CN110066804A - A kind of aptamer with borax specific binding - Google Patents

A kind of aptamer with borax specific binding Download PDF

Info

Publication number
CN110066804A
CN110066804A CN201910371568.7A CN201910371568A CN110066804A CN 110066804 A CN110066804 A CN 110066804A CN 201910371568 A CN201910371568 A CN 201910371568A CN 110066804 A CN110066804 A CN 110066804A
Authority
CN
China
Prior art keywords
borax
aptamer
bor
specific binding
specifically bound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910371568.7A
Other languages
Chinese (zh)
Inventor
韩芹芹
靖乐
夏雪山
宋玉竹
张金阳
王炳辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming University of Science and Technology
Original Assignee
Kunming University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming University of Science and Technology filed Critical Kunming University of Science and Technology
Priority to CN201910371568.7A priority Critical patent/CN110066804A/en
Publication of CN110066804A publication Critical patent/CN110066804A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to field of biomedicine technology more particularly to a kind of aptamers with borax specific binding, and the aptamer nucleotide sequence with borax specific binding is as shown in SEQ ID NO:1；The aptamer is single stranded DNA, is made of 82 nucleotide, topology is straight-chain；The secondary structure of prediction has ring outstanding and stem, Gibbs free energy DG=-15.21.The present invention is capable of the identification of high-affinity high specific using the aptamer Bor-A01 that SELEX technology screening goes out and combines borax；Detection of the identification of aptamer Bor-A01 for borax remaining in food, and then reduce borax and be of great significance to the infringement of human body.

Description

A kind of aptamer with borax specific binding
Technical field
The invention belongs to field of biomedicine technology more particularly to a kind of aptamers with borax specific binding.
Background technique
Currently, the immediate prior art:
Aptamer is by index concentration Fas lignand system evolution technology (SyStematic evolution of LigandS by exponential enrichment, SELEX) screening obtain can be big with metal ion, small molecule, biology Molecule, or even the SSDNA or RNA molecule of the entire high specificity of cell and compatibility combination.Aptamer not only has antibody The evident characteristics of molecule, it is all to be related to the diagnostic field of antibody, it can nearly all be replaced with aptamer, and be also equipped with Oneself unique excellent properties, with target molecule range is wide, molecular mass is small, immunogenicity is low, is easy to chemical synthesis, transformation The advantages that with label.Aptamer and its related screening technique (SELEX), aptamer is in recent years in treatment new drug, medicine In the fields of biomedicine such as object transport, cancer cell detection, bio-imaging, the discovery of biomarker, illicit drugs inspection, antiviral Using.
Borax, generally writing Na2B4O7·10H2O is very important containing boron mineral and boron compound, usually colourless The white powder of crystal, it is soluble easily in water.Borax can be used as detergent, cosmetics, insecticide, it can also be used to configure buffer solution and Produce other boron compounds etc..The toxicity of borax is higher, is a kind of strong carcinogen, to the stomach of human body, kidney, liver, brain and Skin lesion is very big, and the adult toxic dose of borax is 1-3 grams, and adult lethal dose is 15 grams, and baby's lethal dose is 2-3 grams.People If body takes in excessive borax, the retention toxicosis of multi viscera can be caused.Long-term Excess free enthalpy borax, to human body reproduction, development With the toxic influence of endocrine system.Short time takes in large dosage of borax, may cause acute poisoning, and less serious case causes dizzy, head Bitterly, the symptoms such as loss of appetite, indigestion, weight loss；There are the poisoning manifestations such as vomiting, diarrhea, shock, stupor in serious person. There is non-specific lesion in the visible stomach of the pathologic finding of borax poisoner, kidney, liver, brain and skin, mainly have liver it is congested, Steatosis, liver cell cloudy swelling；Kidney is in diffusivity oedema, and glomerulus and renal tubule have damage；There is oedema in brain and lung. The illegal producer and retailer are in order to increase the toughness, brittleness mouthfeel or extended shelf life of food, often in the processing of food Illegal addition borax in the process.Since the strong carcinogenicity of borax and more virulent property, countries in the world generally forbid making an addition to borax In food, prohibites in China " food hygiene law " and " food additives administration of health method " and added borax as food Agent uses.
It is at present turmeric colorimetric method for detection borax main method in food.The method needs first in acid condition by boron Sand is changed into boric acid, extrapolates the additive amount of borax indirectly by detecting the content of boric acid.Due to the souring operation of early period, this The result of kind detection method has certain deviation, and testing result can only indicate there is boric acid in food, not necessarily directly It connects and is added to borax.Therefore, in order to ensure that the health of broad masses of the people, is established a kind of accurate and reliable, sensitive quick, extensive The method of borax is particularly important in applicable detection food.
In conclusion problem of the existing technology is:
At present for borax turmeric colorimetric method is detected in food, as a result there is certain deviation, and testing result can only table Show there is boric acid in food, is not necessarily directly added to borax.Foundation cannot be provided to borax in detection food.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of aptamers with borax specific binding.
The invention is realized in this way a kind of aptamer with borax specific binding, described specific with borax In conjunction with aptamer nucleotide sequence as shown in SEQ ID NO:1；The aptamer is single stranded DNA, by 82 nucleosides Acid composition, topology is straight-chain.
Further, the secondary structure of prediction has ring outstanding and stem, Gibbs free energy DG=-15.21.
Another object of the present invention is to provide a kind of screening techniques with the aptamer of borax specific binding to adopt With SELEX technology screening go out can with borax specifically bind aptamer group, design primer carry out PCR amplification, gram Grand, separation and sequencing；It is verified using enzyme-linked oligonucleotides adsorption experiment, obtains aptamers Bor-A01.
Further, the adapter-primer sequence of aptamers are as follows: Aptamer Fw:GACATATTCAGTCTGACAGC；Reverse mutual Complementary series: CGCTGTCAGACTGAATATGTC；Aptamer Rv:GCTAGACGATATTCGTCCATC, reverse complementary sequence: GATGGACGAATATCGTCTAGC；Obtained positive monoclonal carries out nucleotide sequencing, and sequencing result shows special with borax Property the aptamer that combines be made of 82 nucleotide, 5 ' ends are to 3 ' terminal sequences are as follows:
GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGCATGCACGGGAGATGGAC GAATATCGTCTAGC。
Further, it also needs to carry out aptamer single stranded DNA secondary structure characterization after obtaining aptamers Bor-A01,
Second level is carried out using the aptamer Bor-A01 single strand dna that MFOLD software pair is specifically bound with borax Structure prediction；Secondary structure has ring outstanding and stem, Gibbs free energy DG=-15.21
Further, the preparation of borax coating antigen includes:
The coating antigen that borax molecule and BSA coupling are obtained to borax by chemical method, is used for subsequent enzyme-linked oligonucleotides In adsorption measurement；The preparation situation of coating antigen is judged by ultra-violet absorption spectrum.
Another object of the present invention is to provide a kind of aptamers for being loaded with the specific binding of described and borax In identification borax or in the kit of preparation detection borax.
In conclusion advantages of the present invention and good effect are as follows:
The present invention obtains the aptamer Bor-A01 specifically bound with borax using SELEX technology screening, described Aptamer is single stranded DNA, is made of 82 nucleotide, and nucleotide sequence is as shown in SEQ ID NO:1；Its secondary structure Containing ring outstanding and stem, wherein Bor-A01 Gibbs free energy DG=-15.21.Based on enzyme-linked oligonucleotides adsorption measurement The a series of properties assessment such as aptamer specificity, affinity and sensitivity is carried out, shows Bor-A01 dissociation constant Kd= 22.08 ± 2.730nM, and can be specific in conjunction with borax, therefore the aptamer has the spy of high specific, high-affinity Point can be used in the application of the subsequent quick detection kit to borax.
The present invention is capable of the knowledge of high-affinity high specific using the aptamer Bor-A01 that SELEX technology screening goes out Not and combine borax；Detection of the identification of aptamer Bor-A01 for borax remaining in food, and then reduce borax pair The infringement of human body is of great significance.
Detailed description of the invention
Fig. 1 is the secondary structure schematic diagram provided in an embodiment of the present invention for aptamer Bor-A01.
Fig. 2 be it is provided in an embodiment of the present invention the present invention in circular dichroism detector to K+Concentration and aptamer Bor-A01 The analysis result of structural relation；
Fig. 3 is the uv absorption spectra of boric acid-BSA conjugate provided in an embodiment of the present invention；
Fig. 4 is that ELONA method divides the specificity of aptamer Bor-A01 in the present invention provided in an embodiment of the present invention It analyses, in figure: blank control: defatted milk；Negative control is non-target substance: rhodamine B, acephatemet, sodium formaldehyde sulfoxylate, boric acid；It is positive Group: borax；
Fig. 5 is that ELONA method divides the affinity of aptamer Bor-A01 in the present invention provided in an embodiment of the present invention Analysis, the affinity K of the combination of aptamer Bor-A01 and boraxdValue indicates.
Fig. 6 is sensitive to borax based on ELONA method aptamer Bor-A01 in the present invention provided in an embodiment of the present invention The analysis of degree, in figure: blank control: defatted milk；Positive group: borax；
Fig. 7 is the secondary structure figure of the aptamer Bor-A01 after different loci provided in an embodiment of the present invention truncates；
Fig. 8 is truncation experiment point of the ELONA method to aptamer Bor-A01 in the present invention provided in an embodiment of the present invention It analyses, in figure: blank control CK1: defatted milk；Blank control CK2: biotin；Positive group: being marked with the aptamers Bor- of biotin A01 and truncation aptamers Bor-A1279, Bor-A1263, Bor-A3879, Bor-A1234, the Bor- for being marked with biotin A3863、Bor-A6579。
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to Limit the present invention.
At present for borax turmeric colorimetric method is detected in food, as a result there is certain deviation, and testing result can only table Show there is boric acid in food, is not necessarily directly added to borax.Foundation cannot be provided to borax in detection food.
To solve the above problems, below with reference to concrete scheme, the present invention is described in detail.
Aptamer nucleotide sequence such as SEQ ID NO:1 provided in an embodiment of the present invention with borax specific binding It is shown；The aptamer is single stranded DNA, is made of 82 nucleotide, topology is straight-chain.
The secondary structure of prediction has ring outstanding and stem, Gibbs free energy DG=-15.21.
Another object of the present invention is to provide a kind of screening techniques with the aptamer of borax specific binding to adopt With SELEX technology screening go out can with borax specifically bind aptamer group, design primer carry out PCR amplification, gram Grand, separation and sequencing；It is verified using enzyme-linked oligonucleotides adsorption experiment, obtains aptamers Bor-A01.
The adapter-primer sequence of aptamers are as follows:
AptamerFw:GACATATTCAGTCTGACAGC；
Reverse complementary sequence: CGCTGTCAGACTGAATATGTC；
Aptamer Rv:GCTAGACGATATTCGTCCATC,
Reverse complementary sequence: GATGGACGAATATCGTCTAGC；Obtained positive monoclonal carries out nucleotide sequencing, Sequencing result shows that the aptamer specifically bound with borax is made of 82 nucleotide, 5 ' ends to 3 ' terminal sequences are as follows:
GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGCATGCACGGGAGATGGAC GAATATCGTCTAGC。
It also needs to carry out aptamer single stranded DNA secondary structure characterization after obtaining aptamers Bor-A01,
Second level is carried out using the aptamer Bor-A01 single strand dna that MFOLD software pair is specifically bound with borax Structure prediction；Secondary structure has ring outstanding and stem, Gibbs free energy DG=-15.21
The preparation of borax coating antigen includes:
The coating antigen that borax molecule and BSA coupling are obtained to borax by chemical method, is used for subsequent enzyme-linked oligonucleotides In adsorption measurement；The preparation situation of coating antigen is judged by ultra-violet absorption spectrum.
The invention will be further described combined with specific embodiments below.
Embodiment 1: the screening of borax aptamer
One, the coupling of aglucon (borax) and matrix (Ago-Gel 6B)
1, in sintered glass filter (more reciprocal of duty cycle G3) with the freeze-dried powder Ago-Gel of suspension 1g in 3mL distilled water 6B；
2, the coupling buffer solution (carbonate buffer of 0.05M, pH9.6 of 200mL is used in sintered glass filter immediately Liquid) washing matrix 1 hour；-
3, with the aglucon of the coupling buffer solution dissolution 6g of 6mL, make its ultimate density 1mg/mL；
It 4, is that 1mg/mL has dissolved the buffer solution of aglucon 1:2 ratio by volume by the concentration in step 2 matrix and step 3 Example mixing is handled 16 hours under 35 DEG C -40 DEG C of water bath condition, and 37 DEG C of shaking tables are stayed overnight；
5, under conditions of 40 DEG C -50 DEG C, with the superfluous group of the ethylaminoethanol of 1M closing, at least 4 hours or overnight；
6, surplus aglucon is washed with coupling buffer, 4000rpm is centrifuged 2 minutes, draws supernatant；With ultrapure water (each 7- 8mL) clean 3 times；And then it uses and contains 0.1M NaHCO3, 0.5M NaCl pH8.0 solution clean 3-4 times；Then with containing Have 0.1M NaCl, 0.1M acetate pH 4.0 solution clean 3-4 times；It is finally 20% ethyl alcohol with mass percent concentration 6mL is saved, and is placed in 4 DEG C of refrigerators, and sealed membrane sealing is vertical to place.
Two, the PCR of aptamer library (ssDNA)
The ssDNA aptamers library synthesized using TaKaRa company；
1,94 DEG C of preheating PCR instruments；
2, by 3 μ L ssDNA, 30.6 μ L deionized waters, 5 μ L10 × Buffer, 3 μ LMgCl2, 4 μ L dNTP mixtures it is (each 2.5 μM), 2 μ L forward direction amplimers, the reversed amplimer of 2 μ L and 0.4 μ L Taq enzyme centrifuge tube reacted；Forward direction amplification Primer sequence is 5 '-GACATATTCAGTCTGACAGC-3 ', and reversed amplimer sequence is 5 '- GCTAGACGATATTCGTCCATC-3’。
3, it is expanded in PCR instrument by following procedure
(1) initial denaturation
94 DEG C 5 minutes；
(2) 30 circulations
94 DEG C 45 seconds
58 DEG C 30 seconds
72 DEG C 30 seconds；
(3) it expands afterwards
72 DEG C 7 minutes.
Three, the purifying in ligand library, loading and elution
1, the purifying in ligand library
(1) directly 1:1 ratio is mixed by volume with the solution in plastic recovery kit for aptamer library PCR product It closes, carries out DNA fragmentation recycling；
(2) DNA fragmentation recycling after, 95 DEG C water-bath 10 minutes, ice bath 10 minutes；By this denaturation treatment, become double-stranded DNA At single stranded DNA.
2, affinity chromatography
(1) matrix that was coupled being eluted with coupling buffer: drawing upper solution, coupling buffer is added to mix to 6mL, Centrifugation, discards supernatant liquid, this step is repeated 3 times；
(2) single stranded DNA in step 1 is added in the matrix being coupled, is incubated in 37 DEG C and 40rpm softly rotates 2 Hour；
(3) aforementioned sample is added into chromatographic column, with the ultrapure water pillar of 2-3 column volume；
(4) linear ladder then is carried out with the elution buffer (0.1M NaCl, 0.1M acetate, pH4.0) of 3-4 column volume Degree elution, collects elution fraction；
(5) elution fraction mixes in equal volume with sol solution, is dissolved after recycling with TE solution, obtains Selex solution.
Four, PCR optimization and massive amplification aptamer
Using above-mentioned Selex solution as template, operate as follows:
1,94 DEG C of preheating PCR instruments；
2, by 5 μ L templates, 28.6 μ L deionized waters, 5 μ L10 × Buffer, 3 μ LMgCl2, 4 μ L dNTP mixtures it is (each 2.5 μM), 2 μ L forward direction amplimers, the reversed amplimer of 2 μ L, 0.4 μ LTaq enzyme, reacted in PCR centrifuge tube.It is positive Amplimer sequence is 5 '-GACATATTCAGTCTGACAGC-3 ', and reversed amplimer sequence is 5 '- GCTAGACGATATTCGTCCATC-3’。
3, it is expanded in PCR instrument by following procedure:
(1) initial denaturation
94 DEG C 5 minutes；
(2) 32 circulations:
94 DEG C 45 seconds
58 DEG C 30 seconds
72 DEG C 30 seconds；
(3) it expands afterwards
72 DEG C 7 minutes；
4, PCR product after circulation terminates, is stripped recycling with the DNA product purification kit of TIANGEN company, is walked It is rapid as follows:
(1) PCR product and isometric colloidal sol buffer are mixed by inversion, mixed liquor are then transferred to centrifugal purification column, It is stored at room temperature 5 minutes, makes DNA sufficiently in conjunction with pellosil, 12000rpm is centrifuged 1 minute, outwells the waste liquid in collecting pipe；
(2) rinsing liquid (containing ethyl alcohol) of 700 μ L is added in centrifugal purification column, 12000rpm is centrifuged 1 minute, outwells collection Waste liquid in pipe；
(3) step (2) are repeated；
(4) 12000rpm is centrifuged 3 minutes；
(5) centrifugal purification column is placed in new centrifuge tube；
(6) 30 μ L ultrapure waters are added, stand 5 minutes at room temperature；
(7) 12000rpm is centrifuged 1 minute, and tube bottom solution is the PCR product of the aptamer purified.
Embodiment 2: the clone of aptamer, separation and sequencing and the prediction of single stranded DNA secondary structure
One, the preparation of bacillus coli DH 5 alpha competent cell
1, the single DH5 α bacterium colony of picking is inoculated in 3mL LB culture medium not with ampicillin, 37 DEG C of overnight incubations, Next day takes above-mentioned bacterium solution, and 1:100 is inoculated in 50mL LB liquid medium in proportion, and 37 DEG C vibrate 2 minutes；When OD600 value reaches When to 0.35, bacterial cultures is harvested；
2, bacterial cultures is transferred in the sterile polypropylene tube of 50mL pre-cooling, places 10 minutes on ice, makes to train It is cooling to support object；
3,4000rpm is centrifuged 10 minutes at 4 DEG C, discards culture solution, and pipe is inverted l/min so that remaining culture solution It flows to end；
4, respectively add the 0.1mM CaCl of 150 μ L ice pre-cooling2Solution merges two and manages, and ice bath 10 minutes；
5,4000rpm is centrifuged 10 minutes at 4 DEG C, discards supernatant liquid, and pipe is inverted l/min so that residual liquid stream To the greatest extent；
6, the 0.1M CaCl of 800 μ L ice pre-cooling is first added2Cell is resuspended in solution, adds the sweet of the 75% of 25 μ L pre-cooling Oil, it is spare in -80 DEG C of storages later.
Two, connection and the conversion of connection product
1,0.5 μ LTakarapMD19-T Simple carrier, 4.5 μ L aptamer PCR are added in microcentrifugal tube The ligase buffer mixture of product and 5 μ L；
2, it reacts 3 minutes for 16 DEG C；
3, full dose (10 μ L) is added into 100 μ L DH5 α competent cells, places 30 minutes in ice；
4,42 DEG C after heating 90 seconds, then place 1 minute in ice；
5, the LB culture medium 890 μ L for being added that 37 DEG C of warm bath cross, 37 DEG C slow oscillation culture 60 minutes；
6, take 200 μ L be coated on containing X-Gal, IPTG, ampicillin LB culture medium on, 37 DEG C culture 16 hours with Form single colonie.
Three, the colony screening of aptamer, separation and sequencing and single stranded DNA secondary structure prediction
The single bacterium of the above-mentioned white of picking is fallen in LB culture medium with ampicillin, 37 DEG C slow oscillation culture 4 hours, Carry out PCR amplification；The amplification condition of amplimer and amplification condition with aforementioned aptamer.Positive gram will confirmed through PCR After grand progress plasmid extraction, nucleosides is carried out with the full-automatic nucleotide sequencing instrument of U.S. Applied BioSyStemS3730A The measurement of acid sequence；Structure shows its sequence of aptamer specifically bound with borax from 5 ' ends to 3 ' ends are as follows:
GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGCATGCACGGGAGATGGACG AATATCGTCTAGC
The sequence length of the aptamer Bor-A01 specifically bound with borax: 82 bases, sequence type: nucleic acid, Chain number: single-stranded, topology: straight-chain, sequence type: ssDNA.
It is 26 DEG C, Na that temperature, which is arranged, by MFOLD software+Concentration is 150mM, Mg2+Concentration be 1mM (http: // Mfold.rna.albany.edu/? q=mfold/DNA-Folding-Form) and QGRS mapping (http: // BioinformaticS.ramapo.edu/QGRS/analyze.php) to the aptamer Bor- specifically bound with borax A01 single strand dna carries out secondary structure prediction.The result shows that aptamers contain ring and stem outstanding, Bor-A01 gibbs Free energy DG=-15.21；Structure stability with higher (see Fig. 1).
Embodiment 3: circular dichroism detector (CD) is to K+Concentration is probed into aptamer Bor-A01 structural relation
1, by aptamer ddH2O is diluted to 20 μM, after 95 DEG C of denaturation 30s, is cooled to 25 DEG C rapidly.Again The aptamer after above-mentioned denaturation is diluted to 2.5 μ with the KCl solution of various concentration (0,10,20,40,60,80,100mM) M。
2, aptamer is diluted to 20 μM with 10mM PBS, after 95 DEG C of denaturation 30s, is cooled to 25 rapidly DEG C, then 2.5 μM are diluted to 10mM PBS.
3, temperature setting is 25 DEG C, is detected with circular dichroism spectrometer, wherein the scanning wavelength set is 220-340nm； Scanning speed is 100nm/min；Reaction time is 1s.
The result shows that: in various concentration K+Under environment, the positivity band of the CD map of aptamers Bor-A01 is both present in Near 280nm, negativity band is both present near 245nm, is intersected near 260nm with b axis, complies with standard the CD figure of DNA Spectrum.And the fluctuating range of each curve is unobvious, therefore aptamer Bor-A01 can be stabilized simultaneously in KCl solution And it will not influence its secondary structure (see Fig. 2).
Embodiment 4: borax-BSA conjugate preparation
1,2mg borax is dissolved with 0.2mL dimethylformamide (DMF), A liquid is made.
2,5mg BSA, 3mg EDPC addition 25mL ultrapure water are dissolved, B liquid is made.
3, A liquid is gradually added drop-wise in B liquid, stirring while adding, 1mg EDPC after 10min, in room temperature, the item that pH is 5.5 Continue to stir 18h under part.
4, it with PBS solution dialysis 3d, changes the liquid once daily.After having dialysed, packing freeze-drying is saved.
The result shows that: with borax, BSA characteristic peak compared with, borax-BSA compound in 290nm, 434nm, 471nm, There is different characteristic ultraviolet absorptions at 509nm, 549nm, shows that borax and BSA are coupled successfully (see Fig. 3).
Embodiment 5: specificity, affinity and the sensitivity to borax of aptamer Bor-A01
One, aptamer Bor-A01 specific detection
1, ELONA method
It is improved on the basis of traditional ELISA method, antibody is replaced with the aptamers screened, using life Object element-Avidin amplification system is to detect sample to be tested.
(1) coating of toxin
9.6 carbonate buffer solution of 0.05M pH and borax volume ratio are 1:1 mixing, the final concentration of 1 μ g/mL of borax.Often 100 μ L of hole is added in ELISA Plate, is sealed with adhesive sticker, in being incubated for 2 hours on 37 DEG C, 100rpm oscillator, abandoning after being incubated for The liquid in hole is removed, 200 μ L PBST cleaning solutions are added in every hole, oscillation washing 3 times on Yu Shuiping constant-temperature table, 2 points of washing every time It is patted dry after clock on clean blotting paper.Blank control and negative control (blank control: defatted milk are set up simultaneously；Negative control For non-target substance: rhodamine B, acephatemet, sodium formaldehyde sulfoxylate, boric acid；Positive group: borax.Concentration is consistent, and method is same as above).
(2) it closes
In the ELISA Plate for being coated with borax toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, it Afterwards, in being incubated for 2 hours on 37 DEG C, 100rpm oscillator, after closing, liquid in hole is discarded, repeats the purge step in (1) Suddenly.
(3) plus the aptamer with biotin labeling is incubated for
It screens the aptamer Bor-A01 for obtaining to combine with borax toxin and is sent to the conjunction of Shanghai Sheng Gong biotech firm At, and Bor-A01 is marked with biotin (Biotin).In use, first carrying out of short duration centrifugation, make the nucleic acid of labeled biotin Aptamers are all gathered in test tube bottom.It is with aqua sterilisa that the aptamer of labeled biotin is sufficiently molten according to explanation Solution is 10 at concentration-4The storing solution of M can be packed as aliquot in order to avoid freeze thawing repeatedly.
The aptamer Bor-A01 of labeled biotin is diluted to the working concentration of 100nM with 1 × PBS, then, Accordingly 100 μ L are added in each hole, after adhesive sticker or sealed membrane sealing, in being incubated for 2 hours on 37 DEG C, 100rpm oscillator, After incubation, liquid in hole is discarded, repeats the washing step in (1).
(4) enzyme conjugate is incubated for
The horseradish peroxidase conjugate that 100 μ L indicate Streptavidin is added in each hole, it is then, close with adhesive sticker Envelope in being incubated for 1 hour on 37 DEG C, 100rpm oscillator, after incubation, discards liquid in hole, repeats the washing in (1) later Step.
(5) it develops the color
100 μ L of color developing agent TMB solution is added in every hole, is protected from light colour developing 20 minutes at 37 DEG C later.
(6) it terminates
Finally, the terminate liquid (2M sulfuric acid) of 50 μ L is added into every hole, and to make within 10 minutes of reaction terminating Absorbance value of each hole at 450nm is detected with microplate reader, obtains OD 450nm.
The results show that aptamers Bor-A01 can and borax specificity combination (see Fig. 4).
Two, the affinity K of aptamer Bor-A01dValue calculates:
1,9.6 carbonate buffer solution of 0.05M pH and borax volume ratio are 1:1 mixing, the final concentration of 1 μ g/mL of borax. Every 100 μ L of hole is added in ELISA Plate, is sealed with adhesive sticker, in being incubated for 2 hours on 37 DEG C, 150rpm oscillator, after being incubated for Discard liquid in hole, every hole adds 200 μ L of cleaning solution, on horizontal shaker oscillation washing 3 times, 2 minutes every time, similarly every time It is to pat dry on net blotting paper；
2, in the ELISA Plate for being coated with borax toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, Later, in being incubated for 2 hours on 37 DEG C, 100rpm oscillator, after closing, liquid in hole is discarded, repeats the purge step in 1 Suddenly；
3, by the aptamers of biotin labeling with 1 × PBS be diluted to 1nM, 5nM, 10nM, 20nM, 50nM, 80nM, 100nM, 150nM, 300nM, 500nM, each hole adds 100 μ L, is sealed with adhesive sticker or sealed membrane, vibrates in 37 DEG C, 100rpm It is incubated for 2 hours on device, liquid in hole is discarded after being incubated for, repeat the washing step in 1；
3,100 μ L horseradish peroxidase conjugates are added in every hole, are sealed with adhesive sticker, are vibrated in 37 DEG C, 150rpm It is incubated for 1 hour on device, discards liquid in hole, repeat the washing step in 1；
4,100 μ L of TMB color developing agent is added in every hole, and colour developing 20 minutes is protected from light in 37 DEG C；
5, add 50 μ L terminate liquids (2M sulfuric acid), and surveyed at each hole 450nm and inhaled with microplate reader within reaction terminating 10 minutes Shading value OD 450nm；
The result shows that the K of aptamer Bor-A01d=22.08 ± 2.730nM (see Fig. 5).
Four, detection of the aptamer Bor-A01 to borax sensitivity
1,9.6 carbonate buffer solution of 0.05M pH and borax volume ratio are 1:1 mixing, make the final concentration of 1ng/ of borax ML, 5ng/mL, 10ng/mL, 20ng/mL, 40ng/mL, 60ng/mL, 80ng/mL, 100ng/mL.Every 100 μ L of hole is added to enzyme It in target, is sealed with adhesive sticker, in being incubated for 2 hours on 37 DEG C, 150rpm oscillator, liquid in hole, every hole is discarded after being incubated for Add 200 μ L of cleaning solution, in oscillation washing 3 times on horizontal shaker, 2 minutes every time, to be similarly net blotting paper every time On pat dry；
2, in the ELISA Plate for being coated with borax toxin, 5% defatted milk of 100 μ L is added in each hole, is sealed with adhesive sticker, Later, in being incubated for 2 hours on 37 DEG C, 100rpm oscillator, after closing, liquid in hole is discarded, repeats the purge step in 1 Suddenly；
3, the aptamers of biotin labeling are diluted to 100nM with 1 × PBS, each hole adds 100 μ L, with adhesive sticker or envelope Membrana oralis sealing discards liquid in hole in being incubated for 2 hours on 37 DEG C, 100rpm oscillator after being incubated for, repeat the purge step in 1 Suddenly；
4,100 μ L horseradish peroxidase conjugates are added in every hole, are sealed with adhesive sticker, are vibrated in 37 DEG C, 150rpm It is incubated for 1 hour on device, discards liquid in hole, repeat the washing step in 1；
5,100 μ L of TMB color developing agent is added in every hole, and colour developing 20 minutes is protected from light in 37 DEG C；
6, add 50 μ L terminate liquids (2M sulfuric acid), and surveyed at each hole 450nm and inhaled with microplate reader within reaction terminating 10 minutes Shading value OD 450nm；
The result shows that aptamer Bor-A01 detects that the minimum concentration of borax is not 20ng/mL (see Fig. 6).
Embodiment 6: the truncation experimental analysis of aptamer Bor-A01
In order to reduce the cost of nucleic acid aptamers, to aptamer Bor-A01 be based on its secondary structural features into Row truncates experiment and gropes.Sequence after aptamer truncates see the table below, and secondary structure is as shown in Figure 7.Six are truncated respectively Aptamer segment and full length fragment afterwards carries out ELONA method and is verified, remaining operation is same as above.
The result shows that: the segment after truncation cannot identify target molecule, and therefore, aptamer Bor-A01 shows that it is complete Three-dimensional structure be capable of the identification target molecule (Fig. 8) of high-affinity
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>Kunming University of Science and Technology
<120>a kind of aptamer with borax specific binding
<130> 2018
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 82
<212> DNA
<213>artificial synthesized (artificial)
<400> 1
gacatattca gtctgacagc ggaagcgggt cagtccaact cacggtctcg catgcacggg 60
agatggacga atatcgtcta gc 82

Claims (7)

1. a kind of aptamer with borax specific binding, which is characterized in that the nucleic acid with borax specific binding Aptamers nucleotide sequence is as shown in SEQ ID NO:1；The aptamer is single stranded DNA, is made of 82 nucleotide, topology Structure is straight-chain.
2. the aptamer specifically bound as described in claim 1 with borax, which is characterized in that the secondary structure of prediction With ring outstanding and stem, Gibbs free energy DG=-15.21.
3. a kind of screening technique with the aptamer of borax specific binding as described in claim 1, which is characterized in that The screening technique with the aptamer of borax specific binding is gone out using SELEX technology screening can be with borax specificity In conjunction with aptamer group, design primer carries out PCR amplification, clone, separation and sequencing；It is adsorbed using enzyme-linked oligonucleotides It is verified, obtains aptamers Bor-A01.
4. the screening technique of the aptamer specifically bound as claimed in claim 3 with borax, which is characterized in that adaptation The adapter-primer sequence of body are as follows: Aptamer Fw:GACATATTCAGTCTGACAGC；Reverse complementary sequence: CGCTGTCAGACTGAATATGTC；Aptamer Rv:GCTAGACGATATTCGTCCATC, reverse complementary sequence: GATGGACGAATATCGTCTAGC；Obtained positive monoclonal carries out nucleotide sequencing, and sequencing result shows special with borax Property the aptamer that combines be made of 82 nucleotide, 5 ' ends are to 3 ' terminal sequences are as follows:
GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGCATGCACGGGAGATGGACGAAT ATCGTCTAGC。
5. the screening technique of the aptamer specifically bound as claimed in claim 3 with borax, which is characterized in that obtain It also needs to carry out aptamer single stranded DNA secondary structure characterization after aptamers Bor-A01,
Secondary structure is carried out using the aptamer Bor-A01 single strand dna that MFOLD software pair is specifically bound with borax Prediction；Secondary structure has ring outstanding and stem, Gibbs free energy DG=-15.21.
6. the screening technique of the aptamer specifically bound as claimed in claim 3 with borax, which is characterized in that borax The preparation of coating antigen includes:
The coating antigen that borax molecule and BSA coupling are obtained to borax by chemical method, for subsequent enzyme-linked oligonucleotides absorption In measuring method；The preparation situation of coating antigen is judged by ultra-violet absorption spectrum.
7. a kind of be loaded with identifying borax or making for the aptamer specifically bound as described in claim 1 with borax The kit of standby detection borax.
CN201910371568.7A 2019-05-06 2019-05-06 A kind of aptamer with borax specific binding Pending CN110066804A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910371568.7A CN110066804A (en) 2019-05-06 2019-05-06 A kind of aptamer with borax specific binding

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910371568.7A CN110066804A (en) 2019-05-06 2019-05-06 A kind of aptamer with borax specific binding

Publications (1)

Publication Number Publication Date
CN110066804A true CN110066804A (en) 2019-07-30

Family

ID=67370221

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910371568.7A Pending CN110066804A (en) 2019-05-06 2019-05-06 A kind of aptamer with borax specific binding

Country Status (1)

Country Link
CN (1) CN110066804A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110885827A (en) * 2019-11-26 2020-03-17 昆明理工大学 Aptamer specifically bound with vomitoxin, preparation method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107505463A (en) * 2017-07-17 2017-12-22 昆明理工大学 With the aptamer Sf B09 of sodium formaldehyde sulfoxylate specific bond and its application
CN108251429A (en) * 2018-03-05 2018-07-06 昆明理工大学 A kind of aptamer Met-G02 and its application with acephatemet specific binding

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107505463A (en) * 2017-07-17 2017-12-22 昆明理工大学 With the aptamer Sf B09 of sodium formaldehyde sulfoxylate specific bond and its application
CN108251429A (en) * 2018-03-05 2018-07-06 昆明理工大学 A kind of aptamer Met-G02 and its application with acephatemet specific binding

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LE JING等: "A novel borax-specific ssDNA aptamer screened by high-throughput SELEX and its colorimetric assay with aggregation of AuNPs", 《JOURNAL OF FOOD COMPOSITION AND ANALYSIS》 *
靖 乐: "硼砂相应核酸适配体的筛选及其可视化检测法的研究", 《中国优秀硕士学位论文全文数据库工程科技I辑》 *
魏强等: "动力学毛细管电泳法求解蛋白质与单链脱氧核糖核苷酸结合的解离常数及可靠性分析", 《色谱》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110885827A (en) * 2019-11-26 2020-03-17 昆明理工大学 Aptamer specifically bound with vomitoxin, preparation method and application
CN110885827B (en) * 2019-11-26 2022-07-01 昆明理工大学 Aptamer specifically bound with vomitoxin, preparation method and application

Similar Documents

Publication Publication Date Title
Kaur et al. Aptamers in the therapeutics and diagnostics pipelines
JP2674957B2 (en) Electrochemiluminescence assay
Vivekananda et al. Anti-Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by Aptamer-Linked Immobilized Sorbent Assay
Goldman et al. Selection of phage displayed peptides for the detection of 2, 4, 6-trinitrotoluene in seawater
Disney et al. Aminoglycoside microarrays to explore interactions of antibiotics with RNAs and proteins
CN103513027B (en) Establishment of novel ultrasensitiveness ELISA method
CN104198721A (en) Preparation and application of Golgi protein 73 (GP73) antigen silicon-based magnetic bead conjugate
CN107505463B (en) With the aptamer Sf-B09 of sodium formaldehyde sulfoxylate specific bond and its application
CN107462714B (en) With the aptamer Sf-A09 of sodium formaldehyde sulfoxylate specific bond and its application
CN110066804A (en) A kind of aptamer with borax specific binding
CN105039346B (en) A kind of aptamer and application with melamine specific bond
CN110423754A (en) Aptamer and utilization SELEX screening technique and application with borax specific binding
CN104233474A (en) Synthetic phage display nano antibody library and application thereof
CN104862314B (en) A kind of and the aptamer of α amanita hemolysin specific bonds and application
Yuan et al. Development of single chain variable fragment (scFv) antibodies against Xylella fastidiosa subsp. pauca by phage display
CN102791883A (en) Method for screening nucleic acid ligand
CN108251429A (en) A kind of aptamer Met-G02 and its application with acephatemet specific binding
JP2017529062A5 (en)
WO2011014989A1 (en) Oligonucleotide aptamers targeting at mycobacterium tuberculosis ag85b, preparing method and uses thereof
Huang et al. High-resolution mapping of human norovirus antigens via genomic phage display library selections and deep sequencing
Hirose et al. Strong and Specific Recognition of CAG/CTG Repeat DNA (5’‐dWGCWGCW‐3’) by a Cyclic Pyrrole‐Imidazole Polyamide
CN108486119B (en) Aptamer RhB-F02 specifically bound with rhodamine B and application thereof
CN105177009B (en) A kind of aptamer and application with α-amanita hemolysin specific bond
CN105177011B (en) A kind of aptamer and application with clenbuterol hydrochloride specific bond
CN104878015B (en) A kind of bacterial endotoxin aptamer and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination