CN110029181A - A kind of the condition assessment system and its kit of systemic loupus erythematosus - Google Patents

A kind of the condition assessment system and its kit of systemic loupus erythematosus Download PDF

Info

Publication number
CN110029181A
CN110029181A CN201910317741.5A CN201910317741A CN110029181A CN 110029181 A CN110029181 A CN 110029181A CN 201910317741 A CN201910317741 A CN 201910317741A CN 110029181 A CN110029181 A CN 110029181A
Authority
CN
China
Prior art keywords
library
pcr
dna
sequence
added
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910317741.5A
Other languages
Chinese (zh)
Inventor
古洁若
林智明
桂连
左晓宇
冯俊梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Affiliated Hospital Sun Yat Sen University
Original Assignee
Third Affiliated Hospital Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Third Affiliated Hospital Sun Yat Sen University filed Critical Third Affiliated Hospital Sun Yat Sen University
Priority to CN201910317741.5A priority Critical patent/CN110029181A/en
Publication of CN110029181A publication Critical patent/CN110029181A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Abstract

A kind of the condition assessment system and kit of systemic loupus erythematosus, belong to technical field of biomedical detection.The present invention provides a kind of assessment system for the condition assessment of the systemic loupus erythematosus of realization more convenient and quicker, the assessment system is enteron aisle Proteobacteria/Bacteroidetes (Proteobacteria/Bacteroidetes by calculating patient, P/B ratio), with the healthy population reference value (medical reference range=0.13-0.63 formulated based on early-stage study result,) compare, when its value is higher than healthy population, the assessment of SLE disease can be effectively assisted；The value increases with the increase that SLE disease activity index (SLE disease activity index, SLEDAI) scores, and effective assessment of SLE Disease Activity is carried out according to the change of the ratio.In addition, additionally providing a kind of corresponding kit.

Description

A kind of the condition assessment system and its kit of systemic loupus erythematosus
Technical field
The present application relates to one kind by detection enteron aisle Proteobacteria/Bacteroidetes (Proteobacteria/ Bacteroidetes, P/B) ratio carry out systemic loupus erythematosus condition assessment method and dedicated kit, belong to biology Technical field of medical detection.
Background technique
Systemic loupus erythematosus (systemic lupus erythematosus, SLE) is a kind of chronic auto-immune Disease, global illness rate be 0.02%-0.24%, clinical symptoms multiplicity, be mainly shown as erythema, photosensitization, arthritis, The hematoligical symptoms such as the neurological symptoms such as glomerulonephritis, pericarditis, epilepsy and anaemia, decrease of platelet.Previous grinds Study carefully and shows that the interaction of the age relateds such as science of heredity, epigenetics, hormone factor and environmental factor causes immune system It is abnormal, lead to patient Yi Fa SLE.
A large amount of microorganism is colonized in normal human's enteron aisle, wherein enteric bacteria accounts for the 90% of enteric microorganism sum, Its type is more than 1000 kinds, and intestinal flora total number of cells mesh is up to 100,000,000,000,000, is 10 times of human body cell number, these intestines Road flora gene number is 100 times of human gene number, is referred to as macro genome.Therefore intestinal flora is considered as the " hidden of human body The organ of hiding " carries second set of genome of the mankind.Under physiological status, intestinal flora is not only involved in defense against bacterial, virus etc. The building of the intestinal mucosal barrier of pathogen invasion, also the participation a variety of physiological metabolism processes of human body.A large number of studies show that when enteron aisle is micro- After balance between biology and body is broken, flora can change intestinal permeability, and influence short by influencing energy absorption The approach such as the metabolism of chain fatty acid, choline, bile acid and butyrate, and influence break immune stable state of the utilization to immunocyte Influence the health of host.
Research thinks intestinal flora as important environmental factor at present, is not only to cause rheumatoid arthritis, backbone The Important cause of disease of the diseases such as arthritis and type 1 diabetes, it is also closely related with the generation of systemic loupus erythematosus.But systemic red The relevant study on intestinal flora of the yabbi sore deficiency small there are sample size, the persuasion of this research evidence limited to a certain extent Power, and research object is concentrated and is in single disease activity or inactive stages, resulting pathogenic flora is also different.Therefore, We are included in the research case in the various disease stage, by advanced 16S it is necessary to the sample size of further expansion research RRNA gene high throughput sequencing technologies analyze the intestinal flora of healthy population and SLE patient, find SLE disease with this Correlation pathogenic bacteria.
SLE is relatively conventional chronic auto-immune disease, protracted course, and with disease progression can jeopardize kidney and Brain seriously threatens the life of patient, therefore should strive for that the variation of early detection conditions of patients carries out early intervention.However, by mesh Before, it is usually mainly anti-using clinical symptoms and serological laboratory itself for the change of illness state of systemic loupus erythematosus The auxiliary examination of the detections such as body is judged, the kit of specific aided disease condition assessment is lacked, therefore, it is desirable to Specificity SLE detection kit is invented for the SLE disease correlation intestinal flora of early-stage study discovery, to assist the SLE state of an illness living The judgement of dynamic degree.
Summary of the invention
The present patent application is to lack specific aided disease condition assessment method and specificity examination for the current SLE that lacks Agent box, provide it is a kind of cause a disease relevant intestinal flora detection kit for SLE, commented with the SLE Disease Activity for carrying out special Estimate.
The application after extensive and in-depth study, is sequenced by 16S rRNA gene amplicon to healthy population and SLE Patient carries out the analysis of intestinal microflora and abundance, as a result finds the P/B ratio [median (quartile of SLE patient for the first time Spacing)=0.44 (0.28-0.66)] it is significantly higher than healthy control group [median (quartile spacing)=0.28 (0.2- 0.36)], P=3.44 × 10-14；And it is expressed and disease activity index (Systemic lupus erythematosus Disease activity index, SLEDAI) being positively correlated property (r=0.177, P=0.034), i.e., the ratio of P/B be The morbidity of system property lupus erythematosus is closely related, and increases with the increase of Disease activity, and therefore, P/B ratio can be used as The important indicator of the important state of an illness mobility assessment of systemic loupus erythematosus, completes the present invention based on this.
The first purpose of the present patent application is to provide a kind of systemic loupus erythematosus and causes a disease relevant enteron aisle Proteobacteria/quasi- The ratio of bacillus door (Proteobacteria/Bacteroidetes, P/B), the P/B of the Patients with SLE Ratio is higher than healthy population, and the bigger disease of ratio is more movable.
The second purpose of the present patent application is to provide a kind of appraisal procedure of the Disease Activity of systemic loupus erythematosus, institute The appraisal procedure stated be calculate patient P/B ratio, and with the (research based on 134 healthy persons early period of healthy population reference value As a result medical reference range=0.13-0.63 is made using method of percentiles) it is compared, when its value is higher than healthy population When, since the ratio increases with the increase that SLEDAI scores, it is living that the state of an illness can be carried out according to the change of the ratio Effective assessment of dynamic property.
Further, the sample for detecting enteron aisle Proteobacteria and Bacteroidetes is excrement.
Further, the appraisal procedure comprises the following steps that
1) genomic DNA in sample to be tested excrement is extracted；
2) amplification label is carried out to it by PCR method using 16S rRNA gene V3-V4 area's specific primer and Miseq is surveyed The sequencing of sequence instrument；
3) sequencing gained sequencing sequence (reads) is sorted out, sequence is divided into OTU by threshold value of 97% similarity, OTU is represented sequence again to compare with corresponding microbiological data library, obtains Proteobacteria and Bacteroidetes microbial species and table Up to abundance messages, gene expression abundance carries out subduplicate conversion；
4) P/B ratio is calculated；
5) by calculated P/B ratio and healthy population reference value, (result of study based on 134 healthy persons early period is used Method of percentiles makes medical reference range=0.13-0.63) it is compared.
The third purpose of the present patent application is to provide a kind of systemic loupus erythematosus and causes a disease the detection side of relevant P/B ratio Method, the detection method include the following steps:
Sample builds library sequencing
After extracting genomic DNA in fecal sample, the loading final concentration of all DNA is standardized as 5ng/ul (Nuclease-free water dilution), volume is at least 2.5ul, i.e. gross mass is 12.5ng.
(1) PCR amplification
Reaction system are as follows:
2.5 μ l of microbe genome DNA (5ng/ul)；
5 μ l of amplicon PCR forward primer (1uM)；
5 μ l of amplicon PCR reverse primer (1uM)；
2 × KAPA Hifi hotstar readymix 12.5 μ l, 25 μ l of total system.
Response procedures are as follows:
95℃3min；
95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, totally 25 recycle；
72 DEG C of 5min, 4 DEG C of-∞.
The full-automatic nucleic acid-protein analysis system detection pcr amplification product about 550bp of Qsep100 is qualification, is carried out next Step operation.
(2) PCR is purified
1. room temperature is centrifuged amplicon PCR plate 1000g, 1min, sealing film is torn off；
2. be vortexed concussion AMPure XP magnetic bead 30s, magnetic bead is mixed, is expanded and is produced in above-mentioned PCR using Multi-channel liquid transfer device 20ul AMPure XP magnetic bead is added in every hole in object, replaces pipette tips in time after sample-adding；
3. softly being mixed 10 times up and down with pipettor, it is stored at room temperature and is incubated for 5min；
2min is stood 4. being put on magnetic frame；
PCR plate is placed in magnetic frame, is performed the following operation:
5. discarding supernatant using Multi-channel liquid transfer device, pipette tips are replaced；
6. 80% ethyl alcohol that the fresh configuration of 200ul is added in every hole is cleaned；
7. standing 30s, supernatant is siphoned away to greatest extent；
8. repeated washing is primary, supernatant is siphoned away to greatest extent；
9. being placed at room temperature for, 10min is air-dried；
10. removing amplicon PCR plate from magnetic frame, 52.5ul Nuclease-free water is added；
11. 10 times are blown and beaten about and is sufficiently mixed magnetic bead, are incubated at room temperature 2min；
12. amplicon PCR plate is put back to and stands 2min on magnetic frame, draws 50ul supernatant and 1 piece of 96 new hole PCR is added In plate, notice that replacing pipette tips in time avoids cross contamination.
(3)Index PCR
Reaction system are as follows:
DNA 5μl；
1 primer (N7XX) of Nextera XT Index, 5 μ l；
2 primer (S5XX) of Nextera XT Index, 5 μ l；
2×KAPA Hifi hotstar readymix 25μl；
10 μ l total system of Nuclease-free water, 50 μ l.
Index 1(i7) Primer sequence 5 ' -3 ' Index 2(i5) Primer sequence 5 ' -3 '
N701 TAAGGCGA S501 TAGATCGC
N702 CGTACTAG S502 CTCTCTAT
N703 AGGCAGAA S503 TATCCTCT
N704 TCCTGAGC S504 AGAGTAGA
N705 GGACTCCT S505 GTAAGGAG
N706 TAGGCATG S506 ACTGCATA
N707 CTCTCTAC S507 AAGGAGTA
N708 CAGAGAGG S508 CTAAGCCT
N709 GCTACGCT
N710 CGAGGCTG
N711 AAGAGGCA
N712 GTAGAGGA
Response procedures are as follows:
95℃3min；
95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, totally 25 recycle；
72 DEG C of 5min, 4 DEG C of-∞.
(4) PCR is purified
1. being centrifuged above-mentioned index PCR plate 280g, 1min at room temperature, sealing film is torn off；
2. be vortexed concussion AMPure XP magnetic bead 30s mix magnetic bead, using the volley of rifle fire in the PCR product of above-mentioned label every hole 56ul AMPure XP magnetic bead is added, pays attention to replacing pipette tips in time；
3. being mixed 10 times up and down with pipettor, it is stored at room temperature 5min；
2min is stood 4. being placed on magnetic frame；
5. being discarded supernatant using the volley of rifle fire；
6. 80% ethyl alcohol that the fresh configuration of 200ul is added in every hole is cleaned；
7. standing 30s, supernatant is siphoned away to greatest extent；
8. repeated washing 1 time, siphoning away supernatant；
9. being placed at room temperature for 10min, air-dry；
10. taking out index PCR plate from magnetic frame, 27.5ul Nuclease-free water is added；
11. 10 times are blown and beaten about and is sufficiently mixed magnetic bead, are incubated at room temperature 2min；
12. relaying index PCR plate on magnetic frame, draws 25ul supernatant and 1 piece of 96 new hole PCR plate is added In, notice that replacing pipette tips in time avoids cross contamination.
13. after magnetic beads for purifying, the full-automatic nucleic acid-protein analysis system detection library size about 630bp of Qsep100 is to close Lattice can carry out next step operation.
(5) the quantitative of library, standardization and pond (pooling)
Calculate the concentration in library, DNA concentration (nM)=DNA library concentration (ng/ μ l)/[(660g/mol × average library Size] × 106。
Based on above-mentioned library concentration, it is diluted to 4nM, then each library respectively takes 5ul to carry out pond.
(6) library denaturation and Miseq sample loading
1) DNA denaturation and dilution
1. the 5 μ l of 0.2N NaOH of 5 μ l of 4nM pooled library and fresh configuration are added in microcentrifugal tube.
2. adequately mixing, room temperature is centrifuged 280g, 1min；
3. being incubated at room temperature 5min；
4. the hybridization buffer HT1 preparation 20pM denaturation library of 990 μ l pre-cooling is added；
5. taking above-mentioned 120ul 20pM denaturation library, the hybridization buffer HT1 preparation 4pM loading that 480ul pre-cooling is added becomes Property library, be sufficiently mixed, be placed in stand-by on ice.
2) denaturation and dilution of the library PhiX reference substance
4nM PhiX library is made in the 10mM Tris-HCl, pH 8.5 for taking 2 μ l of the library 10nM PhiX that 3 μ l are added, Remaining step is denaturalized and dilutes with above-mentioned DNA.
3) mixing of sublibrary and the library PhiX reference substance is expanded
1. above-mentioned 30 μ l of the diluted library PhiX reference substance and amplification 570 μ l of sublibrary is taken to be mixed, it is then placed on ice On until next step operate；
2. being placed on 96 DEG C of heating 2min on heated at constant temperature instrument；
3. carrying out ice bath 5min immediately after mixing 1-2 times after being incubated for, it is sequenced to upper machine.
4) it is sequenced
Using MiSeq sequenator carry out be sequenced and by MiSeq reporting software (MiSeq Reporter software, MSR) MiSeq sequencing initial data is analyzed.
Data analysis
1) sequencing sequence statistics, Quality Control and assembling
Initial data saves as fastq format.Connector, low quality sequence are removed using software, comparison data library is gone to decontaminate Sequence is contaminated, optimization is assembled；
2) these sequencing sequences reads is sorted out, sequence is divided into OTU for OTU generation by threshold value of 97% similarity Table sequence compares (Greengenes database (http://greengenes.lbl.gov/) with corresponding microbiological data library Deng), proteus and Bacteroidetes microbial species and gene expression abundance information are obtained, gene expression abundance carries out subduplicate conversion；
3) the relevant enteron aisle P/B ratio of computing system Erythematosus Disease, when if more than 0.13-0.63, P/B ratio The more big then state of an illness is more movable.
The fourth purpose of the present patent application is to provide a kind of kit for systemic loupus erythematosus condition assessment, described Kit in include:
1) the forward and reverse primer freeze-dried powder of specificity in the PCR method amplification area bacterial 16 S rRNA gene V3-V4,
Forward primer sequence 5 ' -3 ':
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGAGGCTGCAG,
Reverse primer sequences 5 ' -3 ':
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACACGGGTATCTAATCC；
2) 2 × KAPA HiFi HotStart ReadyMix (high-fidelity thermal starting archaeal dna polymerase premixed liquid)；
3) AMPure XP magnetic bead；
4) 1 primer of Nextera XT Index (N7XX), 2 primer (S5XX) of Nextera XT Index
5) HT1 (hybridization buffer)；
6) library PhiX reference substance；
7)10mM Tris-HCl,pH 8.5
8)Illumina MiSeq Reagent Cartridge；
9) Illumina MiSeq PR2 (combination buffer)；
10) Illumina MiSeq Flow Cell (miseq flowing groove)；
11) nuclease-free water (nuclease-free water)；
12) sealing plate pad pasting；
13) hole 96- 0.2ml PCR plate.
The fifth purpose of the present patent application be to provide systemic loupus erythematosus cause a disease relevant enteron aisle P/B ratio in system Application in property lupus erythematosus zhiliao.
The present invention provides a kind of drug, the drug for adjust internal Proteobacteria and The quantity of Bacteroidetes.
Specifically, mainly by reducing application of the P/B ratio in development system lupus erythematosus zhiliao drug, packet It includes the death of induced distortion bacterium or inhibits mycetozoan growth, or inhibit the death of bacteroid and promote to accesses such as bacteroid growths Intervention, be prepared into therapeutic agent.
The beneficial effects of the present invention are provide a kind of more convenient accurate systemic loupus erythematosus condition assessment side Formula.
Specific embodiment
Below in conjunction with specific embodiment, has described in the present patent application and the systemic loupus erythematosus state of an illness is assisted to comment The detection method and its kit of the P/B ratio of assessment values are described, in order to which the public better understands Shen of the present invention Technology contents that please be described, rather than the limitation to the technology contents, in fact, with identical or approximate principle, to institute Any improvement that method and step, reagent, reaction condition have made the kit is stated, to realize that essentially identical effect is Purpose, then all within the present patent application technical solution claimed.
Embodiment 1
P/B and the first-degree of systemic loupus erythematosus are studied
1. research object
50 SLE cases and 92 normal healthy controls in research mostly come from The Third Affiliated Hospital of Zhongshan University's door Examine SLE patient that is medical or being hospitalized, these SLE patients be by veteran rheumatology brainstrust according to clinical manifestation and The SLE patient of the SLE diagnostic criteria for meeting the formulation of American Rheumatism Association in 1997 of laboratory examination results diagnosis.For every Position SLE patient agrees to contribute its excrement for this research after the research purpose being apprised of, and signs informed consent Book.The SLE patient for merging pregnancy, autoimmune disease, rheumatic disease and tumour is excluded.92 normal healthy controls crowds are Antibiotic or immunomodulator treatment, no pregnancy, tumour, infection or any autoimmune or rheumatic disease symptom is not used Or the healthy volunteer of medical history, these healthy volunteers agree to that contributing its excrement uses equally after being apprised of this research purpose In the research, and sign informed consent form.
When collecting stool sample, rheumatism expert carefully inquires and records each SLE patient and normal healthy controls crowd It (includes: gender, age, age of onset, the course of disease and antibiotic and immune that basic condition is recorded when situation, especially SLE patient The medicining condition of regulator) and collect clinical data include SLEDAI scoring, anti-dsDNA, C3, C4 and Cr.Take donor new Everyone 10-50g of fresh excrement, is put in sterile chamber with cover, takes back laboratory and saves in 4 DEG C of refrigerators, it is ensured that mentions in 4 hours Take DNA or be immediately placed on -80 DEG C save after later extract.And for normal healthy controls crowd, then carefully inquire medical history, including Respiratory system, cardiovascular system, endocrine system, hematological system, digestive system, skeletal musculature, nervous system etc. are each The case where training and medicining condition, emphasis exclude pregnancy and the medical histories such as autoimmune disease, rheumatic disease, tumour and The medication history of antibiotic and immunological regulation class drug.
2. experimental method and result
The extraction of 2.1DNA
In this study, we use QIAamp DNA stool Kit excrement genome DNA extracting reagent kit, from Extract DNA in the fecal sample of people, the composition of the kit is: QIAamp centrifugal column, collecting pipe, InhibitEXTM tablet, ASL lysate, AL liquid, AW1 washing lotion, AW2 washing lotion, AE eluent, Proteinase K.
2.2 research step
We carry out the enterobacteriaceae of excrement by 16S rRNA amplicon sequencing technologies to SLE case and normal healthy controls crowd The Research on differences of group structure and abundance searches significant difference flora.In order to further go deep into found flora and disease Relationship research, correlation analysis is carried out to the relationships of the clinical indices such as the flora and SLEDAI.Pass through above step, confirmation The pathogenic relevant flora of SLE, so that the assessment for disease activity provides help.
2.2.1 the library of building of sample is sequenced
After extracting genomic DNA in fecal sample, the loading final concentration of all DNA is standardized as 5ng/ul, Volume is at least 2.5ul, i.e. gross mass is 12.5ng.The 16S metagenomic that we recommend according to Illumina Sequencing library preparation Operating Guideline handbook carries out the preparation before Jian Ku and upper machine.It is reported using MiSeq Software (MiSeq Reporter software, MSR) is accused to analyze MiSeq sequencing initial data.
2.2.2 data are analyzed
1. sequencing sequence statistics, Quality Control and assembling:
Initial data saves as fastq format.Connector, low quality sequence are removed using software, comparison data library is gone to decontaminate Sequence is contaminated, optimization is assembled；
2. sorting out to these reads, sequence is divided into OTU by threshold value of 97% similarity, OTU is represented into sequence (Greengenes database (http://greengenes.lbl.gov/) etc.) is compared with corresponding microbiological data library, is obtained The microbial species and gene expression abundance information that OTU is represented are obtained, after gene expression abundance value carries out square root conversion, using mean ± standard Difference or median (quartile spacing) indicate；
3. detecting using Kruskal-Wallis rank sum test in multiple groups sample and obtaining abundance difference between different grouping Significant species go deep into it with clinical indices progress Spearman correlation analysis such as SLEDAI and face if discrepant flora The research of bed meaning.
2.3 result
The intestinal flora of 50 systemic loupus erythematosuses and 92 normal healthy controls crowds bacterium door level existence difference (P < 0.05), and the P/B ratio 0.35 (0.27-0.56) of patient is higher than healthy control group 0.27 (0.2-0.35), and difference has aobvious Statistical difference (P=1.50 × 10 of work-8), prompt the morbidity of P/B ratio and systemic loupus erythematosus closely related；With The increase of SLEDAI scoring is in increase (R=0.281, P=0.048).Thus, working as the P/B of Patients with SLE When ratio is higher than normal person, the ratio is bigger, then the state of an illness of patient is more movable, helps to assist commenting for disease condition mobility Estimate.
Embodiment 2
P/B and the first-degree of systemic loupus erythematosus are studied
1. research object
94 SLE cases and 42 normal healthy controls in research mostly come from The Third Affiliated Hospital of Zhongshan University's door Examine SLE patient that is medical or being hospitalized, these SLE patients be by veteran rheumatology brainstrust according to clinical manifestation and The SLE patient of the SLE diagnostic criteria for meeting the formulation of American Rheumatism Association in 1997 of laboratory examination results diagnosis.For every Position SLE patient agrees to contribute its excrement for this research after the research purpose being apprised of, and signs informed consent Book.The SLE patient for merging pregnancy, autoimmune disease, rheumatic disease and tumour is excluded.42 normal healthy controls crowds are Antibiotic or immunomodulator treatment, no pregnancy, tumour, infection or any autoimmune or rheumatic disease symptom is not used Or the healthy volunteer of medical history, these healthy volunteers agree to that contributing its excrement uses equally after being apprised of this research purpose In the research, and sign informed consent form.
When collecting stool sample, rheumatism expert carefully inquires and records each SLE patient and normal healthy controls crowd It (includes: gender, age, age of onset, the course of disease and antibiotic and immune that basic condition is recorded when situation, especially SLE patient The medicining condition of regulator) and collect clinical data include SLEDAI, anti-dsDNA, C3, C4 and Cr.Take donor fresh Everyone 10-50g of excrement, is put in sterile chamber with cover, takes back laboratory and saves in 4 DEG C of refrigerators, it is ensured that extracts in 4 hours DNA or be immediately placed on -80 DEG C save after later extract.And for normal healthy controls crowd, then carefully inquire medical history, including exhale Desorption system, cardiovascular system, endocrine system, hematological system, digestive system, skeletal musculature, nervous system etc. are each specially The case where section and medicining condition, emphasis exclude the medical histories such as pregnancy and autoimmune disease, rheumatic disease, tumour and resist The medication history of raw element and immunological regulation class drug.
2. experimental method and result
The extraction of 2.1DNA
In this study, we use QIAamp DNA stool Kit excrement genome DNA extracting reagent kit, from Extract DNA in the fecal sample of people, the composition of the kit is: QIAamp centrifugal column, collecting pipe, InhibitEXTM tablet, ASL lysate, AL liquid, AW1 washing lotion, AW2 washing lotion, AE eluent, Proteinase K.
2.2 research step
We carry out the enterobacteriaceae of excrement by 16S rRNA amplicon sequencing technologies to SLE case and normal healthy controls crowd The Research on differences of group structure and abundance searches significant difference flora.In order to further go deep into found flora and disease Relationship research, correlation analysis is carried out to the relationship of the flora and clinical indices.By above step, confirm that SLE is pathogenic Relevant flora, so that the assessment for Disease Activity provides help.
2.2.1 the library of building of sample is sequenced
After extracting genomic DNA in fecal sample, the loading final concentration of all DNA is standardized as 5ng/ul, Volume is at least 2.5ul, i.e. gross mass is 12.5ng.The 16S metagenomic that we recommend according to Illumina Sequencing library preparation Operating Guideline handbook carries out the preparation before Jian Ku and upper machine.It is reported using MiSeq Software (MiSeq Reporter software, MSR) is accused to analyze MiSeq sequencing initial data.
2.2.2 data are analyzed
1. sequencing sequence statistics, Quality Control and assembling:
Initial data saves as fastq format.Connector, low quality sequence are removed using software, comparison data library is gone to decontaminate Sequence is contaminated, optimization is assembled；
2. sorting out to these reads, sequence is divided into OTU by threshold value of 97% similarity, OTU is represented into sequence It compares (Greengenes database (http://greengenes.lbl.gov/) etc.), obtains with corresponding microbiological data library The microbial species and gene expression abundance information that OTU is represented, after gene expression abundance value carries out square root conversion, using mean ± standard deviation Or median (quartile spacing) indicates；
3. detecting using Kruskal-Wallis rank sum test in multiple groups sample and obtaining abundance difference between different grouping Significant species carry out Spearman correlation analysis with clinical indices and go deep into its clinical meaning if discrepant flora Research.
2.3 result
The intestinal flora of 94 systemic loupus erythematosuses and 42 normal healthy controls crowds bacterium door level existence difference (P < 0.05), and the P/B ratio 0.46 (0.29-0.71) of patient is higher than healthy control group 0.32 (0.21-0.44), and difference has Significant statistical difference (P=0.0003), prompts the morbidity of P/B ratio and systemic loupus erythematosus closely related；With The increase of SLEDAI scoring is in increase trend, no significant difference (R=0.115, P=0.2694).Thus, working as When the P/B ratio of Patients with SLE is higher than normal person, then facilitate to assess disease condition.
Embodiment 3
P/B and the first-degree of systemic loupus erythematosus are studied
1. research object
Object in research is all examples 1 and SLE crowd and normal healthy controls crowd in example 2, these SLE patients It is to meet beauty in 1997 according to what clinical manifestation and laboratory examination results diagnosed by veteran rheumatology brainstrust The SLE patient for the SLE diagnostic criteria that rheumatism association, state formulates.For every SLE patient, the research purpose being apprised of it Agree to contribute its excrement afterwards for this research, and signs informed consent form.Merge pregnancy, autoimmune disease, rheumatic The SLE patient of disease and tumour is excluded.134 normal healthy controls crowds are that antibiotic or immunomodulator treatment, nothing is not used Pregnancy, tumour, infection or any autoimmune or rheumatic disease symptom or medical history healthy volunteer, these health aspirations Person agrees to contribute equally after being apprised of this research purpose its excrement for the research, and signs informed consent form.
When collecting stool sample, rheumatism expert carefully inquires and records each SLE patient and normal healthy controls crowd It (includes: gender, age, age of onset, the course of disease and antibiotic and immune that basic condition is recorded when situation, especially SLE patient The medicining condition of regulator) and collect clinical data include SLEDAI, anti-dsDNA, C3, C4 and Cr.Take donor fresh Everyone 10-50g of excrement, is put in sterile chamber with cover, takes back laboratory and saves in 4 DEG C of refrigerators, it is ensured that extracts in 4 hours DNA or be immediately placed on -80 DEG C save after later extract.And for normal healthy controls crowd, then carefully inquire medical history, including exhale Desorption system, cardiovascular system, endocrine system, hematological system, digestive system, skeletal musculature, nervous system etc. are each specially The case where section and medicining condition, emphasis exclude the medical histories such as pregnancy and autoimmune disease, rheumatic disease, tumour and resist The medication history of raw element and immunological regulation class drug.
2. experimental method and result
The extraction of 2.1DNA
In this study, we use QIAamp DNA stool Kit excrement genome DNA extracting reagent kit, from Extract DNA in the fecal sample of people, the composition of the kit is: QIAamp centrifugal column, collecting pipe, InhibitEXTM tablet, ASL lysate, AL liquid, AW1 washing lotion, AW2 washing lotion, AE eluent, Proteinase K.
2.2 research step
We carry out the enterobacteriaceae of excrement by 16S rRNA amplicon sequencing technologies to SLE case and normal healthy controls crowd The Research on differences of group structure and abundance searches significant difference flora.In order to further go deep into found flora and disease Relationship research, correlation analysis is carried out to the relationship of the flora and clinical indices.By above step, confirm that SLE is pathogenic Relevant flora, so that the assessment for disease activity provides help.
2.2.1 the library of building of sample is sequenced
After extracting genomic DNA in fecal sample, the loading final concentration of all DNA is standardized as 5ng/ul, Volume is at least 2.5ul, i.e. gross mass is 12.5ng.The 16S metagenomic that we recommend according to Illumina Sequencing library preparation Operating Guideline handbook carries out the preparation before Jian Ku and upper machine.It is reported using MiSeq Software (MiSeq Reporter software, MSR) is accused to analyze MiSeq sequencing initial data.
2.2.2 data are analyzed
1. sequencing sequence statistics, Quality Control and assembling:
Initial data saves as fastq format.Connector, low quality sequence are removed using software, comparison data library is gone to decontaminate Sequence is contaminated, optimization is assembled；
2. sorting out to these reads, sequence is divided into OTU by threshold value of 97% similarity, OTU is represented into sequence (Greengenes database (http://greengenes.lbl.gov/) etc.) is compared with corresponding microbiological data library, is obtained The microbial species and gene expression abundance information that OTU is represented are obtained, after gene expression abundance value carries out square root conversion, using mean ± standard Difference or median (quartile spacing) indicate；
3. detecting using Kruskal-Wallis rank sum test in multiple groups sample and obtaining abundance difference between different grouping Significant species go deep into it with clinical indices progress Spearman correlation analysis such as SLEDAI and face if discrepant flora The research of bed meaning.
2.3 result
The intestinal flora of 144 systemic loupus erythematosuses and 134 normal healthy controls crowds bacterium door level existence difference (P < 0.05), and the P/B ratio 0.44 (0.28-0.66) of patient is higher than healthy control group 0.28 (0.2-0.36), and difference has aobvious Statistical difference (P=3.44 × 10 of work-14), prompt the morbidity of P/B ratio and systemic loupus erythematosus closely related；With The increase of SLEDAI scoring is in increase (R=0.177, P=0.034).Thus, working as the P/B of Patients with SLE When ratio is higher than normal person, the ratio is bigger, then the state of an illness of patient is more movable, helps to assist commenting for disease condition mobility Estimate.Medical reference range (P is formulated using method of percentiles in addition, thus calculating2.5-P97.5) it is 0.13-0.63, as The healthy population reference range that the present invention uses.
Example IV
P/B and the first-degree of systemic loupus erythematosus are studied
1. research object
All patients and general population to be detected whether to increase there are P/B.
The extraction of 2.DNA
To sample to be detected, we use QIAamp DNA stool Kit excrement genomic DNA to extract examination Agent box extracts DNA from the fecal sample of people, and the composition of the kit is: QIAamp centrifugal column, collecting pipe, InhibitEXTM Tablet, ASL lysate, AL liquid, AW1 washing lotion, AW2 washing lotion, AE eluent, Proteinase K.
3. experimental procedure
We carry out the enterobacteriaceae of excrement by above-mentioned 16S rRNA amplicon sequencing technologies to all samples to be detected Group's detection carries out 16S rRNA genetic fragment using quantitative PCR technique by the sequencing of the two continuous hypervariable regions in the area V3-V4 Amplification, determines all amplified production sequences by high-flux sequence, analyzes bacterial species representated by each sequence and expresses rich Spend information.Calculate P/B ratio and with normal value [medical reference range (P2.5-P97.5)=0.13-0.63] compare, if should Ratio is greater than normal value, and the more big then patient groups Disease activity of ratio is higher.
It is specific as follows:
Kit described in 3.1 includes:
1) the forward and reverse primer freeze-dried powder of specificity in the PCR method amplification area bacterial 16 S rRNA gene V3-V4, forward primer sequence Column 5 ' -3 ':
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGAGGCTGCAG,
Reverse primer sequences 5 ' -3 ':
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACACGGGTATCTAATCC；
2)2×KAPA HiFi HotStart ReadyMix；
3) AMPure XP magnetic bead；
4) 1 primer of Nextera XT Index (N7XX), 2 primer (S5XX) of Nextera XT Index
5) HT1 liquid；
6) library PhiX reference substance；
7)10mM Tris-HCl,pH 8.5；
8)Illumina MiSeq Reagent Cartridge；
9) Illumina MiSeq PR2 (combination buffer)；
10) Illumina MiSeq Flow Cell (miseq flowing groove)；
11) nuclease-free water (nuclease-free water)；
12) sealing plate pad pasting；
13) hole 96- 0.2ml PCR plate.
3.2 detection methods
Sample builds library sequencing
After extracting genomic DNA in fecal sample, the loading final concentration of all DNA is standardized as 5ng/ul (Nuclease-free water dilution), volume is at least 2.5ul, i.e. gross mass is 12.5ng.
(1) PCR amplification
Reaction system are as follows:
2.5 μ l of microbe genome DNA (5ng/ul)；
5 μ l of amplicon PCR forward primer (1uM)；
5 μ l of amplicon PCR reverse primer (1uM)；
2 × KAPA Hifi hotstar readymix 12.5 μ l, 25 μ l of total system.
Response procedures are as follows:
95℃3min；
95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, totally 25 recycle；
72 DEG C of 5min, 4 DEG C of-∞.
The full-automatic nucleic acid-protein analysis system detection pcr amplification product about 550bp of Qsep100 is qualification, is carried out next Step operation.
(2) PCR is purified
1. room temperature is centrifuged amplicon PCR plate 1000g, 1min, sealing film is torn off；
2. be vortexed concussion AMPure XP magnetic bead 30s, magnetic bead is mixed, is expanded and is produced in above-mentioned PCR using Multi-channel liquid transfer device 20ul AMPure XP magnetic bead is added in every hole in object, replaces pipette tips in time after sample-adding；
3. softly being mixed 10 times up and down with pipettor, it is stored at room temperature and is incubated for 5min；
2min is stood 4. being put on magnetic frame；
PCR plate is placed in magnetic frame, is performed the following operation:
5. discarding supernatant using Multi-channel liquid transfer device, pipette tips are replaced；
6. 80% ethyl alcohol that the fresh configuration of 200ul is added in every hole is cleaned；
7. standing 30s, supernatant is siphoned away to greatest extent；
8. repeated washing is primary, supernatant is siphoned away to greatest extent；
9. being placed at room temperature for, 10min is air-dried；
10. removing amplicon PCR plate from magnetic frame, 52.5ul Nuclease-free water is added；
11. 10 times are blown and beaten about and is sufficiently mixed magnetic bead, are incubated at room temperature 2min；
12. amplicon PCR plate is put back to and stands 2min on magnetic frame, draws 50ul supernatant and 1 piece of 96 new hole PCR is added In plate, notice that replacing pipette tips in time avoids cross contamination.
(3)Index PCR
Reaction system are as follows:
DNA 5μl；
1 primer (N7XX) of Nextera XT Index, 5 μ l；
2 primer (S5XX) of Nextera XT Index, 5 μ l；
2×KAPA Hifi hotstar readymix 25μl；
10 μ l total system of Nuclease-free water, 50 μ l.
Index 1(i7) Primer sequence 5 ' -3 ' Index 2(i5) Primer sequence 5 ' -3 '
N701 TAAGGCGA S501 TAGATCGC
N702 CGTACTAG S502 CTCTCTAT
N703 AGGCAGAA S503 TATCCTCT
N704 TCCTGAGC S504 AGAGTAGA
N705 GGACTCCT S505 GTAAGGAG
N706 TAGGCATG S506 ACTGCATA
N707 CTCTCTAC S507 AAGGAGTA
N708 CAGAGAGG S508 CTAAGCCT
N709 GCTACGCT
N710 CGAGGCTG
N711 AAGAGGCA
N712 GTAGAGGA
Response procedures are as follows:
95℃3min；
95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, totally 25 recycle；
72 DEG C of 5min, 4 DEG C of-∞.
(4) PCR is purified
1. being centrifuged above-mentioned index PCR plate 280g, 1min at room temperature, sealing film is torn off；
2. be vortexed concussion AMPure XP magnetic bead 30s mix magnetic bead, using the volley of rifle fire in the PCR product of above-mentioned label every hole 56ul AMPure XP magnetic bead is added, pays attention to replacing pipette tips in time；
3. being mixed 10 times up and down with pipettor, it is stored at room temperature 5min；
2min is stood 4. being placed on magnetic frame；
5. being discarded supernatant using the volley of rifle fire；
6. 80% ethyl alcohol that the fresh configuration of 200ul is added in every hole is cleaned；
7. standing 30s, supernatant is siphoned away to greatest extent；
8. repeated washing 1 time, siphoning away supernatant；
9. being placed at room temperature for 10min, air-dry；
10. taking out index PCR plate from magnetic frame, 27.5ul Nuclease-free water is added；
11. 10 times are blown and beaten about and is sufficiently mixed magnetic bead, are incubated at room temperature 2min；
12. relaying index PCR plate on magnetic frame, draws 25ul supernatant and 1 piece of 96 new hole PCR plate is added In, notice that replacing pipette tips in time avoids cross contamination.
13. after magnetic beads for purifying, the full-automatic nucleic acid-protein analysis system detection library size about 630bp of Qsep100 is to close Lattice can carry out next step operation.
(5) the quantitative of library, standardization and pond (pooling)
Calculate the concentration in library, DNA concentration (nM)=DNA library concentration (ng/ μ l)/[(660g/mol × average library Size] × 106。
Based on above-mentioned library concentration, it is diluted to 4nM, then each library respectively takes 5ul to carry out pond.
(6) library denaturation and Miseq sample loading
1) DNA denaturation and dilution
1. the 5 μ l of 0.2N NaOH of 5 μ l of 4nM pooled library and fresh configuration are added in microcentrifugal tube.
2. adequately mixing, room temperature is centrifuged 280g, 1min；
3. being incubated at room temperature 5min；
4. the hybridization buffer HT1 preparation 20pM denaturation library of 990 μ l pre-cooling is added；
5. taking above-mentioned 120ul 20pM denaturation library, the hybridization buffer HT1 preparation 4pM loading that 480ul pre-cooling is added becomes Property library, be sufficiently mixed, be placed in stand-by on ice.
2) denaturation and dilution of the library PhiX reference substance
4nM PhiX is made in the 10mM Tris-HCl, pH 8.5 for taking 2 μ l of 10nM PhiX library that 3 μ l are added Library, remaining step are denaturalized and dilute with above-mentioned DNA.
3) mixing of sublibrary and the library PhiX reference substance is expanded
1. above-mentioned 30 μ l of the diluted library PhiX reference substance and amplification 570 μ l of sublibrary is taken to be mixed, it is then placed on ice On until next step operate；
2. being placed on 96 DEG C of heating 2min on heated at constant temperature instrument；
3. carrying out ice bath 5min immediately after mixing 1-2 times after being incubated for, it is sequenced to upper machine.
4) it is sequenced
Using MiSeq sequenator carry out be sequenced and by MiSeq reporting software (MiSeq Reporter software, MSR) MiSeq sequencing initial data is analyzed.
Data analysis
2) sequencing sequence statistics, Quality Control and assembling
Initial data saves as fastq format.Connector, low quality sequence are removed using software, comparison data library is gone to decontaminate Sequence is contaminated, optimization is assembled；
2) these sequencing sequences are sorted out, sequence is divided into OTU as threshold value using 97% similarity, OTU is represented into sequence Column compare (Greengenes database (http://greengenes.lbl.gov/) etc.) with corresponding microbiological data library, Proteus and Bacteroidetes microbial species and gene expression abundance information are obtained, gene expression abundance carries out subduplicate conversion；
3) the relevant enteron aisle P/B ratio of computing system Erythematosus Disease.
4. experimental result:
The risk factors that testing result is SLE when being high P/B ratio, and the value the big, and SLE disease is prompted to be likely to be at High mobility.
Sequence table
<110>The Third Affiliated Hospital of Zhongshan University
<120>the condition assessment system and kit of a kind of systemic loupus erythematosus
<130> PJ1910325.06
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 1
taaggcga 8
<210> 2
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 2
cgtactag 8
<210> 3
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 3
aggcagaa 8
<210> 4
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 4
tcctgagc 8
<210> 5
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 5
ggactcct 8
<210> 6
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 6
taggcatg 8
<210> 7
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 7
ctctctac 8
<210> 8
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 8
cagagagg 8
<210> 9
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 9
gctacgct 8
<210> 10
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 10
cgaggctg 8
<210> 11
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 11
aagaggca 8
<210> 12
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 12
gtagagga 8
<210> 13
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 13
tagatcgc 8
<210> 14
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 14
ctctctat 8
<210> 15
<211> 7
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 15
atcctct 7
<210> 16
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 16
agagtaga 8
<210> 17
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 17
gtaaggag 8
<210> 18
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 18
actgcata 8
<210> 19
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 19
aaggagta 8
<210> 20
<211> 8
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 20
ctaagcct 8
<210> 21
<211> 50
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 21
tcgtcggcag cgtcagatgt gtataagaga cagcctacgg gaggctgcag 50
<210> 22
<211> 55
<212> DNA
<213>artificial sequence (" artificial sequence ")
<400> 22
gtctcgtggg ctcggagatg tgtataagag acaggactac acgggtatct aatcc 55

Claims (9)

  1. The ratio of relevant Proteobacteria/Bacteroidetes 1. a kind of assessment system lupus erythematosus is caused a disease, it is special Sign is that the P/B ratio is the enteron aisle Proteobacteria/Bacteroidetes calculated in sample.
  2. The ratio of relevant P/B 2. a kind of systemic loupus erythematosus as claimed in claim 1 is caused a disease, which is characterized in that described Sample is excrement.
  3. 3. a kind of appraisal procedure of the activity of systemic loupus erythematosus, which is characterized in that the appraisal procedure is to calculate to suffer from The P/B ratio of person, then compares the ratio and healthy population reference value, according to comparison result to Patients with SLE It is assessed.
  4. 4. appraisal procedure as claimed in claim 3, which is characterized in that the appraisal procedure comprises the following steps that
    1) DNA in sample to be tested excrement is extracted；
    2) amplification label and sequencing are carried out to it by PCR method using 16S rRNA gene V3-V4 area's specific primer；
    3) sequencing gained sequencing sequence is sorted out, sequence is divided into OTU by threshold value of 97% similarity, OTU is represented into sequence Column are compared with corresponding microbiological data library, obtain Proteobacteria and Bacteroidetes microbial species and gene expression abundance information, right Gene expression abundance carries out subduplicate conversion；
    4) P/B ratio is calculated；
    5) the P/B ratio being calculated is compared with healthy population reference value, according to comparison result to systemic red yabbi Sore patient assesses.
  5. The detection method of relevant P/B ratio 5. a kind of systemic loupus erythematosus is caused a disease, which is characterized in that the method includes Following steps:
    First: sample builds library sequencing
    After extracting genomic DNA in fecal sample, the loading final concentration of all DNA is standardized as 5ng/ul, volume At least 2.5ul, i.e. gross mass are 12.5ng；
    (1) PCR amplification
    Reaction system are as follows:
    2.5 μ l of microbe genome DNA 5ng/ul；
    5 μ l of amplicon PCR forward primer 1uM；
    5 μ l of amplicon PCR reverse primer 1uM；
    2 × KAPA Hifi hotstar readymix 12.5 μ l, 25 μ l of total system；
    Response procedures are as follows:
    95℃3min；
    95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, totally 25 recycle；
    72 DEG C of 5min, 4 DEG C of-∞；
    The full-automatic nucleic acid-protein analysis system detection pcr amplification product about 550bp of Qsep100 is qualification, carries out next step behaviour Make；
    (2) PCR is purified
    1. room temperature is centrifuged amplicon PCR plate 1000g, 1min, sealing film is torn off；
    2. be vortexed concussion AMPure XP magnetic bead 30s, magnetic bead is mixed, it is every in above-mentioned pcr amplification product using Multi-channel liquid transfer device 20ul AMPure XP magnetic bead is added in hole, replaces pipette tips in time after sample-adding；
    3. softly being mixed 10 times up and down with pipettor, it is stored at room temperature and is incubated for 5min；
    2min is stood 4. being put on magnetic frame；
    PCR plate is placed in magnetic frame, is performed the following operation:
    5. discarding supernatant using Multi-channel liquid transfer device, pipette tips are replaced；
    6. 80% ethyl alcohol that the fresh configuration of 200ul is added in every hole is cleaned；
    7. standing 30s, supernatant is siphoned away to greatest extent；
    8. repeated washing is primary, supernatant is siphoned away to greatest extent；
    9. being placed at room temperature for, 10min is air-dried；
    10. removing amplicon PCR plate from magnetic frame, 52.5ul Nuclease-free water is added；
    11. 10 times are blown and beaten about and is sufficiently mixed magnetic bead, are incubated at room temperature 2min；
    12. amplicon PCR plate is put back to and stands 2min on magnetic frame, draws 50ul supernatant and 1 piece of 96 new hole PCR plate is added In, replacement pipette tips avoid cross contamination；
    (3)Index PCR
    Reaction system are as follows:
    DNA 5μl；
    1 primer (N7XX) of Nextera XT Index, 5 μ l；
    2 primer (S5XX) of Nextera XT Index, 5 μ l；
    2×KAPA Hifi hotstar readymix 25μl；
    10 μ l total system of Nuclease-free water, 50 μ l；
    Response procedures are as follows:
    95℃3min；
    95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, totally 25 recycle；
    72 DEG C of 5min, 4 DEG C of-∞；
    (4) PCR is purified
    1. being centrifuged above-mentioned index PCR plate 280g, 1min at room temperature, sealing film is torn off；
    2. the concussion AMPure XP magnetic bead 30s that is vortexed mixes magnetic bead, using the volley of rifle fire, every hole is added in the PCR product of above-mentioned label 56ul AMPure XP magnetic bead pays attention to replacing pipette tips in time；
    3. being mixed 10 times up and down with pipettor, it is stored at room temperature 5min；
    2min is stood 4. being placed on magnetic frame；
    5. being discarded supernatant using the volley of rifle fire；
    6. 80% ethyl alcohol that the fresh configuration of 200ul is added in every hole is cleaned；
    7. standing 30s, supernatant is siphoned away to greatest extent；
    8. repeated washing 1 time, siphoning away supernatant；
    9. being placed at room temperature for 10min, air-dry；
    10. taking out index PCR plate from magnetic frame, 27.5ul Nuclease-free water is added；
    11. 10 times are blown and beaten about and is sufficiently mixed magnetic bead, are incubated at room temperature 2min；
    12. relaying index PCR plate on magnetic frame, draws 25ul supernatant and be added in 1 piece of 96 new hole PCR plate, more It changes pipette tips and avoids cross contamination；
    13. after magnetic beads for purifying, the full-automatic nucleic acid-protein analysis system detection library size about 630bp of Qsep100 is qualification, can Carry out next step operation；
    (5) the quantitative of library, standardization and pond
    The concentration in calculating library, DNA concentration (nM)=DNA library concentration (ng/ μ l)/[(660g/mol × average library is big It is small] × 106；
    Based on above-mentioned library concentration, it is diluted to 4nM, then each library respectively takes 5ul to carry out pond；
    (6) library denaturation and Miseq sample loading
    1) DNA denaturation and dilution
    1. 0.2 N NaOH, the 5 μ l of 5 μ l of 4nM pooled library and fresh configuration are added in microcentrifugal tube；
    2. adequately mixing, room temperature is centrifuged 280g, 1min；
    3. being incubated at room temperature 5min；
    4. the HT1 hybridization buffer preparation 20pM denaturation library of 990 μ l pre-cooling is added；
    5. taking above-mentioned 120ul20pM denaturation library, the HT1 hybridization buffer preparation 4pM loading denaturation text of 480ul pre-cooling is added Library is sufficiently mixed, and is placed in stand-by on ice；
    2) denaturation and dilution of the library PhiX reference substance
    4nM PhiX library is made in the 10mM Tris-HCl, pH8.5 for taking 2 μ l of 10nM PhiX library that 3 μ l are added, Remaining step is denaturalized and dilutes with above-mentioned DNA；
    3) mixing of sublibrary and the library PhiX reference substance is expanded
    1. above-mentioned 30 μ l of the diluted library PhiX reference substance and amplification 570 μ l of sublibrary is taken to be mixed, then it is placed on straight on ice It is operated to next step；
    2. being placed on 96 DEG C of heating 2min on heated at constant temperature instrument；
    3. carrying out ice bath 5min immediately after mixing 1-2 times after being incubated for, it is sequenced to upper machine；
    4) it is sequenced
    It carries out sequencing using MiSeq sequenator and initial data is sequenced to MiSeq by MiSeq reporting software to analyze；
    Second: data analysis
    1) sequencing sequence statistics, Quality Control and assembling
    Initial data saves as fastq format, removes connector, low quality sequence using software, depollution sequence is gone in comparison data library Column, assemble optimization；
    2) these sequencing sequences are sorted out, by sequence using 97% similarity as threshold value divide OTU, by OTU represent sequence with Corresponding microbiological data library compares, and obtains proteus and Bacteroidetes microbial species and gene expression abundance information, expresses rich Degree carries out subduplicate conversion；
    3) the relevant enteron aisle P/B ratio of computing system Erythematosus Disease.
  6. 6. a kind of kit for the assessment system lupus erythematosus state of an illness, which is characterized in that include in the kit:
    1) the forward and reverse primer freeze-dried powder of specificity in the PCR method amplification area bacterial 16 S rRNA gene V3-V4,
    Forward primer sequence 5 ' -3 ':
    TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGAGGCTGCAG,
    Reverse primer sequences 5 ' -3 ':
    GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACACGGGTATCTAATCC；
    2)2×KAPA HiFi HotStart ReadyMix；
    3) AMPure XP magnetic bead；
    4) 1 primer of Nextera XT Index (N7XX), 2 primer (S5XX) of Nextera XT Index
    5)HT1；
    6) library PhiX reference substance；
    7)10mM Tris-HCl,pH8.5
    8)Illumina MiSeq Reagent Cartridge；
    9)Illumina MiSeq PR2；
    10)Illumina MiSeq Flow Cell；
    11)nuclease-free water；
    12) sealing plate pad pasting；
    13) hole 96- 0.2ml PCR plate.
  7. 7. a kind of drug, which is characterized in that the drug is used to adjust the quantity of Proteobacteria and Bacteroidetes in enteron aisle.
  8. 8. drug as claimed in claim 7, which is characterized in that the drug effect is dead by induced distortion bacterium or presses down Mycetozoan growth processed, or inhibit the death of bacteroid and promote the intervention of the related pathways such as bacteroid growth.
  9. Application of the relevant P/B in systemic loupus erythematosus condition assessment and treatment 9. a kind of systemic loupus erythematosus is caused a disease.
CN201910317741.5A 2019-04-19 2019-04-19 A kind of the condition assessment system and its kit of systemic loupus erythematosus Pending CN110029181A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910317741.5A CN110029181A (en) 2019-04-19 2019-04-19 A kind of the condition assessment system and its kit of systemic loupus erythematosus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910317741.5A CN110029181A (en) 2019-04-19 2019-04-19 A kind of the condition assessment system and its kit of systemic loupus erythematosus

Publications (1)

Publication Number Publication Date
CN110029181A true CN110029181A (en) 2019-07-19

Family

ID=67239220

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910317741.5A Pending CN110029181A (en) 2019-04-19 2019-04-19 A kind of the condition assessment system and its kit of systemic loupus erythematosus

Country Status (1)

Country Link
CN (1) CN110029181A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110904193A (en) * 2019-12-20 2020-03-24 中南大学湘雅二医院 Method for selecting systemic lupus erythematosus skin microbial diagnosis marker
CN113789289A (en) * 2021-11-05 2021-12-14 中山大学附属第三医院粤东医院 Intestinal microorganism combination for evaluating risk of systemic lupus erythematosus and detection reagent thereof
CN113930479A (en) * 2021-11-25 2022-01-14 上海锐翌生物科技有限公司 Marker microorganism of systemic lupus erythematosus and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016164402A1 (en) * 2015-04-06 2016-10-13 Oklahoma Medical Research Foundation Methods of diagnosing and treating autoimmune disease
CN107904298A (en) * 2017-12-29 2018-04-13 苏州普瑞森基因科技有限公司 A kind of kit and its application for being used to analyze enteric microorganism
WO2018209149A1 (en) * 2017-05-10 2018-11-15 New York University Methods and compositions for treating and diagnosing autoimmune diseases
CN108841951A (en) * 2018-07-19 2018-11-20 南京鼓楼医院 A kind of RNASE2 gene primer pair and its kit for systemic lupus erythematosus diagnosis and detection disease activity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016164402A1 (en) * 2015-04-06 2016-10-13 Oklahoma Medical Research Foundation Methods of diagnosing and treating autoimmune disease
WO2018209149A1 (en) * 2017-05-10 2018-11-15 New York University Methods and compositions for treating and diagnosing autoimmune diseases
CN107904298A (en) * 2017-12-29 2018-04-13 苏州普瑞森基因科技有限公司 A kind of kit and its application for being used to analyze enteric microorganism
CN108841951A (en) * 2018-07-19 2018-11-20 南京鼓楼医院 A kind of RNASE2 gene primer pair and its kit for systemic lupus erythematosus diagnosis and detection disease activity

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHIXING HE等: "Alterations of the gut microbiome in Chinese patients with systemic lupus erythematosus", 《GUT PATHOG》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110904193A (en) * 2019-12-20 2020-03-24 中南大学湘雅二医院 Method for selecting systemic lupus erythematosus skin microbial diagnosis marker
CN113789289A (en) * 2021-11-05 2021-12-14 中山大学附属第三医院粤东医院 Intestinal microorganism combination for evaluating risk of systemic lupus erythematosus and detection reagent thereof
CN113930479A (en) * 2021-11-25 2022-01-14 上海锐翌生物科技有限公司 Marker microorganism of systemic lupus erythematosus and application thereof
CN113930479B (en) * 2021-11-25 2023-11-24 上海锐翌生物科技有限公司 Systemic lupus erythematosus marker microorganism and application thereof

Similar Documents

Publication Publication Date Title
Shoskes et al. Analysis of gut microbiome reveals significant differences between men with chronic prostatitis/chronic pelvic pain syndrome and controls
Bahl et al. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis
CN109913567A (en) Systemic loupus erythematosus is caused a disease the detection method and kit of relevant intestinal flora
WO2014019271A1 (en) Biomarkers for diabetes and usages thereof
US20160153054A1 (en) Biomarkers for colorectal cancer
US20080020379A1 (en) Diagnosis and prognosis of infectious diseases clinical phenotypes and other physiologic states using host gene expression biomarkers in blood
Robinson et al. Intricacies of assessing the human microbiome in epidemiologic studies
CN111315884B (en) Normalization of sequencing libraries
CN110029181A (en) A kind of the condition assessment system and its kit of systemic loupus erythematosus
CN112899368B (en) Biomarker for early diagnosis of primary hepatocellular carcinoma, detection reagent and application thereof
US20230272466A1 (en) Absolute quantification of nucleic acids and related methods and systems
CN108060245A (en) Primer sets, kit and the method for enteric microorganism genetic test based on high-flux sequence
CN112029844B (en) Use of intestinal microorganisms for diagnosing dystonia
CN107937582A (en) A kind of primer sets and its application for being used to analyze enteric microorganism
Tao et al. Bacterial community mapping of the intestinal tract in acute pancreatitis rats based on 16S rDNA gene sequence analysis
CN110452974A (en) A kind of detection bacterium 16S rDNA overall length builds library sequencing approach
Brugère et al. Tools for stools: the challenge of assessing human intestinal microbiota using molecular diagnostics
CN115261499B (en) Intestinal microbial marker related to endurance and application thereof
Boxberger et al. Complete genome and description of Corynebacterium incognita sp. nov.: a new bacterium within the Corynebacterium genus
US20160244839A1 (en) Methods for distinguishing inflammatory bowel diseases using microbial community signatures
CN115867676A (en) Method for treating cell population and method for analyzing gene contained in cell population
Sirangelo Human gut microbiome analysis and multi-omics approach
Lawley et al. Nucleic acid-based methods to assess the composition and function of the bowel microbiota
Bruggeling et al. Optimized DNA isolation method for microbiome analysis of human tissues
Almonacid et al. 16S rRNA gene sequencing as a clinical diagnostic aid for gastrointestinal-related conditions

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination