-03-10 | Moredun Research Institute | Streptococcus agalactiae antigens associated with strains virulent in fish |
-
2019
- 2019-04-22 CN CN201910327304.1A patent/CN110093433A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152368A (en) * | 2014-03-11 | 2014-11-19 | 广西壮族自治区水产科学研究院 | Tilapia mossambica source streptococcus agalactiae low virulent strain and application thereof |
| WO2016034879A1 (en) * | 2014-09-03 | 2016-03-10 | Moredun Research Institute | Streptococcus agalactiae antigens associated with strains virulent in fish |
| CN105154435A (en) * | 2015-05-14 | 2015-12-16 | 广西壮族自治区水产科学研究院 | Streptococcus agalactiae attenuated strain YM001 genome sequence feature and use thereof |
Non-Patent Citations (4)
| Title |
|---|
| LING LIU等: "Development of attenuated erythromycin-resistant Streptococcus agalactiae vaccine for tilapia (Oreochromis niloticus) culture", 《J FISH DIS》 * |
| MO,X.B等: "Accession NO: CP034315.1 Streptococcus agalactiae strain TFJ0901 chromosome, complete genome", 《GENBANK DATABASE》 * |
| WANG,R.等: "Accession NO: CP011325.1 Streptococcus agalactiae strain HN016, complete genome", 《GENBANK DATABASE》 * |
| 李莉萍等: "罗非鱼无乳链球菌弱毒株与其母源株部分生物学特性及免疫原性比较研究", 《西南农业学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116334256A (en) * | 2022-10-09 | 2023-06-27 | 中国食品发酵工业研究院有限公司 | Identification method of streptococcus thermophilus CICC6038 strain, and primer, kit and application thereof |
| CN116334256B (en) * | 2022-10-09 | 2023-11-10 | 中国食品发酵工业研究院有限公司 | Identification method of streptococcus thermophilus CICC 6038 strain, and primer, kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chacón et al. | Differentiation of field isolates and vaccine strains of infectious laryngotracheitis virus by DNA sequencing | |
| CN103805609B (en) | A kind of lasiohelea taiwana molecular assay method | |
| CN102154450B (en) | Method for detecting enteritis pathogenic bacteria | |
| CN107557478A (en) | A kind of method and its application that amplification the Changjiang river fish chondriogen total order is combined based on degenerate primer | |
| CN111052250A (en) | High resolution microbiological analysis method | |
| Stulberg et al. | A multiplex PCR assay to detect and differentiate select agent strains of Ralstonia solanacearum | |
| CN108486266B (en) | Molecular marker of corn chloroplast genome and application of molecular marker in variety identification | |
| CN105925664A (en) | Method and system for determining nucleic acid sequence | |
| Zhu et al. | Visualization-assisted binning of metagenome assemblies reveals potential new pathogenic profiles in idiopathic travelers’ diarrhea | |
| CN113481311A (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| Jones et al. | The complete sequences of two divergent variants of the rhabdovirus raspberry vein chlorosis virus and the design of improved primers for virus detection | |
| Foster et al. | A multi-gene region targeted capture approach to detect plant DNA in environmental samples: A case study from coastal environments | |
| CN110093433A (en) | The SNP marker and its application of Streptococcusagalactiae | |
| KR101166781B1 (en) | Specific primer for strain discrimination of Pleurotus spp. by analysis of mitochondria DNA polymorphism and uses thereof | |
| CN103184275A (en) | Novel method for gene identification of rice genome | |
| Manimekalai et al. | Real-time PCR technique-based detection of coconut root (wilt) phytoplasma | |
| CN113151516B (en) | Human high-risk zoonotic streptococcus suis specific sequence, detection primer and application | |
| Kathurima et al. | Diversity and phylogenetic relationships of full genome sequences of cassava brown streak viruses in Kenya | |
| CN113462799B (en) | Bacillus anthracis identification method based on chromosome specific probe | |
| CN110468226A (en) | The molecular labeling of poplar leaf rust resistance and its application | |
| CN103343169B (en) | Meloidogyne molecular identification primer set, and preparation method and application thereof | |
| CN116904620B (en) | Primer group, kit and method for rapidly detecting rice pathogenic bacteria based on MNP | |
| CN113151309B (en) | Streptococcus suis specific sequence with high risk of human beings and livestock and application thereof | |
| KR102255610B1 (en) | Genetic marker for discriminating original species of Scolopendra subspinipes mutilans | |
| CN101955932B (en) | Phakopsora pachyrhizi molecular probe and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190806 |